ID: 1142029921

View in Genome Browser
Species Human (GRCh38)
Location 16:87833368-87833390
Sequence TCCAGGTGGTGGCCCGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 300}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142029921_1142029934 16 Left 1142029921 16:87833368-87833390 CCACACCCGGGCCACCACCTGGA 0: 1
1: 0
2: 2
3: 24
4: 300
Right 1142029934 16:87833407-87833429 TCACAGCAGGCAGGGCCGGAGGG 0: 1
1: 0
2: 0
3: 22
4: 305
1142029921_1142029935 17 Left 1142029921 16:87833368-87833390 CCACACCCGGGCCACCACCTGGA 0: 1
1: 0
2: 2
3: 24
4: 300
Right 1142029935 16:87833408-87833430 CACAGCAGGCAGGGCCGGAGGGG No data
1142029921_1142029932 12 Left 1142029921 16:87833368-87833390 CCACACCCGGGCCACCACCTGGA 0: 1
1: 0
2: 2
3: 24
4: 300
Right 1142029932 16:87833403-87833425 CTGTTCACAGCAGGCAGGGCCGG 0: 1
1: 0
2: 1
3: 42
4: 419
1142029921_1142029931 8 Left 1142029921 16:87833368-87833390 CCACACCCGGGCCACCACCTGGA 0: 1
1: 0
2: 2
3: 24
4: 300
Right 1142029931 16:87833399-87833421 TGGACTGTTCACAGCAGGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 205
1142029921_1142029928 3 Left 1142029921 16:87833368-87833390 CCACACCCGGGCCACCACCTGGA 0: 1
1: 0
2: 2
3: 24
4: 300
Right 1142029928 16:87833394-87833416 ATGCCTGGACTGTTCACAGCAGG 0: 1
1: 0
2: 1
3: 14
4: 135
1142029921_1142029930 7 Left 1142029921 16:87833368-87833390 CCACACCCGGGCCACCACCTGGA 0: 1
1: 0
2: 2
3: 24
4: 300
Right 1142029930 16:87833398-87833420 CTGGACTGTTCACAGCAGGCAGG 0: 1
1: 0
2: 1
3: 12
4: 263
1142029921_1142029933 15 Left 1142029921 16:87833368-87833390 CCACACCCGGGCCACCACCTGGA 0: 1
1: 0
2: 2
3: 24
4: 300
Right 1142029933 16:87833406-87833428 TTCACAGCAGGCAGGGCCGGAGG 0: 1
1: 0
2: 1
3: 20
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142029921 Original CRISPR TCCAGGTGGTGGCCCGGGTG TGG (reversed) Intronic
900385831 1:2410255-2410277 TCCTGGAGCTGGCCCGGGTGAGG - Intronic
900852635 1:5156110-5156132 ACCAGCAGGTGGCCCTGGTGTGG + Intergenic
901047309 1:6404883-6404905 CCCAGGTGGGATCCCGGGTGGGG - Intergenic
902341112 1:15784313-15784335 TCCACGTGGAGGCGCCGGTGAGG - Intronic
903867552 1:26410443-26410465 TACAGGTGGGGGACCTGGTGGGG - Intergenic
904211014 1:28887105-28887127 TGCAGGTGGAGGCCCCGGCGGGG + Exonic
904351076 1:29907119-29907141 ACGAGGTGGTGGCCCAGGTATGG - Intergenic
904418108 1:30375106-30375128 TGCTGGTGGGGGCCTGGGTGAGG - Intergenic
905617140 1:39409000-39409022 TCCAGGGGGCTGCCCGGGCGGGG + Intronic
907302779 1:53498864-53498886 TCAAGGTGGGGCCCGGGGTGAGG - Intergenic
907910799 1:58824560-58824582 TACAGGTGGAGGCCAGGGGGTGG + Intergenic
912974483 1:114315491-114315513 TTCAGGTGCTAGGCCGGGTGTGG - Intergenic
914764084 1:150622723-150622745 GTCAGGAGGTGGCTCGGGTGTGG - Exonic
915485356 1:156216605-156216627 TCCCGGTGCCGGCCCGGGTCCGG + Intronic
916761674 1:167823087-167823109 TCCAGGTGCTGGGGCGGCTGTGG - Exonic
920032922 1:203048294-203048316 ACCAGGAGCTGGCACGGGTGAGG + Intronic
920087607 1:203429134-203429156 GGCAGGTGGTGCCCCGTGTGAGG - Intergenic
920173377 1:204085077-204085099 GGCAGGAGGTGGCCAGGGTGTGG + Intronic
922400528 1:225249524-225249546 TCCAGATGGTGGCCCAGGGAAGG + Intronic
922916747 1:229264092-229264114 TCCAGGAGGTGGCCAGGATTCGG + Intergenic
923544636 1:234915155-234915177 TCCAAGTGCTGGATCGGGTGTGG + Intergenic
924539966 1:244970963-244970985 CCCGGGGGGTGGCCTGGGTGAGG + Exonic
1063124996 10:3129601-3129623 TCCAGGTGGCTGCCATGGTGGGG + Intronic
1063376490 10:5557611-5557633 TCCAGAAGGAGGCCCCGGTGTGG + Intergenic
1064583515 10:16817208-16817230 CCCAGGGGCTGGTCCGGGTGCGG + Exonic
1067581107 10:47446596-47446618 TCCAGGTGGGGCCCTTGGTGAGG + Intergenic
1070855532 10:79605620-79605642 TCCAGATAGTGGCATGGGTGTGG - Intergenic
1071481022 10:86065088-86065110 GCCGGGTGGTGGCCCTAGTGGGG - Intronic
1075587480 10:123668059-123668081 TCCAGATGGTGTCGCAGGTGAGG + Intronic
1075723529 10:124600435-124600457 TCTGGGTGTTGGCCTGGGTGGGG + Intronic
1077082328 11:729573-729595 TGCTGGTGCTGGCCCTGGTGGGG + Intergenic
1077187918 11:1243702-1243724 TCCTGGAGGTGGCCGTGGTGTGG - Exonic
1077188344 11:1245373-1245395 TCCTGGAGGTGGCCCTGGTGTGG - Exonic
1077188877 11:1247473-1247495 TCCTGGAGGTGCCCCTGGTGTGG - Exonic
1077189299 11:1249144-1249166 TCCTGGAGGTGGCCGTGGTGTGG - Exonic
1077490371 11:2858271-2858293 GCCAGGCGGTGGCCGGGGGGTGG - Intergenic
1077557353 11:3232038-3232060 GCCAGATGGTGGCAGGGGTGGGG - Intronic
1078290385 11:10005001-10005023 TCCTGGTGGTGGCATGGGGGTGG - Intronic
1082082624 11:48024057-48024079 TACAGGTGGGGGTCCAGGTGGGG - Intronic
1083321781 11:61852140-61852162 TCCAGACGGTGGCCTGGGAGAGG - Intronic
1083758297 11:64802867-64802889 CCCAGGTGAGGGCCCGGGTCGGG - Exonic
1083979537 11:66155591-66155613 TCCAGGTGTTGGCAAGGATGTGG + Intronic
1084670606 11:70604444-70604466 GCCAGGGGGTGGCCTGGGAGAGG + Intronic
1084705875 11:70815718-70815740 TCCCGGTGGGGGCCCTGGGGAGG + Intronic
1085293218 11:75415027-75415049 TGGAGGTGGTGGACTGGGTGGGG - Intronic
1088613799 11:111602993-111603015 ACCAGGTCACGGCCCGGGTGGGG - Intronic
1088819422 11:113444773-113444795 TCCAGATGGTGGCCTCCGTGAGG - Intronic
1090910027 11:131110781-131110803 TCCAGGCGCTGGCCCCTGTGAGG + Intergenic
1093372955 12:18386593-18386615 TCCAGGTGGTAGCCCCGATTGGG + Intronic
1093932412 12:24967307-24967329 ACCAGGTGGTGGTCTGGCTGTGG + Intergenic
1094405830 12:30115329-30115351 TCCAGGTGCTGGAGAGGGTGTGG - Intergenic
1096094477 12:48925294-48925316 TCCAAGTGGAGACCCTGGTGAGG - Exonic
1096186687 12:49586228-49586250 TCCCAGTGGAGGCCTGGGTGTGG + Intronic
1099857405 12:88184017-88184039 GGCAGGTGGTGCCCCGTGTGAGG - Intronic
1100655142 12:96635989-96636011 TCCAGGAGGTGGGAGGGGTGGGG + Intronic
1100981325 12:100164967-100164989 TGCAAGTGGTGTCCCGCGTGAGG - Intergenic
1102082849 12:110112415-110112437 TCCAGCTGGAGGTCCGTGTGGGG - Intergenic
1102458640 12:113086914-113086936 TTCAGGTGGGGGGCAGGGTGGGG - Intronic
1102582148 12:113896445-113896467 TCCAGGTTGGAGCCAGGGTGTGG - Intronic
1103890666 12:124236739-124236761 CCAAGGTGGTGGCCGGGGAGTGG - Intronic
1104280445 12:127371908-127371930 TCCTGGTGGTGGCACTGGTGTGG - Intergenic
1105480086 13:20767014-20767036 TCCAGATGGTGGGCCAGGCGCGG + Intronic
1106090498 13:26588699-26588721 TCCCGGTGTTGGCCAGGATGGGG - Intronic
1106188350 13:27427981-27428003 TCCATGTGGTAGGCTGGGTGTGG + Intronic
1108533276 13:51347020-51347042 TGCAGGTGGGGGCCCCAGTGAGG + Exonic
1112258532 13:97856864-97856886 CCCAAGTGGTGGCCCTGGTAGGG - Intergenic
1112326341 13:98444882-98444904 TCCTGGTGGTGGCCAGGGCTGGG - Intronic
1113315678 13:109176821-109176843 TGCAGGTGGAGGGCCAGGTGAGG - Intronic
1115175416 14:30556879-30556901 TCCAAGTGATGGCCAGGCTGCGG + Intergenic
1118337060 14:64862581-64862603 TTAAGGTGGTGGCCTGGGCGCGG + Intronic
1118477866 14:66135154-66135176 TCCAGGTGGAGGCTTGAGTGTGG - Intergenic
1118761913 14:68885297-68885319 TACAGGTGGGTGCCCAGGTGGGG - Intronic
1119428542 14:74551265-74551287 TCCACCAGGTGGCCCAGGTGCGG - Exonic
1119485070 14:74981616-74981638 TCCAGGCTGTGGTCCGGGAGAGG + Intergenic
1120647049 14:87086730-87086752 TACAGGTGGTGGTTGGGGTGGGG + Intergenic
1121559648 14:94864966-94864988 TTCAGGTGGAGGGCCCGGTGGGG + Intergenic
1122066220 14:99175859-99175881 TCCAGGTGGTGGCGCGGCGGGGG + Exonic
1122075561 14:99232577-99232599 TCCACGTGGGGGCCCTGGAGTGG - Intronic
1122774229 14:104110156-104110178 TGCAGGTGGTGGCTGGGGTGGGG + Intronic
1122976535 14:105173167-105173189 TCCAGGTGGGGGCCTGGTGGAGG - Exonic
1124071459 15:26396786-26396808 TCCAGGGGCTGGCACAGGTGGGG - Intergenic
1124896049 15:33778516-33778538 TCCAGGTGGTGGCCAGGTGTGGG - Intronic
1125402990 15:39324097-39324119 TCCAGGTGCTGACCTGGGTCTGG + Intergenic
1128551029 15:68598072-68598094 TCCAGGTGGTGGAGGGGGTCTGG - Intronic
1128640505 15:69332689-69332711 TCCATGGGTTGGCCGGGGTGGGG - Intronic
1132523235 16:401106-401128 TCCGCGTGGGGGCCCGGGCGGGG - Intronic
1133178309 16:4032972-4032994 GCCACGTGGTGGGGCGGGTGAGG - Intronic
1133230827 16:4365745-4365767 TGCAGGTGGAGGCCCTGGGGAGG - Intronic
1134002631 16:10794651-10794673 TGCAGGTGGTGCACAGGGTGAGG + Intronic
1134521508 16:14921069-14921091 TCCTGGGGGTGGATCGGGTGGGG + Intronic
1134709179 16:16319720-16319742 TCCTGGGGGTGGATCGGGTGGGG + Intergenic
1134716388 16:16359749-16359771 TCCTGGGGGTGGATCGGGTGGGG + Intergenic
1134950426 16:18348925-18348947 TCCTGGGGGTGGATCGGGTGGGG - Intergenic
1134958362 16:18392410-18392432 TCCTGGGGGTGGATCGGGTGGGG - Intergenic
1135378840 16:21975798-21975820 TCCATGTGTTTGGCCGGGTGTGG + Intronic
1135591073 16:23705620-23705642 TCAAGGGGGTGGGCCAGGTGTGG + Intronic
1135878771 16:26231521-26231543 TGCAGGTGGAGGCCAGGCTGTGG - Intergenic
1136158740 16:28403726-28403748 CCCAGGTCGAGGTCCGGGTGGGG - Intronic
1136204348 16:28711557-28711579 CCCAGGTCGAGGTCCGGGTGGGG + Intronic
1138522199 16:57577565-57577587 CCCAGATGGTGGCAGGGGTGGGG - Intronic
1139298694 16:65925555-65925577 GCCGGGTGGTGGGCCGGGTGTGG + Intergenic
1139436585 16:66940153-66940175 TCTAGGTAGTGGCCCTGGTGGGG + Intronic
1139719419 16:68840761-68840783 TCCAGAGTGTGGGCCGGGTGTGG - Intergenic
1141692180 16:85602610-85602632 TCTGGGTGGTGGCCTTGGTGGGG + Intergenic
1142029921 16:87833368-87833390 TCCAGGTGGTGGCCCGGGTGTGG - Intronic
1142234432 16:88915183-88915205 GCCAGGTGGTGGCGTGGGTGTGG + Intronic
1142379609 16:89723798-89723820 TCTAGGTGGTGGCTGGGGTGTGG + Intronic
1143568532 17:7740052-7740074 TCAGGGCGGTGGCCCGGGGGGGG + Intronic
1143657001 17:8300863-8300885 TACAGGTTTTGGCCCAGGTGAGG - Intergenic
1145248564 17:21285127-21285149 TCCAGGTGAGGGCCCAGGCGGGG - Intronic
1147155342 17:38541989-38542011 TCCAGGTGGAGGCTGGGGAGAGG + Intronic
1147441014 17:40447249-40447271 TCCATGTGCTGGCCAGGTTGTGG + Intronic
1147585971 17:41654244-41654266 TGCAGGCGGGGGCCTGGGTGGGG + Intergenic
1147840640 17:43369055-43369077 TCCAGGAGGTGACCCAGGAGGGG + Intergenic
1147883014 17:43665846-43665868 TCCACGTGATGGCTCAGGTGTGG - Intergenic
1150441756 17:65197060-65197082 GACAGGTGGTGGCCTGGGTTGGG - Intronic
1151727828 17:75894821-75894843 ACCCGGTGGTGGCCAGGCTGCGG + Intronic
1152793363 17:82293531-82293553 TCCAGGCGGTGCCCCGGGCGGGG - Intergenic
1152851870 17:82641604-82641626 TCCAAGAGGTGGCCGGGGTGCGG + Intronic
1152934954 17:83131140-83131162 TCCTGCTGGTGGCTGGGGTGAGG + Intergenic
1152945500 17:83195532-83195554 TGCAGGAGGGGGCCTGGGTGGGG + Intergenic
1155992767 18:32296999-32297021 ACCAAGTGGTGGGCCAGGTGTGG - Intronic
1157294634 18:46433586-46433608 ACGAGGGCGTGGCCCGGGTGTGG + Intronic
1160385857 18:78495799-78495821 CCCAGGTGGGCGCCCGGCTGGGG + Intergenic
1160510299 18:79449757-79449779 TCCAGGTGGAGCCCCGGGGGTGG + Intronic
1160554563 18:79717199-79717221 GCCGGGTGGGGGCCCTGGTGGGG + Intronic
1160810801 19:1012219-1012241 CCCAGGGGGTGGCCTGGGCGGGG - Intronic
1160811525 19:1014961-1014983 TCCAGCTGGTGGCCCTGGGGTGG - Intronic
1160831873 19:1108064-1108086 ACCAGGTGGGGGCCCGGGTCGGG + Exonic
1160841982 19:1150376-1150398 TGCAGGTGGGGGCCCTGCTGAGG - Intronic
1160902016 19:1433472-1433494 GCCTGGTGGAGGCCGGGGTGTGG + Intronic
1160914369 19:1489812-1489834 TGCAGGCGGTGGCCCCAGTGCGG + Exonic
1160923924 19:1533944-1533966 TCCAGCAGGTGGCACAGGTGTGG - Exonic
1161011386 19:1960990-1961012 TCCAGGTGTGGGCCGGTGTGCGG + Intronic
1161037986 19:2096164-2096186 GCCAGGTGGGTGCCCGGGAGGGG - Intronic
1161169241 19:2804795-2804817 GGCAGGTGGTGGCCAGGCTGTGG + Intronic
1161242187 19:3228625-3228647 GCCCGGCGGGGGCCCGGGTGGGG + Intronic
1161487107 19:4542539-4542561 TCCTGGGGGTGGCACGGGTGGGG - Intergenic
1161557859 19:4954645-4954667 TCCAGGAGGTGGCCCGAGCAGGG + Exonic
1162578728 19:11514635-11514657 TCCAGCTGCTGGACAGGGTGAGG - Intronic
1163237627 19:16038587-16038609 GCCAGGGGGAGGCCTGGGTGAGG + Intergenic
1163884302 19:19952295-19952317 TACAGATAGTGGCCCAGGTGGGG + Intergenic
1163898694 19:20081671-20081693 TACAGATAGTGGCCCAGGTGGGG - Intronic
1163908942 19:20171637-20171659 TACAGATAGTGGCCCAGGTGGGG - Intronic
1163920914 19:20287682-20287704 TGCAGCTAGTGGCCCAGGTGGGG - Intergenic
1163957518 19:20658173-20658195 TACAGATAGTGGCCCAGGTGGGG + Intronic
1163959185 19:20671341-20671363 TACAGATAGTGGCCCAGGTGGGG - Intronic
1164000337 19:21092505-21092527 TACAGATAGTGGCCCAGGTGGGG - Intronic
1164006701 19:21156292-21156314 TACAGATGGTGGCCCAGGTGGGG - Intronic
1164241019 19:23389219-23389241 TACAGATAGTGGCCCAGGTGGGG + Intronic
1164683203 19:30149712-30149734 TACAGGTGGTGGGCAGGGAGAGG - Intergenic
1164767338 19:30781943-30781965 TGCAGGAGGTGCCCTGGGTGGGG + Intergenic
1165317587 19:35066045-35066067 TCCAGATGGGAGCCAGGGTGGGG + Intronic
1165473715 19:36017613-36017635 TCCAGGTGGTGCCCTGGGTTTGG + Intronic
1165495838 19:36151651-36151673 TCCAGGTGGGGGGTCGGGGGGGG - Exonic
1165821978 19:38682586-38682608 GCAAGGTGGTGGCTTGGGTGAGG - Intronic
1165956487 19:39504667-39504689 TCCTGGAGGTGGCCCGGGGCTGG + Intronic
1166858019 19:45792797-45792819 TCCGGGAGGGGGCCCGGCTGCGG - Exonic
1168273947 19:55265933-55265955 AGCAGCTGGTGGCCCTGGTGCGG - Exonic
925019809 2:559371-559393 TCCAGGTGCTCTCCTGGGTGAGG + Intergenic
927672648 2:25082062-25082084 TGCTGCTGGTGGCCCAGGTGAGG + Intronic
927872574 2:26632976-26632998 TCCCGGTGGTGCCCGTGGTGGGG - Intronic
928452545 2:31389331-31389353 TCCAGGTGGTGGGGTGGGTGGGG - Intronic
934653329 2:96104488-96104510 TCCAGATTGTGGCTTGGGTGTGG - Intergenic
935237377 2:101150684-101150706 TCCAGGTGGTGTCGTGGCTGGGG - Intronic
935293282 2:101627605-101627627 GGCAGGTGGTGGCCAGGGTATGG - Intergenic
935416883 2:102828592-102828614 TCCAAGTGATGGCCAAGGTGAGG + Intronic
936532159 2:113283907-113283929 CCCAGGGAGTGGCCAGGGTGAGG + Intergenic
938278465 2:130048722-130048744 TGCTGGTGGTGGTCCCGGTGTGG - Intergenic
938329440 2:130439581-130439603 TGCTGGTGGTGGTCCCGGTGTGG - Intergenic
938360508 2:130681922-130681944 TGCTGGTGGTGGTCCCGGTGTGG + Intergenic
938436911 2:131288630-131288652 TGCTGGTGGTGGTCCCGGTGTGG + Intronic
941112285 2:161428139-161428161 TCCGGGAGCTCGCCCGGGTGCGG + Intronic
941843597 2:170112487-170112509 GGCAGGTGGTGCCCCGTGTGAGG + Intergenic
943033634 2:182714847-182714869 AAGAGGTGGTGGGCCGGGTGTGG - Intergenic
943797248 2:192012040-192012062 GCCTGGTGGTGGGCCGGGCGAGG - Intronic
943811599 2:192195100-192195122 GCCAGGCGCTGGCCCGAGTGGGG + Exonic
948166654 2:235867749-235867771 TCCAGGTGATGCCCCTGCTGAGG - Intronic
948175707 2:235940944-235940966 TCCAAGTGGTGGCAGGGGTGGGG + Intronic
948897457 2:240934066-240934088 ACGGGGTGGTGGCCCAGGTGGGG - Intronic
1170613244 20:17930397-17930419 GGCAGGTGGTGGCCCAGGCGTGG - Intergenic
1170965313 20:21063467-21063489 GCCAAGTGGTGCCCAGGGTGTGG - Intergenic
1172618094 20:36303008-36303030 TCCAGGTGATGCCCGGGCTGAGG - Intergenic
1173222849 20:41143591-41143613 TCAAGGTGGAGCCACGGGTGAGG + Intronic
1173454541 20:43191725-43191747 CCCAGGGGATGACCCGGGTGGGG + Intergenic
1174356707 20:50003173-50003195 TCCTGGTGCAGGGCCGGGTGTGG - Intergenic
1174383031 20:50169668-50169690 GCAAGGAGGTGGCCTGGGTGTGG + Intergenic
1175709293 20:61206318-61206340 GCCATGTGGTGGCCCTGATGGGG - Intergenic
1176293026 21:5056193-5056215 TCCAGGTGGCTGCCCAGGCGTGG - Intergenic
1176310852 21:5148096-5148118 TCCGTGTTGGGGCCCGGGTGGGG - Intronic
1176546903 21:8206153-8206175 TCCCGGTGCCGGCCCGGGTCCGG + Intergenic
1176554808 21:8250362-8250384 TCCCGGTGCCGGCCCGGGTCCGG + Intergenic
1176565854 21:8389200-8389222 TCCCGGTGCCGGCCCGGGTCCGG + Intergenic
1176573729 21:8433387-8433409 TCCCGGTGCCGGCCCGGGTCCGG + Intergenic
1178049265 21:28730496-28730518 TCAAGGTGTTGGCCAGGCTGTGG + Intergenic
1179846203 21:44113939-44113961 TCCGTGTTGGGGCCCGGGTGGGG + Intronic
1179864234 21:44207457-44207479 TCCAGGTGGCTGCCCAGGCGTGG + Intergenic
1180106351 21:45620748-45620770 TCCAGTTGGGGGCCCGGGCAGGG + Intergenic
1181104945 22:20568627-20568649 TCCAGGTGAGGGCCTGGGGGTGG + Exonic
1181175190 22:21031304-21031326 TCCGGGTAGTGGCCCAGGAGGGG + Exonic
1181633673 22:24164482-24164504 TCAAGGTGCTGGCCCAGCTGCGG + Exonic
1182557014 22:31134604-31134626 CCCAGATGGGGGCCTGGGTGGGG - Exonic
1183194759 22:36345767-36345789 GCCAGGTGTTGGCCAGGCTGAGG - Intronic
1183216149 22:36481519-36481541 TCGAGGTGGTGTCGCGGCTGAGG - Intronic
1183310912 22:37109142-37109164 CCCAGGTGGGGTACCGGGTGTGG + Intronic
1183658830 22:39206720-39206742 TGGAGGTTATGGCCCGGGTGGGG - Intergenic
1184005010 22:41701227-41701249 TCCAGCTGTTTGGCCGGGTGTGG - Intronic
1184248028 22:43245437-43245459 TGCAGGTGGTGGCGCGGGTGGGG + Intronic
1184319896 22:43733274-43733296 TCCAGGTGGTGACGCTGGAGAGG - Intronic
1184808455 22:46812002-46812024 TCCAGGTGGTTGCCAAGGTCTGG + Intronic
1185210787 22:49569491-49569513 TCCAGGTGTTGGCCAGGGCTGGG + Intronic
1185226435 22:49656408-49656430 GGCAGGTGGAGGCCAGGGTGAGG - Intronic
1185426592 22:50775266-50775288 TCCCCCTGGTGACCCGGGTGTGG - Intronic
1203251778 22_KI270733v1_random:122438-122460 TCCCGGTGCCGGCCCGGGTCCGG + Intergenic
1203259828 22_KI270733v1_random:167520-167542 TCCCGGTGCCGGCCCGGGTCCGG + Intergenic
949602545 3:5615794-5615816 GGCAGGTGGTTGGCCGGGTGCGG - Intergenic
950123805 3:10499286-10499308 TACAGGGCTTGGCCCGGGTGTGG - Intronic
951231651 3:20186339-20186361 GCCAGGTGGATGCCCGGATGTGG - Intergenic
952974128 3:38679794-38679816 TCAAGGTGGGGACCAGGGTGAGG - Intergenic
953606588 3:44416735-44416757 GCCTGGTGGTGGCCAGGGAGGGG - Intergenic
953766669 3:45748133-45748155 TCCAAGTGCTGGCATGGGTGCGG - Intergenic
954121773 3:48504004-48504026 TCCGGGTGGTGAGCCGGGGGTGG - Exonic
954125308 3:48524808-48524830 TCCAGGAGGTGGCCTGGGGCAGG - Intronic
954289646 3:49642845-49642867 TCCAGGTGCTGGCCCAGGCCCGG - Exonic
954881519 3:53838910-53838932 TCCAGGTGGTGTCCAAGGGGTGG - Intronic
955941055 3:64147307-64147329 TCCAGATGGGGTCCCGGTTGAGG + Exonic
956145556 3:66187724-66187746 TCAAGGTGTTGGTCAGGGTGTGG - Intronic
959253003 3:103972240-103972262 TCTAGGTGGGGGGCCGAGTGTGG - Intergenic
959682007 3:109106670-109106692 ACCAGATGGTTGCCCGTGTGAGG - Intronic
960159161 3:114331233-114331255 TCCTGGAGGTGGCAGGGGTGGGG - Intergenic
961851602 3:129825115-129825137 ACCAGGTGGTGCCCTAGGTGAGG - Intronic
961886245 3:130098164-130098186 TCCAGGTGGTGACCTGGGATGGG + Intronic
961906044 3:130264148-130264170 TCCAGGGCGTGGCCCAGGGGGGG - Intergenic
964689543 3:159434897-159434919 TACAGGTGGAGGACAGGGTGAGG - Intronic
966803326 3:183785194-183785216 ACCAGGTGTTTGGCCGGGTGCGG + Intronic
967171273 3:186825255-186825277 TCCAGGAGGTGGGATGGGTGAGG - Intergenic
968505182 4:968151-968173 TCCAGGTGGGTGCTCGGGGGCGG - Intronic
968649628 4:1755384-1755406 TCCAGATGGGGGCCCCGCTGAGG + Intergenic
969070564 4:4534977-4534999 TTCTGGAGGAGGCCCGGGTGAGG - Intronic
969818518 4:9703925-9703947 TCCAGGTGGTGACCTGGGATGGG - Intergenic
972619268 4:40731230-40731252 AACAGGTGGTGGGCCAGGTGTGG + Intergenic
973931643 4:55799080-55799102 TCCATGTGGTAGCCTGTGTGAGG - Intergenic
975214347 4:71736748-71736770 TCCTGCTGGTGGGCTGGGTGTGG + Intergenic
980050289 4:128032961-128032983 TCCAGTGGGTGGGCCGGGCGTGG + Intronic
982215891 4:153082357-153082379 TGCAGGAGGGGGCCGGGGTGTGG - Intergenic
985626023 5:988479-988501 TGCAAGTGGTGGCAAGGGTGTGG + Intergenic
985801270 5:2006710-2006732 TCCAGGGTGTGGCAGGGGTGGGG - Intergenic
985895561 5:2748604-2748626 TCCTGGCGGTGCCCCGGTTGAGG + Exonic
985895817 5:2749544-2749566 ACCAGGTGGAGACCTGGGTGAGG + Exonic
995146269 5:108789891-108789913 TCCTGCTGGTGGGCCAGGTGTGG - Intronic
995650485 5:114362704-114362726 TGCTGGTGGTGCGCCGGGTGCGG - Exonic
995854296 5:116576154-116576176 TCCAGGTGGTGGTAGTGGTGCGG - Intergenic
997215225 5:132104350-132104372 ACCAGGTGGTGGCCGGATTGAGG + Intergenic
997701470 5:135903840-135903862 TCCAGGTGATGACTCAGGTGTGG + Intergenic
997721641 5:136082622-136082644 TCCAGGTGCTCCCCCTGGTGGGG + Intergenic
998252501 5:140562352-140562374 TCCAGATGGTGCCTGGGGTGAGG - Exonic
998349400 5:141491165-141491187 AGCAGGTGGTGGTCCTGGTGAGG + Exonic
998406241 5:141876290-141876312 TCCCCGCGGTGGCCTGGGTGCGG - Intronic
998467388 5:142356879-142356901 TCCAGGTCGTGGCCTGGCGGCGG + Intergenic
999079065 5:148826448-148826470 TCCTGGGGCTGGCCCGGGCGGGG - Exonic
1000338485 5:160259532-160259554 GGCAGGTGGTGGGCCAGGTGTGG + Exonic
1002541836 5:179911359-179911381 CCCAGGAGGTGGCCCAGGTCAGG - Intergenic
1003571190 6:7257796-7257818 TCCTGGTGGAGGCCTGGGTGTGG - Intergenic
1005185700 6:23161414-23161436 GGCAGGTGGTGCCCCGTGTGAGG + Intergenic
1006272396 6:32974363-32974385 TCCAGGTGCTGGCCCTAGTGAGG - Intronic
1007662822 6:43496862-43496884 TACAGGTGGGGGCCAGGGAGGGG + Intronic
1007734270 6:43970895-43970917 TCCAGCTTGAGGCCCTGGTGTGG - Intergenic
1008919303 6:56824965-56824987 ACCAGGTGGTGGCCGGGCAGAGG - Intronic
1012587757 6:100945026-100945048 AGCAGGTGGTGCCCCGTGTGAGG + Intergenic
1014059328 6:117052248-117052270 TACAGGCAGTGGGCCGGGTGCGG - Intergenic
1016366951 6:143329656-143329678 TCCAGGTGGTGGGCTGGATTTGG - Intronic
1019049073 6:169169582-169169604 CCCAGGTTCTGTCCCGGGTGTGG - Intergenic
1019292856 7:258787-258809 CCCATGTGATGGCCGGGGTGGGG - Intronic
1019781020 7:2939731-2939753 TCCAGGTGAGGGCCTGGGGGCGG - Exonic
1020649369 7:10855713-10855735 TCCAGGTGTTGACATGGGTGCGG - Intergenic
1022975050 7:35549066-35549088 TCCAGTTGGTGGCCCTGTTATGG - Intergenic
1024062663 7:45710454-45710476 TGCATTTGGTGGCCCTGGTGGGG + Intronic
1025775577 7:64558081-64558103 TACAGATAGTGGCCCAGGTGGGG + Intronic
1026015820 7:66669853-66669875 TCTTGGTGGTGGCCCGGGTGTGG - Intronic
1026892445 7:73990232-73990254 TCTTGGCGGTGGCCGGGGTGTGG - Intergenic
1026932805 7:74233808-74233830 TCCATGTGGTGGCTAGGTTGAGG + Intronic
1028830927 7:95325794-95325816 TTCAGTTGGTGGCCAGGCTGTGG - Intergenic
1029104026 7:98159707-98159729 TCCATGTGATGGCCATGGTGTGG + Intronic
1032084021 7:128874310-128874332 GCCAGGTGGTAGCACAGGTGGGG - Intronic
1034348810 7:150403580-150403602 TCCGAGTGGAGGCACGGGTGGGG + Intronic
1034888716 7:154820145-154820167 TCCAGGTGGGGCCCAGGCTGTGG - Intronic
1035756099 8:2034185-2034207 CCCAGGTGGAGGCCCAGGTAGGG - Intergenic
1035756114 8:2034226-2034248 CCCAGGTGCAGGCCCAGGTGGGG - Intergenic
1035952351 8:4036821-4036843 AACAGGTGGTGGCCCTGGTCAGG - Intronic
1036465956 8:8997484-8997506 TCCAGGTGGTGGCTTGGACGTGG - Intergenic
1036773062 8:11592183-11592205 TCCAGCTCCTGGGCCGGGTGGGG + Intergenic
1037281019 8:17242177-17242199 CTCAGGTAGTGGCCCGGGTCAGG + Intronic
1042743276 8:72075413-72075435 ACCAGGTGGCGTCCGGGGTGGGG - Exonic
1043227137 8:77746571-77746593 TACAGGTGGTGGCCAGGCAGTGG + Intergenic
1049247308 8:141569700-141569722 TCCAGGTGCTGGCCTGGCTGTGG + Intergenic
1049584325 8:143425892-143425914 TCCAGGTGGGGGTGGGGGTGAGG + Intronic
1049746383 8:144264998-144265020 TCCAGGTCGTAGCCCACGTGGGG + Exonic
1049766556 8:144357956-144357978 TCCGAGCGGTGGCCCGGGCGGGG - Intronic
1049979636 9:892396-892418 TGCAGGTGGAGGGCTGGGTGAGG - Intronic
1054711248 9:68512997-68513019 ACCAGGTGGTGGCCAGGGTTTGG + Intronic
1055018746 9:71646674-71646696 TCCAGGTGGTGGGCAGGGGTCGG + Intergenic
1056259532 9:84833932-84833954 TGCAGGAGGATGCCCGGGTGAGG + Intronic
1057297676 9:93859063-93859085 TCAAAGTGGTGGCTGGGGTGTGG + Intergenic
1057376184 9:94525384-94525406 TCCCCGGGGTGGGCCGGGTGTGG + Intergenic
1060197831 9:121634803-121634825 CACAGGTGGTGGCTGGGGTGGGG - Intronic
1060747715 9:126148715-126148737 TCCTGCTGGTGGCCCAGATGTGG + Intergenic
1061372244 9:130203889-130203911 TCCAGGAGAAGGCCCAGGTGTGG - Intronic
1061596671 9:131634914-131634936 TCCAGGTGCTAGGCTGGGTGTGG + Intronic
1061989749 9:134152505-134152527 GCCAGGTGCTGGGCAGGGTGTGG + Intronic
1062022248 9:134325257-134325279 TGCGCGTGGTGGCCCGGGTCAGG - Intronic
1062270264 9:135705011-135705033 TCCAGTGGCTGGCCTGGGTGTGG + Intronic
1062308322 9:135921897-135921919 TCTGGGTGGTGACCCGGGTGAGG + Intergenic
1062334589 9:136059492-136059514 CCAAGGAGGCGGCCCGGGTGGGG - Intronic
1062385564 9:136309647-136309669 TCCAGGGGCTGACCCAGGTGCGG + Intergenic
1203468180 Un_GL000220v1:105589-105611 TCCCGGTGCCGGCCCGGGTCCGG + Intergenic
1203476001 Un_GL000220v1:149561-149583 TCCCGGTGCCGGCCCGGGTCCGG + Intergenic
1185499395 X:585384-585406 CCCAGGTGGGGGCCGGCGTGAGG - Intergenic
1187692725 X:21887075-21887097 TCCAGATGGAGGCAAGGGTGTGG - Intergenic
1187966400 X:24616527-24616549 TCCAGGTGGCTGACCGGGCGTGG - Intronic
1190294352 X:49016287-49016309 ACCAGGTTGTCGGCCGGGTGCGG + Intergenic
1192180849 X:68914669-68914691 TCCAGGTGGTGGGTCTGGGGAGG + Intergenic
1195394908 X:104399903-104399925 CCCAGGGGGTGGGCGGGGTGGGG + Intergenic
1195455425 X:105064035-105064057 TACAGGTGGTAGCCAGGGAGTGG - Intronic
1197863532 X:130995275-130995297 TTCAGTTGGTGGCCAGGATGTGG - Intergenic
1199623551 X:149720383-149720405 GGCAGGTGGTGCCCCGTGTGAGG + Intergenic
1199758928 X:150890608-150890630 TCAAGGTGGGGGCGGGGGTGTGG - Intronic
1200166063 X:154036191-154036213 TCCAGGTGTGGCCCAGGGTGGGG + Intronic