ID: 1142029919

View in Genome Browser
Species Human (GRCh38)
Location 16:87833359-87833381
Sequence TGGCCCGGGTGTGGACCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 175}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142029919_1142029933 24 Left 1142029919 16:87833359-87833381 CCTGCAGGTCCACACCCGGGCCA 0: 1
1: 0
2: 0
3: 27
4: 175
Right 1142029933 16:87833406-87833428 TTCACAGCAGGCAGGGCCGGAGG 0: 1
1: 0
2: 1
3: 20
4: 262
1142029919_1142029930 16 Left 1142029919 16:87833359-87833381 CCTGCAGGTCCACACCCGGGCCA 0: 1
1: 0
2: 0
3: 27
4: 175
Right 1142029930 16:87833398-87833420 CTGGACTGTTCACAGCAGGCAGG 0: 1
1: 0
2: 1
3: 12
4: 263
1142029919_1142029931 17 Left 1142029919 16:87833359-87833381 CCTGCAGGTCCACACCCGGGCCA 0: 1
1: 0
2: 0
3: 27
4: 175
Right 1142029931 16:87833399-87833421 TGGACTGTTCACAGCAGGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 205
1142029919_1142029925 -3 Left 1142029919 16:87833359-87833381 CCTGCAGGTCCACACCCGGGCCA 0: 1
1: 0
2: 0
3: 27
4: 175
Right 1142029925 16:87833379-87833401 CCACCACCTGGACACATGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 229
1142029919_1142029934 25 Left 1142029919 16:87833359-87833381 CCTGCAGGTCCACACCCGGGCCA 0: 1
1: 0
2: 0
3: 27
4: 175
Right 1142029934 16:87833407-87833429 TCACAGCAGGCAGGGCCGGAGGG 0: 1
1: 0
2: 0
3: 22
4: 305
1142029919_1142029932 21 Left 1142029919 16:87833359-87833381 CCTGCAGGTCCACACCCGGGCCA 0: 1
1: 0
2: 0
3: 27
4: 175
Right 1142029932 16:87833403-87833425 CTGTTCACAGCAGGCAGGGCCGG 0: 1
1: 0
2: 1
3: 42
4: 419
1142029919_1142029928 12 Left 1142029919 16:87833359-87833381 CCTGCAGGTCCACACCCGGGCCA 0: 1
1: 0
2: 0
3: 27
4: 175
Right 1142029928 16:87833394-87833416 ATGCCTGGACTGTTCACAGCAGG 0: 1
1: 0
2: 1
3: 14
4: 135
1142029919_1142029935 26 Left 1142029919 16:87833359-87833381 CCTGCAGGTCCACACCCGGGCCA 0: 1
1: 0
2: 0
3: 27
4: 175
Right 1142029935 16:87833408-87833430 CACAGCAGGCAGGGCCGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142029919 Original CRISPR TGGCCCGGGTGTGGACCTGC AGG (reversed) Intronic
900316723 1:2060714-2060736 TGGTCTGGGGCTGGACCTGCCGG + Intronic
900364216 1:2304229-2304251 TCTCCCTGGTGTGGAGCTGCCGG + Intronic
900458820 1:2790406-2790428 TGGACCTGGTGGGGACTTGCAGG - Intronic
901792033 1:11658729-11658751 TGGCCTGGCTGCGAACCTGCAGG - Exonic
902731673 1:18373938-18373960 AGGCCCGGGCCTGGGCCTGCTGG - Intronic
902813565 1:18903091-18903113 TGGCCGCGCTGTGGCCCTGCGGG - Intronic
903668047 1:25019695-25019717 TGGCCCCGGTGTGGAAATGTGGG - Intergenic
903886928 1:26546131-26546153 TGGCCCAGGCCTGGCCCTGCAGG + Intronic
904390988 1:30185888-30185910 TGGCCCAGGAGTGGACCTCTGGG - Intergenic
906448756 1:45925561-45925583 TGGCCCAGCTGTAGGCCTGCTGG + Intronic
907047629 1:51309353-51309375 TGGCCCAGGTGGGCAGCTGCAGG + Intronic
907222069 1:52914444-52914466 GGGCCCAGGTGTGGGACTGCAGG + Intronic
908293217 1:62688303-62688325 CGGGCCGGGTGCGGACCGGCGGG + Exonic
908527420 1:65001442-65001464 TGGCGTGGGTGGGGACCTCCGGG - Intergenic
917495563 1:175537334-175537356 TTGCCCGGGTGTGGACCTAGGGG + Intronic
919788108 1:201273012-201273034 TGGTCCGTGTGAGGACCAGCTGG - Intergenic
1063173643 10:3532707-3532729 TGGCCAGGGTGGGGACAGGCAGG - Intergenic
1063464404 10:6233548-6233570 TGGAAGGTGTGTGGACCTGCAGG - Exonic
1067336871 10:45373844-45373866 AGGCCCTGGGGTGGAGCTGCGGG - Intergenic
1072921318 10:99579415-99579437 TGGCCTGGGTGTGCCCCTGTGGG - Intergenic
1075741981 10:124701558-124701580 TGGCCTGAGTGTGGGCGTGCGGG + Intronic
1076273617 10:129177865-129177887 TGGCCTGAGCGTGGAGCTGCTGG - Intergenic
1076721735 10:132396201-132396223 TGAGCCGGGTGCGGACGTGCTGG + Intergenic
1076778237 10:132709859-132709881 TGGGCCGGCTGTGGGCCTGCAGG - Intronic
1076844004 10:133060258-133060280 CGGGGCGGGTGTGAACCTGCCGG - Intergenic
1078060385 11:8039308-8039330 GGGCCGGAGTGTGGAGCTGCCGG - Intronic
1079363730 11:19791421-19791443 TGGCCCAGGTGTGGAGCCCCTGG + Intronic
1081787354 11:45756824-45756846 TGGCCTGGATGTGGCCCTGGGGG - Intergenic
1083099896 11:60292282-60292304 TGGCCCTGGTGTGCCCCAGCTGG + Exonic
1089747539 11:120627695-120627717 GGGCCCTGGTGTAGCCCTGCTGG + Intronic
1090105644 11:123851717-123851739 TGGCCAGGCTGTGGTCCTGGGGG + Intergenic
1090773694 11:129944920-129944942 TGGCCCGGGTGAGCACCGGCCGG + Exonic
1091493709 12:953978-954000 TGGCAGGGGTGTGGACATACAGG - Intronic
1091795484 12:3295376-3295398 TGTGCAGGGTGTGGACGTGCTGG + Intergenic
1095465575 12:42484362-42484384 TGGCCCGCGCGTGCACCTGCGGG - Intronic
1104722437 12:131052305-131052327 TGGCGTGGGTGGGCACCTGCTGG + Intronic
1106229383 13:27809971-27809993 TGAGCCAGGTGTGTACCTGCAGG - Intergenic
1113866777 13:113531652-113531674 CAGCACGCGTGTGGACCTGCAGG + Intronic
1117902551 14:60550650-60550672 TGGCATGGGTGTGTGCCTGCTGG + Intergenic
1118843404 14:69528622-69528644 TGGCCCTGGTGTGGACCCAAAGG - Exonic
1119856467 14:77904756-77904778 TGGTCAGGGTGTGACCCTGCTGG + Intronic
1121015790 14:90548232-90548254 TGGCCCTGGAGTGGCCCAGCAGG - Intronic
1121452808 14:94020215-94020237 TGGGCTGGATGTGGAGCTGCAGG - Intergenic
1122032079 14:98919591-98919613 TGGCCAAGGTGGGGACCTGCTGG - Intergenic
1122123985 14:99569395-99569417 GGGCCCAGGTGTGGACATCCAGG - Intronic
1122694169 14:103544847-103544869 GGGCCTGGGTGTGAACCTGGAGG - Intergenic
1122770099 14:104094001-104094023 TGGGACGGGTGAGGAGCTGCAGG + Intronic
1122945750 14:105008121-105008143 TGGCCCAGATGTGGCCCAGCAGG + Intronic
1122976174 14:105171695-105171717 TGGCCCAGGTGGGGCCCTGTGGG - Intergenic
1122976401 14:105172657-105172679 AGGCCTGGGGGTGGGCCTGCTGG - Intergenic
1123034740 14:105467305-105467327 GGGCCCGGGTGTGCAAGTGCTGG + Intronic
1123124760 14:105938266-105938288 TGGCCTGGGTGTGTGTCTGCTGG - Intergenic
1123627150 15:22235458-22235480 TGGCTGGAATGTGGACCTGCTGG + Intergenic
1124223495 15:27869880-27869902 TGTCCCGGCTGTGGCCCAGCTGG - Intronic
1125759107 15:42085009-42085031 TGCCTGGGGTGTGGACCAGCAGG - Intronic
1126166600 15:45659010-45659032 TGGCCCCGGTGTGCAGCTGAAGG - Exonic
1127328080 15:57914953-57914975 TGGGCCGGGTGAGGACCGACTGG + Intergenic
1129263277 15:74380901-74380923 TGGCATGGGTGTGGGCCTGGGGG - Intergenic
1130296114 15:82647870-82647892 TGGGGCCGGTGTGGCCCTGCGGG + Intronic
1131269188 15:90935996-90936018 GGGCCCTGGTGTGGAGCTGTAGG + Intronic
1132391833 15:101444833-101444855 TGGCCCAGGTGGAGACCTGGAGG + Intronic
1133233056 16:4375312-4375334 TGGAGCAGGTGTGGACCAGCTGG - Intronic
1133233758 16:4378408-4378430 TGACCCTGGTCTGGCCCTGCTGG + Intronic
1136286723 16:29248498-29248520 TGACCCAGGCCTGGACCTGCTGG + Intergenic
1136397162 16:29999397-29999419 TGGCCAGGGCGTGGGCCTCCAGG - Intronic
1137547350 16:49413651-49413673 TGGCCAGGCTGTGGACCAGAGGG - Intergenic
1139561227 16:67743671-67743693 AGGCCCAGATGTGGCCCTGCAGG - Intronic
1141906336 16:87029188-87029210 TGTCCCAGGTGTGGCCCTGGAGG - Intergenic
1141936003 16:87238193-87238215 TGGCATGGGTGTGGCTCTGCTGG - Intronic
1142007184 16:87695063-87695085 AGGCCTGGGAGTGGAACTGCTGG + Intronic
1142029919 16:87833359-87833381 TGGCCCGGGTGTGGACCTGCAGG - Intronic
1142179708 16:88662494-88662516 CGGCACGGATGTGGGCCTGCGGG + Intronic
1142381324 16:89733874-89733896 TGGCCCGGGTGCGGCTCTGAGGG + Intronic
1142505361 17:360113-360135 TGGCCGGGGTAAGGACTTGCGGG - Intronic
1144845715 17:18217846-18217868 TGGCCTGGGGGTGGACCTGATGG - Intergenic
1147325026 17:39665977-39665999 TGGCCAGTGTGTGGACCGCCAGG + Exonic
1148156950 17:45430026-45430048 GGGCTCGGGTGGGGACCTGGCGG + Intronic
1148482842 17:47971252-47971274 TGGCCCCGTTCTGGCCCTGCAGG + Intronic
1151703168 17:75753945-75753967 GGGCCCGGGTGTCGCACTGCGGG - Exonic
1151817347 17:76477808-76477830 TGGCCAGGCTGTGGTCCTGATGG - Intronic
1152407462 17:80105793-80105815 GTGCCCGGCTGTGGACATGCGGG - Intergenic
1152855567 17:82663298-82663320 TGGCTCGGGGGTGGCCCAGCAGG + Intronic
1158226303 18:55205114-55205136 TGGCCAGAATGTGGACTTGCTGG + Intergenic
1160298481 18:77658308-77658330 AGGCCTGGGTGAGTACCTGCAGG + Intergenic
1160940206 19:1617268-1617290 TGGCCCGGGCGTGGGGCTGTAGG - Intronic
1161322178 19:3646388-3646410 TGGCCTGGCTGGGGCCCTGCTGG + Intronic
1162753582 19:12843665-12843687 TGGCCTGGGTGTGGGTCTTCAGG - Intronic
1163148507 19:15398197-15398219 TGGCCCAGGTGGGGACCGGAAGG + Intronic
1163168595 19:15515037-15515059 TGCCCAGGGCGTGGATCTGCTGG + Intronic
1163761628 19:19140096-19140118 TGGCCCTGGTCTGGATGTGCGGG + Intergenic
1165143080 19:33714130-33714152 TAGCCCGGTAGTGGAACTGCGGG - Intronic
1167234973 19:48308886-48308908 AGGCCCGGGTCTGTAGCTGCGGG - Intronic
1167661578 19:50798767-50798789 GGGCCCGGCTGTACACCTGCAGG + Exonic
1167672084 19:50859229-50859251 TGGCCCAGGTGAGGCCCTGCAGG - Intronic
1167674838 19:50877655-50877677 TGGCCCAGGTGAGGCCCTGCAGG - Intronic
1168474349 19:56665114-56665136 GGGCCAGGTTGAGGACCTGCAGG - Exonic
1168544831 19:57241558-57241580 TGGACCGGGTAGGGACTTGCAGG - Intronic
925286659 2:2720867-2720889 TGGCTGGGGTGTGGAGGTGCAGG - Intergenic
925286677 2:2720935-2720957 TGGCTGGGGTGTGGAGGTGCAGG - Intergenic
925286695 2:2721003-2721025 TGGCCGGGGTGTGGAGGTGCAGG - Intergenic
925286704 2:2721037-2721059 TGGCTGGGGTGTGGAGGTGCAGG - Intergenic
925286723 2:2721105-2721127 TGGCCAGGGTGTGGAGATGCAGG - Intergenic
925286730 2:2721139-2721161 TGGCCAGGGTGTGGAGGTGCAGG - Intergenic
925286738 2:2721173-2721195 TGGCCAGGGTGTGGAGGTGCAGG - Intergenic
925286746 2:2721207-2721229 TGGCCAGGGTGTGGAGGTGCAGG - Intergenic
925286754 2:2721241-2721263 TGGCCAGGGTGTGGAGGTGCAGG - Intergenic
925286763 2:2721275-2721297 TGGCCGGGGTGTGGAGATGCAGG - Intergenic
925286772 2:2721309-2721331 TGGCCGGGGTGTGGAGGTGCAGG - Intergenic
925286781 2:2721343-2721365 TGGCTGGGGTGTGGAGGTGCAGG - Intergenic
925286799 2:2721411-2721433 TGGCCGGGGTGTGGAGGTGCAGG - Intergenic
925286836 2:2721547-2721569 TGGCCGGGGTGTGGAGGTGCAGG - Intergenic
925286863 2:2721649-2721671 TGGCCGGGGTGTGGAGGTGCAGG - Intergenic
925286872 2:2721683-2721705 TGGCTGGGGTGTGGAGGTGCAGG - Intergenic
925286892 2:2721751-2721773 TGGCCAGGGTGTGGAGACGCAGG - Intergenic
925286899 2:2721785-2721807 TGGCCGGGGTGTGGAGGTGCAGG - Intergenic
926128356 2:10285570-10285592 GGGCCGTGGTCTGGACCTGCAGG - Intergenic
930089351 2:47520625-47520647 TGCCCTGGGTGTGGGCCTGGGGG + Exonic
931045959 2:58353314-58353336 TGGCCCTGGTTAGGAGCTGCAGG + Intergenic
934573939 2:95388987-95389009 AGGCCCGTGTGAGGACCAGCAGG + Intergenic
934951259 2:98577105-98577127 GGGCCTGGGTGAAGACCTGCGGG - Exonic
937236516 2:120434614-120434636 TGCCCCGGGTCTGGAGCTCCTGG + Intergenic
938074514 2:128324544-128324566 TGGGCCGGGTGAGGGCCTCCTGG + Intergenic
938138142 2:128775697-128775719 TGGCCCTGGCGTGGACGTGCAGG - Intergenic
944269046 2:197760392-197760414 TGGCCTGGGGGTGCATCTGCTGG - Intronic
947741281 2:232486133-232486155 CGGCCCGGGGGTGGGCCTGGCGG - Exonic
948454955 2:238100611-238100633 TGGCCCCGTTGTGGGCCCGCTGG - Exonic
948823257 2:240560900-240560922 CGACCCGGCTGAGGACCTGCTGG + Exonic
948953182 2:241268420-241268442 TGGGCTGTGTGTGGACCTGGGGG - Intronic
1169208389 20:3752559-3752581 TGTGCAGGGTCTGGACCTGCAGG + Exonic
1171019818 20:21574906-21574928 GGGCCCGAGGGTTGACCTGCTGG - Intergenic
1171040478 20:21758049-21758071 GGGCTCGGGTGCTGACCTGCTGG + Intergenic
1172093979 20:32451782-32451804 TGGCCCAGCTGTGGCCCCGCTGG - Intronic
1174195840 20:48772307-48772329 TGGCACAGGTATGGCCCTGCAGG + Intronic
1174238557 20:49114566-49114588 TGCCCAGGGTGTGGATCTGCTGG + Exonic
1175967555 20:62667042-62667064 GGCCCCGGGAGTGCACCTGCAGG + Intronic
1176304238 21:5114961-5114983 TGGTGGGGGTGTGGACATGCTGG - Intergenic
1176307925 21:5133974-5133996 TGGCCCTGGTGAAGTCCTGCTGG + Exonic
1178807447 21:35851299-35851321 GGGTCCTGGTGTGGAACTGCTGG - Intronic
1179849136 21:44128056-44128078 TGGCCCTGGTGAAGTCCTGCTGG - Exonic
1179852818 21:44147069-44147091 TGGTGGGGGTGTGGACATGCTGG + Intergenic
1180010335 21:45045592-45045614 TGGCCAGGGTGTGGAGCAACAGG + Intergenic
1180211156 21:46296087-46296109 TGGCCCTGGGGTGGCCCTGAAGG + Intronic
1180599716 22:17008020-17008042 TGGCCCGGAAGTGGCCCCGCCGG - Exonic
1180968965 22:19805072-19805094 TGGCCCGGCTGTGAGCCTGCTGG + Intronic
1182748977 22:32626758-32626780 TGCCCCGAGTGTGGAGGTGCGGG + Intronic
1184599006 22:45531752-45531774 GGGCCCTGGTGAGGCCCTGCTGG + Intronic
1185344143 22:50304139-50304161 TGGCCTGGCTGTGGAGCTGGGGG - Intronic
949105421 3:196902-196924 AGCCCCGGGTGCGGACCAGCGGG + Exonic
950653739 3:14423945-14423967 TGGCTGGGTTCTGGACCTGCAGG + Intronic
953320168 3:41964165-41964187 AGGCCAGGGTGTGCAGCTGCAGG + Intergenic
955409059 3:58644080-58644102 TGGCCCAGCTGTGTTCCTGCTGG + Intronic
968470174 4:777181-777203 CTGCCAGGGTGTGGACCTGCTGG - Intergenic
968474033 4:794793-794815 TGGCAGGGGTGGGGAGCTGCAGG + Intronic
968509860 4:990871-990893 TGGCCTTGGTGGGGACCAGCAGG - Intronic
970186019 4:13454866-13454888 TGGCCTGGGTGTGTGTCTGCTGG + Intronic
977330446 4:95630624-95630646 TGCCTGGGGTATGGACCTGCTGG - Intergenic
978416850 4:108485982-108486004 AGGACCAGGTGGGGACCTGCTGG - Intergenic
979712056 4:123791328-123791350 TGGCCAGGGGGAGGACCTGGTGG + Intergenic
982207716 4:153009543-153009565 TGGCCAGGGCCTGGACCTCCTGG - Intergenic
986007000 5:3676877-3676899 TGGTCCAGGTGTGGTCCTGGAGG + Intergenic
986330184 5:6712284-6712306 TGGCCCGGGAGTGCATTTGCGGG + Intergenic
1002471308 5:179437797-179437819 AGGCTGGGGTGTGGAGCTGCCGG + Intergenic
1002580980 5:180209256-180209278 GGGCGCGGGGGTGGAGCTGCGGG + Intergenic
1005928743 6:30465339-30465361 TGGGCCTTGTGAGGACCTGCAGG - Intergenic
1006442137 6:34059425-34059447 TGGGGCGGGTGTGGATCTGGAGG - Intronic
1006599216 6:35214457-35214479 CGGCGCGGGCGTGGACCAGCAGG - Exonic
1007484932 6:42174471-42174493 TGACCACGGTGTGGACCTTCAGG - Intronic
1007581691 6:42963771-42963793 TGGCCCTGGTGTGGGGCTGCTGG - Exonic
1017491707 6:154951158-154951180 TGGCCTCTGTGTGCACCTGCTGG + Intronic
1019170624 6:170131409-170131431 TGGCCCGGGTGGGGAGATGGAGG - Intergenic
1019184126 6:170211154-170211176 TGGCCCTGGTGTGGATCTTAGGG + Intergenic
1019320185 7:411724-411746 TGCCCCGGGTGTGGAGGTCCTGG - Intergenic
1019419752 7:945542-945564 TGGGCCCAGTGTGTACCTGCTGG - Intronic
1019490851 7:1312475-1312497 AAGCCCGGCTGTGGATCTGCAGG - Intergenic
1019495820 7:1340179-1340201 GGCCCTGGGTGGGGACCTGCTGG - Intergenic
1023043692 7:36193959-36193981 TGGGACTGGTGGGGACCTGCAGG - Intronic
1026804551 7:73421882-73421904 GGGCCTGGGTGTGGGCCTGGGGG - Intergenic
1029214163 7:98933499-98933521 AGGCTCGGGCGGGGACCTGCAGG + Intronic
1034418119 7:150975810-150975832 TGTCCAGGGTTTGGAGCTGCAGG - Intronic
1034925568 7:155118759-155118781 TGGGCAGGGCATGGACCTGCTGG + Intergenic
1035268121 7:157703449-157703471 GGGTCCTGGTGTGGACCAGCTGG - Intronic
1035379595 7:158429290-158429312 TGTGCCGGCTGTGGATCTGCTGG - Intronic
1035604697 8:922025-922047 TGGCCCGGGTGTGGCACAGCTGG + Intergenic
1036066213 8:5384219-5384241 AGCCCCGGTTGTGCACCTGCAGG - Intergenic
1037767385 8:21780526-21780548 TGGCCCTGGTTTCTACCTGCAGG + Intronic
1046276246 8:111964507-111964529 AGGCCCAGGAGTGGACCTGAGGG - Intergenic
1049432888 8:142573513-142573535 TGGCCTGGGGCTGCACCTGCAGG - Intergenic
1049607763 8:143537570-143537592 TGCCCCTGGCCTGGACCTGCCGG - Intronic
1049616206 8:143576797-143576819 GGGCCCTGGGGTGGACCTGGCGG - Exonic
1049676248 8:143890556-143890578 AGGCCCGGGAATGTACCTGCTGG - Intergenic
1050823605 9:9914730-9914752 TGGCCCGGGAGTGTGTCTGCTGG - Intronic
1053166377 9:35846643-35846665 TGGACTGGAGGTGGACCTGCTGG + Intronic
1053544048 9:39004359-39004381 TGGACTGGGTGTGGAGCTGGGGG - Intergenic
1056980317 9:91303941-91303963 TGACCCTGGTGTGGGCCTCCAGG - Intronic
1061506037 9:131032321-131032343 TGGGCTGGGTGTGGACCCCCAGG - Intronic
1062101481 9:134730827-134730849 TGGCCTGGGTGTGGCCAGGCAGG + Intronic
1062104617 9:134746846-134746868 TGACCTGTGTGTGGGCCTGCTGG + Intronic
1062520041 9:136953986-136954008 GGGCCCGTGTGTGGCCCTGGAGG + Intronic
1062533017 9:137009968-137009990 AGGCCCGGGTGAGGATCTGTGGG - Exonic
1188768579 X:34126237-34126259 TGGCCAGGCTGGGGACCTGCAGG + Intergenic
1191257749 X:58287072-58287094 GGGCCCGGCTCTGGAACTGCTGG - Intergenic
1196196338 X:112841373-112841395 TGACCTGGGTGGGGGCCTGCTGG - Intergenic
1199236891 X:145503080-145503102 TGGCCCATGTGTGCACCTGGTGG + Intergenic