ID: 1142029922

View in Genome Browser
Species Human (GRCh38)
Location 16:87833373-87833395
Sequence ATGTGTCCAGGTGGTGGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 228}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142029922_1142029937 27 Left 1142029922 16:87833373-87833395 CCCGGGCCACCACCTGGACACAT 0: 1
1: 0
2: 4
3: 22
4: 228
Right 1142029937 16:87833423-87833445 CGGAGGGGCCAATCTGCTAACGG 0: 1
1: 0
2: 0
3: 7
4: 47
1142029922_1142029928 -2 Left 1142029922 16:87833373-87833395 CCCGGGCCACCACCTGGACACAT 0: 1
1: 0
2: 4
3: 22
4: 228
Right 1142029928 16:87833394-87833416 ATGCCTGGACTGTTCACAGCAGG 0: 1
1: 0
2: 1
3: 14
4: 135
1142029922_1142029935 12 Left 1142029922 16:87833373-87833395 CCCGGGCCACCACCTGGACACAT 0: 1
1: 0
2: 4
3: 22
4: 228
Right 1142029935 16:87833408-87833430 CACAGCAGGCAGGGCCGGAGGGG No data
1142029922_1142029934 11 Left 1142029922 16:87833373-87833395 CCCGGGCCACCACCTGGACACAT 0: 1
1: 0
2: 4
3: 22
4: 228
Right 1142029934 16:87833407-87833429 TCACAGCAGGCAGGGCCGGAGGG 0: 1
1: 0
2: 0
3: 22
4: 305
1142029922_1142029938 28 Left 1142029922 16:87833373-87833395 CCCGGGCCACCACCTGGACACAT 0: 1
1: 0
2: 4
3: 22
4: 228
Right 1142029938 16:87833424-87833446 GGAGGGGCCAATCTGCTAACGGG 0: 1
1: 0
2: 0
3: 5
4: 85
1142029922_1142029933 10 Left 1142029922 16:87833373-87833395 CCCGGGCCACCACCTGGACACAT 0: 1
1: 0
2: 4
3: 22
4: 228
Right 1142029933 16:87833406-87833428 TTCACAGCAGGCAGGGCCGGAGG 0: 1
1: 0
2: 1
3: 20
4: 262
1142029922_1142029931 3 Left 1142029922 16:87833373-87833395 CCCGGGCCACCACCTGGACACAT 0: 1
1: 0
2: 4
3: 22
4: 228
Right 1142029931 16:87833399-87833421 TGGACTGTTCACAGCAGGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 205
1142029922_1142029930 2 Left 1142029922 16:87833373-87833395 CCCGGGCCACCACCTGGACACAT 0: 1
1: 0
2: 4
3: 22
4: 228
Right 1142029930 16:87833398-87833420 CTGGACTGTTCACAGCAGGCAGG 0: 1
1: 0
2: 1
3: 12
4: 263
1142029922_1142029932 7 Left 1142029922 16:87833373-87833395 CCCGGGCCACCACCTGGACACAT 0: 1
1: 0
2: 4
3: 22
4: 228
Right 1142029932 16:87833403-87833425 CTGTTCACAGCAGGCAGGGCCGG 0: 1
1: 0
2: 1
3: 42
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142029922 Original CRISPR ATGTGTCCAGGTGGTGGCCC GGG (reversed) Intronic
900148373 1:1167959-1167981 ATGTGCCTCGGTGGTGTCCCCGG - Intergenic
900368216 1:2320090-2320112 ATGTGCCCAGGGGCTGCCCCGGG + Intergenic
900996268 1:6125074-6125096 AAGGGGCTAGGTGGTGGCCCAGG - Intronic
901714959 1:11145874-11145896 ATGGCTCCAGGTGGTAGCTCTGG + Intronic
901930872 1:12595599-12595621 AGGGGGCCAGGTGGTGTCCCGGG + Intronic
904349437 1:29895417-29895439 ATCTGTCCATGCAGTGGCCCCGG - Intergenic
904499739 1:30907238-30907260 AAGTGTCCAGGTTCTGGCTCAGG - Intronic
904601261 1:31673804-31673826 ATGGGTGCAGGTGGTGGCTGGGG + Intronic
905231205 1:36515885-36515907 ATGGGACAAGGTGGAGGCCCAGG - Intergenic
905409489 1:37758487-37758509 AAGTGCCCAGTTGGTGGCCTTGG - Intronic
905881753 1:41468537-41468559 ATGTGGCCAGCTGGTGACACGGG + Intergenic
906895222 1:49763713-49763735 CTGTGTCCATCTGGAGGCCCTGG - Intronic
907273549 1:53304647-53304669 ATGTCTCCAGGTGTTGGTTCTGG + Intronic
908131738 1:61081981-61082003 ACGTGCCCACGCGGTGGCCCGGG + Exonic
909468475 1:76000903-76000925 GTGTGTCCAGAAGTTGGCCCAGG - Intergenic
911056057 1:93709493-93709515 ATCTGTACAGGTGTTGGCCAGGG + Intronic
916965860 1:169942373-169942395 AGGTGTGCAGGAGGTGGGCCAGG - Intronic
918022044 1:180703458-180703480 ATGTGCGCAGGTGTTGGCCATGG + Intronic
922400526 1:225249519-225249541 AGCTTTCCAGATGGTGGCCCAGG + Intronic
922702114 1:227767334-227767356 ATGGGTGCAGGTGGTAGCCAGGG - Intronic
922763681 1:228147049-228147071 ATGTGGCCAGGTTGTGGCCCAGG + Intronic
923363151 1:233233099-233233121 ATGTTTCAAGGTGATTGCCCAGG + Intronic
923858752 1:237871968-237871990 ATGTGTCTAGGTGGTGATGCTGG + Intergenic
1062759999 10:11077-11099 ATGTGTCCAGGTGTTGAAGCGGG - Intergenic
1062829144 10:593689-593711 CTGTGTTCAGGTGGTGCCCCAGG - Intronic
1065136221 10:22673024-22673046 ACCTGTCCAGGAAGTGGCCCTGG - Intronic
1066747544 10:38616120-38616142 ATGTGTCCAGGTGTTGAAGCGGG - Intergenic
1068069736 10:52181269-52181291 ATGTCTCCTGGGGGTGGCCTGGG + Intronic
1068699512 10:60004730-60004752 ATGTGTCCATGTGGTGGTTAGGG + Intergenic
1069959849 10:72073196-72073218 ATCTGTCCTGGTGGTGGGGCTGG - Intronic
1070709993 10:78674141-78674163 AAGTGTCCATGTAGTGACCCTGG - Intergenic
1071300899 10:84255335-84255357 ATGTGTCCAGTAGGGAGCCCTGG - Intronic
1071506094 10:86232517-86232539 ATCTGTCCAGGTGGTGGTGGGGG - Intronic
1074051788 10:109887250-109887272 ATGGGTCCAGTGAGTGGCCCAGG - Intronic
1074905562 10:117860291-117860313 ATGTGTGCATGTGGTGGCAATGG + Intergenic
1076615005 10:131749444-131749466 CTGGGTCCAGGTGATGGCCTGGG - Intergenic
1076998015 11:308480-308502 ATGTGGGCAGGTGGAGCCCCAGG - Intronic
1076999236 11:314398-314420 ATGTGGGCAGGTGGAGCCCCAGG - Intronic
1077026227 11:441241-441263 ACCTGCCCAGGTGTTGGCCCTGG + Intronic
1077088178 11:765145-765167 GGGTTCCCAGGTGGTGGCCCAGG - Intergenic
1078188799 11:9074808-9074830 TTGTGTCCATGTGGCGGTCCTGG - Intronic
1079226205 11:18607236-18607258 TTGTGTCCAGTTGGAGGCCAGGG - Exonic
1079405368 11:20140569-20140591 ATGGTTCCAGGTGGTTGCTCTGG - Intergenic
1083903577 11:65655729-65655751 ATGCGTCGAGGTGGAGGCCGGGG + Exonic
1084479506 11:69410549-69410571 CTCTGTCTAGGTGGTGGTCCAGG + Intergenic
1084705872 11:70815713-70815735 AGGAGTCCCGGTGGGGGCCCTGG + Intronic
1085445786 11:76599745-76599767 AGGTGCCAAGGTGGTGGGCCAGG + Intergenic
1088781362 11:113136923-113136945 ATGTGTCCAGGGGAAGGCCAAGG + Intronic
1089301556 11:117502022-117502044 ATGTGTTCAGGAGGTGGCCCTGG + Intronic
1090234714 11:125139114-125139136 AAGGGTCCACGTGGAGGCCCTGG + Intergenic
1090234736 11:125139185-125139207 AAGGGTCCACGTGGAGGCCCTGG + Intergenic
1091249265 11:134128491-134128513 ATGTGTCAAGGAGGGGGCCCTGG + Intronic
1091682500 12:2537112-2537134 GTGGGTGCAGGTGGTGGTCCTGG - Intronic
1091816464 12:3442617-3442639 ATGCATCCAAGCGGTGGCCCTGG - Intronic
1091942516 12:4501038-4501060 ATCTGTCCAGTTAGTTGCCCAGG + Intronic
1091981333 12:4866525-4866547 ATGAGTCCAGATGGTGAGCCGGG - Intergenic
1092233171 12:6789164-6789186 ATGTGTCCAGTGGGTGCCCCAGG - Intronic
1092906096 12:13101550-13101572 ATGTGTCCCGGAGCTGGGCCGGG + Intronic
1099133559 12:78864929-78864951 GTGGGACCAGCTGGTGGCCCTGG + Exonic
1100603610 12:96133007-96133029 ATGTGTCCACCAGGTGGCCTTGG - Intergenic
1102228423 12:111245789-111245811 TTGTGTCCAGGTTGTGGACCTGG - Intronic
1102956900 12:117064805-117064827 ATGTGTCCAGCTGGTGGGGAGGG + Intronic
1103780680 12:123396811-123396833 AAGTTTCCATGTTGTGGCCCAGG + Intronic
1104329427 12:127830584-127830606 CTGTGTCCTGGTGGTTGCCAGGG + Intergenic
1105480085 13:20767009-20767031 ATATTTCCAGATGGTGGGCCAGG + Intronic
1106448035 13:29854039-29854061 ATGTGTTCTGGTCATGGCCCAGG + Intergenic
1106801851 13:33264045-33264067 ATGTGTCCATGTGGTTGCCCAGG - Intronic
1107565994 13:41605114-41605136 ATGTGTCCAGGTTTGGGCCCAGG + Intronic
1107816368 13:44248150-44248172 AGGTTTCCAGGTGGTGAGCCAGG + Intergenic
1107835229 13:44407543-44407565 TTGTGGCCAGGTGGGGGCACTGG - Intergenic
1108087975 13:46815869-46815891 ATGTTTCTAGCTGGTGACCCAGG - Intergenic
1112061262 13:95741944-95741966 ATGTGTACAGGTGCTGGCTGTGG + Intronic
1113364749 13:109665626-109665648 CTGTGTGCAGGTGATGGCCCTGG + Intergenic
1113425944 13:110208376-110208398 AATTCTCCTGGTGGTGGCCCTGG + Intronic
1114459352 14:22876991-22877013 ATGACTCCAGGAGGTGGCCCAGG + Exonic
1116857005 14:49961441-49961463 GTGGGGCCAGGTGCTGGCCCTGG + Intergenic
1119265878 14:73263041-73263063 ATCTGTGCAGATGGTGGCTCCGG + Intronic
1119706741 14:76787812-76787834 ATGTGTGGAGGGGCTGGCCCAGG + Exonic
1121245707 14:92459640-92459662 GTGTTTCCAGGTGTTGTCCCTGG + Intronic
1122938683 14:104971664-104971686 AGGTGACCAGGAGGTGGGCCAGG - Intronic
1123703235 15:22931410-22931432 ATGTGTCCAGGAGGTGGGCCTGG - Intronic
1125827132 15:42685981-42686003 ATGAGTCAAGGTGGTGGCAGAGG - Exonic
1129883818 15:79025217-79025239 ATGGGCCCAGGTGGTGGGCAGGG - Intronic
1130230892 15:82095846-82095868 ATGTGGCCAGTTGGTGGATCTGG - Intergenic
1133023055 16:2975306-2975328 ATGTGTTCAGGTGGGGACCGGGG - Exonic
1133230830 16:4365750-4365772 AGGTGTGCAGGTGGAGGCCCTGG - Intronic
1135648284 16:24182813-24182835 ATCTCTGCAGGTGGAGGCCCAGG - Intronic
1136735261 16:32461473-32461495 ATGTGTCCAGGTGTTGAAGCGGG + Intergenic
1137624585 16:49899821-49899843 CAGTCTCCAAGTGGTGGCCCTGG + Intergenic
1138332776 16:56228234-56228256 GTCTGGCCTGGTGGTGGCCCTGG - Intronic
1140578115 16:76196823-76196845 ATGTGTCCAGGTGAGGCCACTGG + Intergenic
1141738277 16:85870425-85870447 ATGTGCCCAGGTGGCTGCCTCGG + Intergenic
1141786938 16:86207418-86207440 AGGTGGCCATGAGGTGGCCCAGG + Intergenic
1142029922 16:87833373-87833395 ATGTGTCCAGGTGGTGGCCCGGG - Intronic
1142295149 16:89216645-89216667 ATGTGCCCAGGAGGTGGCGGTGG - Intergenic
1142421406 16:89972691-89972713 CTGTGGCGATGTGGTGGCCCAGG + Intergenic
1203017821 16_KI270728v1_random:368117-368139 ATGTGTCCAGGTGTTGAAGCGGG - Intergenic
1203036156 16_KI270728v1_random:641275-641297 ATGTGTCCAGGTGTTGAAGCGGG - Intergenic
1143119071 17:4596249-4596271 CTGTGTGCAGGGTGTGGCCCAGG + Intronic
1143296279 17:5874354-5874376 ATGGGTCAAGGTGGTGACCAGGG - Intronic
1143329943 17:6126440-6126462 ATGTGTCTAGGAGGAAGCCCAGG + Intergenic
1147645789 17:42033127-42033149 ATGTTTCAAGGAGGTGGGCCGGG - Intronic
1147979083 17:44263638-44263660 TTGGGTCAAGGTGGTGGCCAGGG - Intronic
1148340043 17:46867887-46867909 ATGTGTGGAGGTGGGGGCTCTGG + Intronic
1148669973 17:49403038-49403060 CTGTGGCCAGGTGGTGAGCCTGG + Intronic
1151355098 17:73553609-73553631 CTGTGGCCAGGTAGTGGCTCAGG - Intronic
1151537089 17:74745157-74745179 GTGTGTCCAGGGGCTGGGCCAGG - Intronic
1151820780 17:76495696-76495718 GTGTGTCGAGGTGAGGGCCCAGG - Intronic
1151988520 17:77559124-77559146 GTGTGGCCAGGTGGTGTCCCTGG + Intergenic
1152952907 18:11430-11452 ATGTGTCCAGGTGTTGAAGCGGG - Intergenic
1154148327 18:11885054-11885076 ATGTGTCCAGGTCGTCTCCATGG + Exonic
1154291935 18:13115975-13115997 ATGTTTGCTGGTGGTGGCACTGG - Intronic
1157849994 18:51039581-51039603 CTGTGGCCAGGGGGTGGCTCTGG + Intronic
1160811528 19:1014966-1014988 GTGGGTCCAGCTGGTGGCCCTGG - Intronic
1161156107 19:2732625-2732647 TTGTGCACAGGTGGTGGCCCAGG + Exonic
1161667835 19:5587802-5587824 ATGTGTCCAGGGGCTTCCCCAGG - Intronic
1162531010 19:11236559-11236581 ATTTGTCCAGGTAGGGGTCCTGG + Exonic
1162579822 19:11522311-11522333 ATGGGTCCAGGTGGGGTACCGGG - Intronic
1162786265 19:13036883-13036905 ATGTGTCCGGGTGGGGCCGCAGG - Intronic
1163284709 19:16339101-16339123 ATGTGCCCTGGTGGTGACTCGGG + Intergenic
1163664772 19:18598143-18598165 AGGTGTGCAGGAGGGGGCCCTGG - Intronic
1163727071 19:18928915-18928937 ATGTGGCCAGGTGGGTGGCCAGG - Intronic
1164869608 19:31631956-31631978 AAGTGTCTGGGTGGTGGCCCAGG + Intergenic
1167289782 19:48617996-48618018 AGGTCTCCTGGTGGTGGGCCTGG - Intronic
1168293607 19:55368863-55368885 GGGGGGCCAGGTGGTGGCCCAGG + Exonic
925153668 2:1634608-1634630 ATGTGTCCAGCTGGTGGTCTTGG - Intronic
925758944 2:7165695-7165717 CTGTTTCCTGGTGATGGCCCAGG + Intergenic
925778419 2:7357146-7357168 GTGTGTTCAGCAGGTGGCCCTGG + Intergenic
925930475 2:8703277-8703299 GTGTGGTCAGGTGGTGGCCAGGG - Intergenic
927700595 2:25265953-25265975 CTGTGGCCAGGAGTTGGCCCTGG + Intronic
928775889 2:34763086-34763108 ATGGGTCCAGGTTGAGGACCAGG - Intergenic
929120038 2:38476848-38476870 ATCTGCCGAGCTGGTGGCCCAGG + Intergenic
931749293 2:65316763-65316785 ATGAGTCGTGGAGGTGGCCCAGG + Exonic
934863875 2:97788577-97788599 ATGTGCCCAGGTGGTGGAGTGGG - Intronic
935255466 2:101306482-101306504 AGATGTCCATGTGGTGGCACTGG - Intronic
935293283 2:101627610-101627632 ATCTGGGCAGGTGGTGGCCAGGG - Intergenic
935381033 2:102451393-102451415 GGGTGTCCAGGGCGTGGCCCAGG - Intronic
938278466 2:130048727-130048749 ATGAGTGCTGGTGGTGGTCCCGG - Intergenic
938329441 2:130439586-130439608 ATGAGTGCTGGTGGTGGTCCCGG - Intergenic
938360507 2:130681917-130681939 ATGAGTGCTGGTGGTGGTCCCGG + Intergenic
938436910 2:131288625-131288647 ATGAGTGCTGGTGGTGGTCCCGG + Intronic
938496871 2:131802316-131802338 ATGTGTCCAGGTGTTGAAGCGGG + Intergenic
940709640 2:157146013-157146035 ATGTTTCCAAATTGTGGCCCAGG - Intergenic
942689982 2:178574931-178574953 ATTGGTCCAGTAGGTGGCCCTGG + Exonic
942851814 2:180495775-180495797 TTGTGTCCAGGAGGTGTTCCTGG + Intergenic
945347091 2:208731570-208731592 ATGTGTCCTGGTGGTGGCAGGGG + Intronic
948289252 2:236812945-236812967 ATCTGTACATGAGGTGGCCCTGG - Intergenic
948412467 2:237774788-237774810 ATGAGCCCAGGTGGAGGACCAGG + Intronic
949021567 2:241743875-241743897 ATGGGCCCACGTGGTGGCACAGG + Intronic
1170157344 20:13280629-13280651 CTGTGTCCAGCTGGTGTCCAGGG + Intronic
1171201424 20:23245123-23245145 AGGTGGCCAGGTGGGGACCCGGG - Intergenic
1171419607 20:25009003-25009025 ATCTGTCCAGGAGGTTGCCTAGG - Intronic
1172042806 20:32057916-32057938 ATGTGCCCTGGTCTTGGCCCCGG + Intronic
1172179420 20:32992102-32992124 ATGTGTCCCAGCAGTGGCCCTGG + Intronic
1173237533 20:41261130-41261152 ATGTTTCCAGGTCATGTCCCAGG - Intronic
1173273541 20:41558165-41558187 ATGTGTCCAGTTTGTGGGCGTGG - Intronic
1173895322 20:46546317-46546339 TTGTGTGCAGGTGGAGGTCCTGG - Exonic
1174914827 20:54643595-54643617 CTGTGTCCAGGGTGTGGGCCAGG + Intronic
1175455133 20:59106744-59106766 AGGTGTTCAGATGGTGGCACAGG - Intergenic
1175891336 20:62317332-62317354 ATCTGTCCAGGTGGGTGGCCAGG - Exonic
1175905846 20:62378949-62378971 ATGTGTCCAGGAAGGGGCCTGGG - Intergenic
1176293027 21:5056198-5056220 ACGTTTCCAGGTGGCTGCCCAGG - Intergenic
1177861702 21:26462237-26462259 GTGTGTTCAGGTGGTGGCAAGGG + Intergenic
1178798388 21:35767038-35767060 ACGTGTCAAGGGGGGGGCCCAGG - Intronic
1179551778 21:42147845-42147867 ATGGGTCCTGGGGGTGGCCTGGG + Intergenic
1179864233 21:44207452-44207474 ACGTTTCCAGGTGGCTGCCCAGG + Intergenic
1180537258 22:16404189-16404211 ATGTGTCCAGGTGTTGAAGCGGG - Intergenic
1183600061 22:38834934-38834956 ATGTGTCATGGTGCAGGCCCTGG + Intronic
1184673342 22:46027307-46027329 ATGTGTCCCCGTGTTGGCCCGGG - Intergenic
1184808454 22:46811997-46812019 ATTGGTCCAGGTGGTTGCCAAGG + Intronic
1184858146 22:47157764-47157786 CGGTGCCCAGATGGTGGCCCAGG + Intronic
1185268930 22:49919303-49919325 ACGAGTCCAGGTGGGTGCCCTGG + Exonic
950526433 3:13526794-13526816 GTGTCTCCAGGTGGGGGCCAGGG + Intergenic
950572063 3:13807382-13807404 GAGCTTCCAGGTGGTGGCCCGGG - Intergenic
950579067 3:13850954-13850976 ATTTGCCCAGGCTGTGGCCCAGG + Intronic
951427491 3:22564417-22564439 ACGTTTCCAGGTGCTGTCCCAGG + Intergenic
951868503 3:27334004-27334026 CTGTGTACAGGTGTTGGCCATGG - Intronic
952005454 3:28837500-28837522 GTGTGGCCAGGTGATTGCCCAGG + Intergenic
953798203 3:46001567-46001589 TGGTGTCCAGAGGGTGGCCCTGG - Intergenic
954036502 3:47853747-47853769 CTGTGTGCAGGGGGTGGCCTGGG - Intronic
954289647 3:49642850-49642872 TTGGCTCCAGGTGCTGGCCCAGG - Exonic
954916510 3:54152536-54152558 ATTTGTCCACCTCGTGGCCCAGG + Intronic
955070987 3:55572281-55572303 ATTTCTCCAGCTGCTGGCCCAGG - Intronic
961408838 3:126704036-126704058 ATGTGTACCGGCGGAGGCCCTGG - Intergenic
965828015 3:172750534-172750556 ATGTGGCCAGGAGGTGGCGGTGG - Intergenic
966205403 3:177400836-177400858 ATGTGGCCAGGTGGTGTGGCCGG - Intergenic
968752966 4:2399791-2399813 TTGGGTCCAGATGGTGTCCCGGG - Intronic
970926636 4:21459912-21459934 ATCTTTCCAGGTGGTCTCCCTGG + Intronic
972694733 4:41434284-41434306 ATGTCTACAGCTGGTGGCCAGGG - Intronic
978105051 4:104892295-104892317 ACGTGTCAAGGTGGTGGCACAGG + Intergenic
978617257 4:110610465-110610487 ATGTTTCCAGGTGAGGGCACAGG + Intergenic
980387158 4:132101289-132101311 AAATGTTCAGGTGGGGGCCCTGG - Intergenic
986681340 5:10235581-10235603 CTGTGACCAGCTGGTGGCACCGG + Intronic
988161296 5:27520859-27520881 ATGTGTCCTCCTGGAGGCCCTGG - Intergenic
988629811 5:32916836-32916858 CTGCATCCAGGTGGTGGCACTGG - Intergenic
988870539 5:35384823-35384845 ATGTGGCCAGGTTGGGACCCCGG - Intergenic
991471139 5:66970208-66970230 AAGCCTCCAGGTGGTGGCACTGG - Intronic
992690735 5:79237526-79237548 AGGTGTCCAGGCCGTGGCCCAGG - Exonic
994327561 5:98466379-98466401 TTGTGGCCAGGCGGTGGCTCAGG + Intergenic
994537341 5:101048672-101048694 CTGGGTCCAGGTGATTGCCCTGG - Intergenic
998404093 5:141863834-141863856 GCGTGTCCAGGCTGTGGCCCAGG + Exonic
999255179 5:150206013-150206035 CTGTGTCCCACTGGTGGCCCGGG + Intronic
1000027673 5:157374238-157374260 ATGTGTGCTAGTGATGGCCCTGG - Intronic
1002055329 5:176595361-176595383 CTGTGTCCCAGAGGTGGCCCTGG - Intronic
1002545442 5:179940168-179940190 AAGGGTGCAGGTGGTGGCACTGG + Intronic
1004318026 6:14608569-14608591 ATGAGTCCAGGCAGTGGCCCTGG - Intergenic
1005307287 6:24525895-24525917 ATGTGTCTTGGTGGTGGTCGTGG - Intronic
1006370830 6:33642747-33642769 ATGGGACCACGGGGTGGCCCAGG - Intronic
1006433509 6:34013553-34013575 ATGAATCCAGGAGGTGGCCCTGG + Intergenic
1007629557 6:43265224-43265246 AGGTGCCCAGGTGTTGGGCCAGG + Intronic
1007749233 6:44062063-44062085 CTATGTCCAGGTGCTGGGCCTGG - Intergenic
1008045282 6:46845333-46845355 ATGGGGCCACGTGGTGGCCTTGG + Intergenic
1016577361 6:145584344-145584366 ATGTGGCCAGGCTGGGGCCCTGG + Intronic
1017042710 6:150320482-150320504 GTGTGTCCAGGCAGTGGGCCAGG + Intergenic
1018640645 6:165901066-165901088 ATGAGTCCACGTGGAGGCCGAGG - Intronic
1019016902 6:168886447-168886469 CTGTGGCCGGGAGGTGGCCCCGG + Intergenic
1019565129 7:1675301-1675323 ATGTGGCCAGGTGGCGGCCGAGG + Intergenic
1022544082 7:31169058-31169080 AGGTGTCCATGTGGAGACCCTGG - Intergenic
1025019376 7:55468619-55468641 ATGGGCCCAGCAGGTGGCCCAGG + Intronic
1026015821 7:66669858-66669880 AAGAGTCTTGGTGGTGGCCCGGG - Intronic
1026310002 7:69175259-69175281 CTCTGACCAGGTTGTGGCCCAGG - Intergenic
1026374161 7:69733477-69733499 AGGTTTGCAGGTGGTGACCCTGG + Intronic
1026480153 7:70771676-70771698 ATGTGTCTAAGTGGCGTCCCGGG + Intronic
1027190432 7:75993192-75993214 CTTGGTCCAGGAGGTGGCCCTGG - Intronic
1027198489 7:76047799-76047821 ATTTTTCCAGGTGGGGCCCCAGG - Exonic
1032417414 7:131747023-131747045 CTCTGTCCATGTGGTGACCCAGG + Intergenic
1034831814 7:154315272-154315294 ATGTGTACAGGTGATGTCCTGGG - Intronic
1035050882 7:155998547-155998569 ATGTGGCCAGGCGGGGGCGCGGG - Intergenic
1035228133 7:157444757-157444779 ATGTGTGCAGAGGATGGCCCAGG + Intergenic
1035338284 7:158143969-158143991 GTCTGGGCAGGTGGTGGCCCGGG - Intronic
1035459429 7:159029982-159030004 ATGTCACCCGGTGGTCGCCCAGG + Exonic
1041356615 8:57007178-57007200 ATGAGTCCAGCTGGTGGCTATGG + Intergenic
1042568820 8:70140498-70140520 AGTAGTCTAGGTGGTGGCCCAGG + Intronic
1044698735 8:94948674-94948696 ATGCGTCCCGGGGGTGGCCGCGG + Intronic
1044962269 8:97542757-97542779 AGATGTCCAGGTCCTGGCCCTGG - Intergenic
1045334909 8:101191961-101191983 ATGTGTTCATCTGGTGGGCCAGG + Intronic
1045417140 8:101978636-101978658 ATGTGTGCAGGTGGTGGTGGTGG + Intronic
1046491064 8:114953337-114953359 ATATGGCCAGGTAGGGGCCCTGG - Intergenic
1047968889 8:130068040-130068062 ATGTGGCCATGTGGTCACCCAGG + Intronic
1048153659 8:131919671-131919693 ATCTGTCCAGGTGATTTCCCAGG - Intronic
1052179108 9:25502728-25502750 ATGTGTCAAGGGGGGGGACCAGG + Intergenic
1055018744 9:71646669-71646691 CTGTCTCCAGGTGGTGGGCAGGG + Intergenic
1057017609 9:91666372-91666394 AAGTCTCCAGGTGGTGGCTCTGG - Intronic
1057792338 9:98132445-98132467 AGGGATCCAGGTGGTGCCCCTGG - Intronic
1058154400 9:101498679-101498701 ATGTAGCCAGCTGGAGGCCCAGG + Intronic
1058982517 9:110183392-110183414 ATGTGACCAGGAGGTGGCAGTGG + Intergenic
1060517110 9:124272708-124272730 ATGTGACCAGGGCCTGGCCCAGG - Intronic
1062128710 9:134880933-134880955 AAGTTTCCAGGAGGAGGCCCTGG - Intronic
1062432345 9:136531779-136531801 AGGTGTCCTGGTGGTTTCCCGGG - Intronic
1185463981 X:344620-344642 AGCTGTGCAGGTGCTGGCCCAGG + Intronic
1187942240 X:24393222-24393244 ATGTGTGCTGCTGGTGGCCCAGG + Intergenic
1189204459 X:39226134-39226156 ACGTGTGCAGGTCGTGGCTCAGG + Intergenic
1197251085 X:124217083-124217105 ATGTGTCCAGCAGGAGGCCTGGG - Intronic
1199803107 X:151270780-151270802 ATGGTTCCAGGTGGTAGGCCCGG + Intergenic
1200114248 X:153763233-153763255 ATAGGGCCAGGTGTTGGCCCTGG - Intergenic