ID: 1142029916

View in Genome Browser
Species Human (GRCh38)
Location 16:87833355-87833377
Sequence CCGGGTGTGGACCTGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142029916_1142029933 28 Left 1142029916 16:87833355-87833377 CCTTCCTGCAGGTCCACACCCGG No data
Right 1142029933 16:87833406-87833428 TTCACAGCAGGCAGGGCCGGAGG 0: 1
1: 0
2: 1
3: 20
4: 262
1142029916_1142029934 29 Left 1142029916 16:87833355-87833377 CCTTCCTGCAGGTCCACACCCGG No data
Right 1142029934 16:87833407-87833429 TCACAGCAGGCAGGGCCGGAGGG 0: 1
1: 0
2: 0
3: 22
4: 305
1142029916_1142029930 20 Left 1142029916 16:87833355-87833377 CCTTCCTGCAGGTCCACACCCGG No data
Right 1142029930 16:87833398-87833420 CTGGACTGTTCACAGCAGGCAGG 0: 1
1: 0
2: 1
3: 12
4: 263
1142029916_1142029928 16 Left 1142029916 16:87833355-87833377 CCTTCCTGCAGGTCCACACCCGG No data
Right 1142029928 16:87833394-87833416 ATGCCTGGACTGTTCACAGCAGG 0: 1
1: 0
2: 1
3: 14
4: 135
1142029916_1142029925 1 Left 1142029916 16:87833355-87833377 CCTTCCTGCAGGTCCACACCCGG No data
Right 1142029925 16:87833379-87833401 CCACCACCTGGACACATGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 229
1142029916_1142029932 25 Left 1142029916 16:87833355-87833377 CCTTCCTGCAGGTCCACACCCGG No data
Right 1142029932 16:87833403-87833425 CTGTTCACAGCAGGCAGGGCCGG 0: 1
1: 0
2: 1
3: 42
4: 419
1142029916_1142029935 30 Left 1142029916 16:87833355-87833377 CCTTCCTGCAGGTCCACACCCGG No data
Right 1142029935 16:87833408-87833430 CACAGCAGGCAGGGCCGGAGGGG No data
1142029916_1142029931 21 Left 1142029916 16:87833355-87833377 CCTTCCTGCAGGTCCACACCCGG No data
Right 1142029931 16:87833399-87833421 TGGACTGTTCACAGCAGGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142029916 Original CRISPR CCGGGTGTGGACCTGCAGGA AGG (reversed) Intronic
No off target data available for this crispr