ID: 1142029923

View in Genome Browser
Species Human (GRCh38)
Location 16:87833374-87833396
Sequence CATGTGTCCAGGTGGTGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 410}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142029923_1142029933 9 Left 1142029923 16:87833374-87833396 CCGGGCCACCACCTGGACACATG 0: 1
1: 0
2: 2
3: 21
4: 410
Right 1142029933 16:87833406-87833428 TTCACAGCAGGCAGGGCCGGAGG 0: 1
1: 0
2: 1
3: 20
4: 262
1142029923_1142029931 2 Left 1142029923 16:87833374-87833396 CCGGGCCACCACCTGGACACATG 0: 1
1: 0
2: 2
3: 21
4: 410
Right 1142029931 16:87833399-87833421 TGGACTGTTCACAGCAGGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 205
1142029923_1142029932 6 Left 1142029923 16:87833374-87833396 CCGGGCCACCACCTGGACACATG 0: 1
1: 0
2: 2
3: 21
4: 410
Right 1142029932 16:87833403-87833425 CTGTTCACAGCAGGCAGGGCCGG 0: 1
1: 0
2: 1
3: 42
4: 419
1142029923_1142029937 26 Left 1142029923 16:87833374-87833396 CCGGGCCACCACCTGGACACATG 0: 1
1: 0
2: 2
3: 21
4: 410
Right 1142029937 16:87833423-87833445 CGGAGGGGCCAATCTGCTAACGG 0: 1
1: 0
2: 0
3: 7
4: 47
1142029923_1142029934 10 Left 1142029923 16:87833374-87833396 CCGGGCCACCACCTGGACACATG 0: 1
1: 0
2: 2
3: 21
4: 410
Right 1142029934 16:87833407-87833429 TCACAGCAGGCAGGGCCGGAGGG 0: 1
1: 0
2: 0
3: 22
4: 305
1142029923_1142029928 -3 Left 1142029923 16:87833374-87833396 CCGGGCCACCACCTGGACACATG 0: 1
1: 0
2: 2
3: 21
4: 410
Right 1142029928 16:87833394-87833416 ATGCCTGGACTGTTCACAGCAGG 0: 1
1: 0
2: 1
3: 14
4: 135
1142029923_1142029938 27 Left 1142029923 16:87833374-87833396 CCGGGCCACCACCTGGACACATG 0: 1
1: 0
2: 2
3: 21
4: 410
Right 1142029938 16:87833424-87833446 GGAGGGGCCAATCTGCTAACGGG 0: 1
1: 0
2: 0
3: 5
4: 85
1142029923_1142029930 1 Left 1142029923 16:87833374-87833396 CCGGGCCACCACCTGGACACATG 0: 1
1: 0
2: 2
3: 21
4: 410
Right 1142029930 16:87833398-87833420 CTGGACTGTTCACAGCAGGCAGG 0: 1
1: 0
2: 1
3: 12
4: 263
1142029923_1142029935 11 Left 1142029923 16:87833374-87833396 CCGGGCCACCACCTGGACACATG 0: 1
1: 0
2: 2
3: 21
4: 410
Right 1142029935 16:87833408-87833430 CACAGCAGGCAGGGCCGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142029923 Original CRISPR CATGTGTCCAGGTGGTGGCC CGG (reversed) Intronic
900368215 1:2320089-2320111 CATGTGCCCAGGGGCTGCCCCGG + Intergenic
900387400 1:2416848-2416870 CCTGTGTCCCTGTGTTGGCCGGG + Intergenic
900494966 1:2972139-2972161 CCAGGGTCCAGGTGGTGGCTTGG + Intergenic
900575776 1:3381895-3381917 CCCCTGTACAGGTGGTGGCCTGG - Intronic
900702359 1:4056122-4056144 CATGTGTCGAGGAAGGGGCCTGG + Intergenic
901029752 1:6300252-6300274 CCTGTGTCCATGTGCTGTCCTGG - Intronic
901116141 1:6846100-6846122 CATGTGTCAAGGGCGGGGCCAGG - Intronic
902109143 1:14063717-14063739 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
902172271 1:14621630-14621652 CATGTGTCAAGGGTGGGGCCAGG + Intronic
902254021 1:15175815-15175837 CATGTGTCAAGGGCGGGGCCAGG - Intronic
902423751 1:16302908-16302930 CATGTGTCAAGGGAGTGACCTGG - Intronic
902704470 1:18195075-18195097 CATGTGTCAAGGGCATGGCCTGG - Intronic
902710491 1:18236160-18236182 CATGTGTCAAGGGTGGGGCCAGG + Intronic
902886901 1:19411837-19411859 TTTGTGTCCAGGTGGCAGCCAGG - Intronic
903261518 1:22134115-22134137 CGGGTGTCCAGGTGGGGGCTGGG + Intronic
904601260 1:31673803-31673825 TATGGGTGCAGGTGGTGGCTGGG + Intronic
905665428 1:39760661-39760683 CATGTGGCCTGGAGATGGCCAGG - Intronic
907481429 1:54748030-54748052 CGTGTGTGCAAGTGGGGGCCTGG - Intergenic
908593670 1:65661108-65661130 CATGTGTCAAGGGCGGGGCCAGG - Intergenic
908816057 1:68035628-68035650 CATGTGTCAAGGGGGAGCCCAGG - Intergenic
909439709 1:75684217-75684239 CATGTGTCAAGGGTGGGGCCAGG - Intergenic
911056056 1:93709492-93709514 GATCTGTACAGGTGTTGGCCAGG + Intronic
911501251 1:98687965-98687987 CATGTGTCAAGGGCGGGGCCAGG - Intronic
911945872 1:104108255-104108277 CATGTGTCAAGGAGGGGACCAGG + Intergenic
912498769 1:110107992-110108014 CAAGTGTCCAGCTGCCGGCCTGG - Intergenic
912690832 1:111803507-111803529 GATGTGTCCATGTGGGGGCTTGG - Intronic
912934105 1:113987843-113987865 CATGTGTCAAGGGTGGGGCCAGG - Intergenic
915369506 1:155336900-155336922 CATGTGTGCTGGCGGGGGCCTGG + Exonic
916002200 1:160627870-160627892 CATGTGTCAAGGGTGGGGCCAGG + Intronic
916273541 1:162969314-162969336 CATGTGTCAAGGACGGGGCCAGG + Intergenic
917550924 1:176028128-176028150 CATGTGTCAAGGATGGGGCCAGG - Intronic
917679821 1:177354465-177354487 CATGTGCCCAGGTGTTGCCAGGG - Intergenic
919305904 1:195837528-195837550 GATGAGTCCAGGTGGTAACCAGG + Intergenic
919845521 1:201639800-201639822 CATGTCCCCAGCTGGAGGCCGGG - Intronic
919978567 1:202628445-202628467 CATCCTTCCAGGTGCTGGCCAGG + Intronic
922002413 1:221493225-221493247 CATGTGTCAAGGGTGGGGCCAGG - Intergenic
922702115 1:227767335-227767357 AATGGGTGCAGGTGGTAGCCAGG - Intronic
923055104 1:230420490-230420512 CATGTGTCAAGGGCGGGGCCAGG + Intronic
923172237 1:231428697-231428719 CATGTGTCAAGGGAGGGGCCCGG - Intergenic
924598904 1:245470723-245470745 CAGGGGTCAAAGTGGTGGCCGGG - Intronic
1063161763 10:3423641-3423663 CATGTGTCCGTGTCCTGGCCAGG + Intergenic
1063378744 10:5570874-5570896 CCTGTGTGCAGGTGCTGGCTGGG - Intergenic
1063584987 10:7344298-7344320 CATGTGTCAAGGGTGGGGCCAGG + Intronic
1064548196 10:16472361-16472383 CATGTGTCAAGGGTGGGGCCAGG + Intronic
1064989245 10:21241717-21241739 CAAATGCCCGGGTGGTGGCCTGG - Intergenic
1065452255 10:25871108-25871130 CATGTGTCAAGGATGAGGCCAGG + Intergenic
1067344221 10:45426320-45426342 CACGTGCCCTGGAGGTGGCCGGG - Intronic
1067570317 10:47366804-47366826 CATGTGTGTAGGTGGTGGGGAGG + Exonic
1068069735 10:52181268-52181290 CATGTCTCCTGGGGGTGGCCTGG + Intronic
1068221925 10:54056585-54056607 CATGTGTCAAGGGAGGGGCCAGG - Intronic
1068268068 10:54680593-54680615 CATGTGTCAAGGGTGGGGCCAGG + Intronic
1068699511 10:60004729-60004751 CATGTGTCCATGTGGTGGTTAGG + Intergenic
1069060024 10:63885532-63885554 CAGGTGTGGAGGTGCTGGCCTGG + Intergenic
1070128316 10:73639520-73639542 CATGTTTCCTGGGGGTGGGCAGG - Intronic
1070315981 10:75312858-75312880 CATGTGTCAAGGGTATGGCCAGG + Intergenic
1070539633 10:77406833-77406855 CAGGTCCCCACGTGGTGGCCAGG - Intronic
1071036999 10:81259386-81259408 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
1071506095 10:86232518-86232540 GATCTGTCCAGGTGGTGGTGGGG - Intronic
1072768904 10:98119935-98119957 CATGTGTCAAGGGCGGGGCCAGG + Intergenic
1074719295 10:116250789-116250811 CCTGAGCCCTGGTGGTGGCCTGG + Intronic
1075581975 10:123625692-123625714 CAGCTGTCCAGATGTTGGCCTGG - Intergenic
1076482730 10:130795502-130795524 CAGGTATCCAGGGAGTGGCCTGG - Intergenic
1076615006 10:131749445-131749467 CCTGGGTCCAGGTGATGGCCTGG - Intergenic
1076833879 10:133010277-133010299 CCTGTGTCCAGTTCGGGGCCAGG + Intergenic
1076849054 10:133084056-133084078 AATGAGGCCAGGTGGCGGCCTGG + Intronic
1076934514 10:133558525-133558547 CATGTGACCAGATGGAGGCAGGG + Intronic
1077420446 11:2447493-2447515 CATGTGGCTTGGTGGGGGCCTGG + Intronic
1078573913 11:12482831-12482853 CATGTGTCAAGGGTGGGGCCAGG - Intronic
1078900229 11:15635195-15635217 GATGTCTCAAGGTGGTGGCAAGG + Intergenic
1079226206 11:18607237-18607259 GTTGTGTCCAGTTGGAGGCCAGG - Exonic
1083715231 11:64571530-64571552 CAGGTGTCCAGGTTGTGCACTGG + Exonic
1083903576 11:65655728-65655750 AATGCGTCGAGGTGGAGGCCGGG + Exonic
1085014041 11:73160690-73160712 CCTGTGTGCAGGTGCTGGCTGGG + Intergenic
1085215401 11:74826423-74826445 CATGTGTCAAGGTAGAGTCCAGG - Intronic
1086129803 11:83389589-83389611 AATGTGACAAGTTGGTGGCCTGG + Intergenic
1086798829 11:91144899-91144921 CATGTGTCCAGGGTGAGGCCAGG - Intergenic
1087076906 11:94133999-94134021 CAGGTGTCTGGGAGGTGGCCAGG - Intronic
1087504595 11:99003471-99003493 CATGTGTCCAGGGAGAGACCAGG + Intergenic
1088023951 11:105155476-105155498 CATGTGTCTAGGTTGTGTCTAGG + Intergenic
1088552833 11:111031439-111031461 CATGTGTCCAGGGAGAGACCTGG + Intergenic
1091083889 11:132701314-132701336 CATGTGTCAAGGGTGGGGCCAGG - Intronic
1091104718 11:132907862-132907884 CATCTGTGCATGTGGAGGCCTGG + Intronic
1091981334 12:4866526-4866548 CATGAGTCCAGATGGTGAGCCGG - Intergenic
1092906095 12:13101549-13101571 CATGTGTCCCGGAGCTGGGCCGG + Intronic
1092971638 12:13701194-13701216 CATGTGTCAAGGGAGAGGCCAGG - Intronic
1093006759 12:14059555-14059577 CATGTGTCAAGGGAGTGACCAGG - Intergenic
1093014931 12:14146060-14146082 CATGTGTCCAGGGTGGAGCCAGG - Intergenic
1094761676 12:33540146-33540168 CATGTGCCCAGGTGGTTTGCTGG - Intergenic
1095598909 12:43992681-43992703 CATGTGTCCAGGTCTGGCCCAGG + Intronic
1097351570 12:58554815-58554837 CTTGTGTCCAGGTGAAGGCAAGG - Intronic
1097768372 12:63551703-63551725 CACGTGTCAAGGTTGGGGCCAGG - Intergenic
1097784737 12:63746767-63746789 CACGTGTCAAGGTTGGGGCCAGG - Intergenic
1100043708 12:90352780-90352802 CATGTGTCAAGGGTGTGGCCAGG + Intergenic
1100485022 12:95016970-95016992 CAAGTGTCAATGTGTTGGCCAGG - Intergenic
1100714818 12:97294555-97294577 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
1101231809 12:102749021-102749043 CATGTGTCAAGGATGGGGCCAGG - Intergenic
1101264680 12:103071533-103071555 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
1101735695 12:107461216-107461238 CATGTGTCAAGGGTGGGGCCAGG - Intronic
1101969978 12:109306070-109306092 CAGGTGCCCAGGTGCTGCCCAGG - Intronic
1102956899 12:117064804-117064826 CATGTGTCCAGCTGGTGGGGAGG + Intronic
1103615400 12:122148579-122148601 CATTTCTCAAGGTGGTGGCGTGG + Intergenic
1103930618 12:124448978-124449000 CATATGGCCACGTGGTGGGCTGG - Intronic
1104135251 12:125931555-125931577 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
1104329426 12:127830583-127830605 TCTGTGTCCTGGTGGTTGCCAGG + Intergenic
1104807915 12:131601247-131601269 CATGTGTCAAGGGCGGGGCCAGG - Intergenic
1104964016 12:132501014-132501036 CATGTGGCCAGGAGCTGGGCGGG + Intronic
1105950255 13:25223782-25223804 CATGTGTCAAGGGTGGGGCCAGG - Intergenic
1105955572 13:25279186-25279208 CATGTGTGCAGGAAGTGACCTGG + Intronic
1108361268 13:49669960-49669982 GATGTTTCCAGGCTGTGGCCAGG - Intronic
1110929093 13:81193616-81193638 CATGTGTCAAGGGTGGGGCCAGG - Intergenic
1112116989 13:96366794-96366816 CATGTGTCAAGGGTGGGGCCAGG + Intronic
1112800044 13:103100434-103100456 CATGTGTCCAGGGAGAGACCAGG - Intergenic
1115119618 14:29925445-29925467 CAGGCCTGCAGGTGGTGGCCTGG - Intronic
1116321961 14:43479319-43479341 CATGTGTACAGTCTGTGGCCAGG - Intergenic
1119400711 14:74360341-74360363 CTTGACTCCAGGTGCTGGCCTGG - Intergenic
1120597769 14:86462445-86462467 CATGTGTCCAGGGAGAGACCTGG - Intergenic
1121016876 14:90554263-90554285 CAGGTGTCCAGAGGGTGGTCGGG + Intronic
1121878790 14:97480428-97480450 CATGGTTCCACATGGTGGCCAGG + Intergenic
1121968118 14:98329276-98329298 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
1123124488 14:105936539-105936561 CATGTGTCCAGGGAGGGTCCAGG - Intergenic
1123493381 15:20800010-20800032 CAGGTGTCCAGGGTGTGGCAGGG - Intergenic
1123549890 15:21369112-21369134 CAGGTGTCCAGGGTGTGGCAGGG - Intergenic
1123708595 15:22968815-22968837 CATGAGTCCAGGTGGTGTTAAGG + Intronic
1123903301 15:24897632-24897654 CATGTGTCAAGGGTGGGGCCAGG + Intronic
1124382384 15:29177634-29177656 CACGAGTCCAGATGCTGGCCAGG - Intronic
1124621490 15:31276579-31276601 CATATGTGCAGGTGGTGGAGAGG + Intergenic
1125723946 15:41858737-41858759 CATGTGCCCAGGTGGCTGCGTGG - Exonic
1126332023 15:47543288-47543310 CATGTGTCAAGGGTGGGGCCAGG + Intronic
1129433662 15:75520249-75520271 CATGACTCCAGGTTGTGGCAGGG + Intronic
1129442733 15:75593576-75593598 AATATGACCAGGTGGAGGCCAGG - Intergenic
1129870000 15:78933992-78934014 CACCTGTCCAAGTGGTGGGCAGG + Intronic
1129883819 15:79025218-79025240 TATGGGCCCAGGTGGTGGGCAGG - Intronic
1130080929 15:80732873-80732895 CATGTGGCCTTGTGGTGTCCTGG + Intronic
1131821823 15:96281650-96281672 CATGTGTCAAGGGAGGGGCCAGG + Intergenic
1202958219 15_KI270727v1_random:96330-96352 CAGGTGTCCAGGGTGTGGCAGGG - Intergenic
1133002978 16:2860413-2860435 CATGGGACCAGGCGGTGGCTTGG + Intergenic
1133023056 16:2975307-2975329 GATGTGTTCAGGTGGGGACCGGG - Exonic
1133507821 16:6429606-6429628 CATGTGTCAAGGGTGGGGCCAGG + Intronic
1133961581 16:10498063-10498085 CCTGTGTCCAGCTGGTTACCAGG - Intergenic
1134151880 16:11811638-11811660 AAGATGTCCATGTGGTGGCCAGG + Intergenic
1134368526 16:13602107-13602129 CATGTGTCAAGGCTGGGGCCAGG - Intergenic
1136075123 16:27811985-27812007 CAGGTGTCCAGCTTGAGGCCTGG - Intronic
1137340329 16:47596043-47596065 CATGTGTCAAGGGTGGGGCCAGG + Intronic
1137445404 16:48528606-48528628 AATGTGTCCACATGGTGGGCAGG - Intergenic
1137541026 16:49361816-49361838 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
1138076670 16:54049641-54049663 CAAGTGTTAAGGTGGTGGCTGGG + Intronic
1139146742 16:64334106-64334128 CATGTGTCCAGGGAGGGACCTGG - Intergenic
1139335455 16:66227890-66227912 CATGTGTCAAGGGAGAGGCCAGG - Intergenic
1139492366 16:67293207-67293229 CATGGGTCTAGCTGGAGGCCAGG - Intronic
1140094321 16:71861888-71861910 CATGTGTCCTGTCTGTGGCCGGG - Exonic
1141519904 16:84571720-84571742 CATGTGTCCACGTGACGTCCAGG - Intronic
1142029923 16:87833374-87833396 CATGTGTCCAGGTGGTGGCCCGG - Intronic
1142518536 17:489617-489639 CATGTGTCCGGCCTGTGGCCAGG + Intergenic
1142599271 17:1045543-1045565 CATGTGCCCAGGAGTGGGCCAGG - Intronic
1143296280 17:5874355-5874377 AATGGGTCAAGGTGGTGACCAGG - Intronic
1143623629 17:8095591-8095613 CATGTGTCCAGGAGGAGAACTGG + Intergenic
1144138845 17:12325996-12326018 CATGTGTCAAGGGCGGGGCCAGG - Intergenic
1144770770 17:17758242-17758264 TGAGTGCCCAGGTGGTGGCCGGG - Intronic
1147645790 17:42033128-42033150 CATGTTTCAAGGAGGTGGGCCGG - Intronic
1147793255 17:43025854-43025876 CTTGTGTCCAGGGGCTGGGCTGG + Intronic
1147979084 17:44263639-44263661 ATTGGGTCAAGGTGGTGGCCAGG - Intronic
1148501327 17:48093760-48093782 GATATGTTCAGGTTGTGGCCAGG - Intronic
1149376325 17:56047670-56047692 CATGTGTCATGGTGGGGGCAGGG - Intergenic
1150630492 17:66877134-66877156 CTGGTGTCCAGGGGGTTGCCTGG + Intronic
1150967482 17:69987977-69987999 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
1151166700 17:72209935-72209957 GATGTGTGCAGGAGGGGGCCTGG - Intergenic
1151230886 17:72684292-72684314 CAAGTGTCCAGCTTGTGGCCTGG + Intronic
1151317782 17:73334726-73334748 CCTGTGCTCAGGTGGTGGTCAGG + Exonic
1152311949 17:79556885-79556907 CCTGTGTCCAGCTGGTGCTCAGG + Intergenic
1152569664 17:81116147-81116169 CATTTGGCCAGCTGGTGGCTGGG + Intronic
1153628274 18:7042539-7042561 CATGAGTCCTTGTGGTGTCCTGG - Intronic
1154450933 18:14474548-14474570 CAAGTGTCCAGGGTGTGGCGGGG - Intergenic
1157189318 18:45567589-45567611 CCTGTGTCCAGGGGTTAGCCCGG + Intronic
1160153060 18:76409880-76409902 CATGTGTCAAGGGTGGGGCCAGG + Intronic
1161308233 19:3578805-3578827 CCTGTGTCCTGGGGGTGGCCCGG - Exonic
1161592379 19:5134638-5134660 CATGTGGCCAGGTCCTGTCCTGG - Intronic
1162141199 19:8586459-8586481 CCTTTCTCCAGGTGCTGGCCCGG - Exonic
1162788709 19:13052083-13052105 CAGGCATCCAGGTGGTGCCCGGG + Intronic
1162796571 19:13090400-13090422 CCTGCATCCAGGTGGTGGGCAGG - Intronic
1163068029 19:14813824-14813846 CATGTGTCAAGGAAGGGGCCTGG - Intronic
1163235199 19:16025724-16025746 CAGCTGGCCAGGTGCTGGCCAGG - Intergenic
1163254054 19:16144167-16144189 TCTGTGTCCTGGTGCTGGCCTGG - Intronic
1163902306 19:20114097-20114119 CATGTTTCCCCATGGTGGCCAGG - Intronic
1164967207 19:32495810-32495832 CATGTGTCAAGGGTGGGGCCAGG - Intergenic
1165062502 19:33211710-33211732 CCTGTGTCCAGGTGGGGGTGGGG - Intronic
1165473713 19:36017607-36017629 CAGGGCTCCAGGTGGTGCCCTGG + Intronic
1166334740 19:42098954-42098976 CCTGTGTCTACGTGGTGGCTTGG - Intronic
925262744 2:2542552-2542574 CAAGTGCCCAGGAGGCGGCCTGG + Intergenic
925539033 2:4946408-4946430 CATGTGTCAAGGGGGAGACCAGG - Intergenic
925702682 2:6654833-6654855 CATGATTCCAGGTGGAGGGCAGG - Intergenic
925930476 2:8703278-8703300 GGTGTGGTCAGGTGGTGGCCAGG - Intergenic
926089447 2:10040995-10041017 CAGGTGAGCAGGTGGTGGCCAGG + Intergenic
926140525 2:10365304-10365326 CCTGCCTCCAGGTGGTGGCGCGG + Intronic
926492718 2:13544493-13544515 CATGTGTCCAGGGAGGGACCGGG + Intergenic
927126920 2:20020614-20020636 CATGTGTCAAGGTTGGTGCCAGG - Intergenic
929955513 2:46455297-46455319 CTTGGGTCAAGGTGGTGGCAGGG - Intronic
930587534 2:53285717-53285739 CATGTGTCGAGGGTGAGGCCAGG + Intergenic
934751110 2:96794789-96794811 CATGTATCTGGTTGGTGGCCAGG - Intronic
934863876 2:97788578-97788600 CATGTGCCCAGGTGGTGGAGTGG - Intronic
935293284 2:101627611-101627633 AATCTGGGCAGGTGGTGGCCAGG - Intergenic
935612682 2:105042188-105042210 CAAGAGTCCAGGTATTGGCCGGG + Intronic
937238934 2:120447812-120447834 CATGCAGCCAGGCGGTGGCCAGG + Intergenic
937593563 2:123645237-123645259 CACGTGTCCAGGGAGGGGCCTGG + Intergenic
938944267 2:136197000-136197022 CATGTGTCAAGGGTGGGGCCAGG - Intergenic
939278920 2:140037977-140037999 CATGTGTCAAGGGTGCGGCCAGG - Intergenic
941121006 2:161530233-161530255 CATGTGTCAAGGGTGGGGCCAGG + Intronic
941491065 2:166142769-166142791 CATGTGTCAAGGGTGAGGCCAGG + Intergenic
942489497 2:176475426-176475448 CATGTGTCAAGGGTGGGGCCAGG - Intergenic
943010403 2:182441231-182441253 CATGTGTCAAGGATGGGGCCAGG - Intronic
943115484 2:183664517-183664539 CATGTGTCAAGGTCAGGGCCAGG - Intergenic
944307579 2:198195485-198195507 CATGTCTCCACATGGTGGCAGGG + Intronic
945293938 2:208151986-208152008 CATGTGTCAAGGGTGGGGCCAGG - Intergenic
945347090 2:208731569-208731591 CATGTGTCCTGGTGGTGGCAGGG + Intronic
945529096 2:210927563-210927585 CATGTGTCAAGGGAGGGGCCTGG + Intergenic
947049645 2:226027747-226027769 CATGTGTCAAGTGGGGGGCCAGG - Intergenic
948099200 2:235359961-235359983 CATGTGACCAAGAGGTGGCTGGG + Intergenic
948644195 2:239393517-239393539 ATTGTGGCCAGATGGTGGCCTGG - Intronic
948867420 2:240782935-240782957 CCTGTGTCTGGGAGGTGGCCAGG - Intronic
1168927210 20:1591887-1591909 CATGTGTCAAGGGAGTGACCTGG + Intronic
1169026367 20:2374943-2374965 CCTGTGTCCAGCTGGTTGCTTGG + Intergenic
1169679611 20:8196125-8196147 CATGTGTCAAGGGAGGGGCCAGG - Intronic
1170157343 20:13280628-13280650 TCTGTGTCCAGCTGGTGTCCAGG + Intronic
1170300019 20:14873029-14873051 CATGTGTCAAGGGGGAGACCAGG - Intronic
1172008964 20:31835464-31835486 CCGGTCTCCAGGTGGAGGCCAGG + Intergenic
1172193645 20:33077423-33077445 CAGGTGGCCAGACGGTGGCCAGG + Intergenic
1172618095 20:36303014-36303036 CAAGTTTCCAGGTGATGCCCGGG - Intergenic
1173448023 20:43137742-43137764 CATGTGTGCATGTGTTGGCAGGG - Intronic
1173951499 20:46997155-46997177 CCTTTGCCCAGGTGCTGGCCTGG - Intronic
1174096419 20:48092946-48092968 CATGTGTCCAGTGAGTGGACGGG - Intergenic
1174510232 20:51045830-51045852 CATGTGTCAAGGGCGGGGCCAGG - Intergenic
1175905847 20:62378950-62378972 TATGTGTCCAGGAAGGGGCCTGG - Intergenic
1176188685 20:63796027-63796049 CATCTATCCAGGCTGTGGCCAGG - Intronic
1176445303 21:6816025-6816047 CAGGTGTCCAGGGTGTGGCAGGG + Intergenic
1176823471 21:13681058-13681080 CAGGTGTCCAGGGTGTGGCAGGG + Intergenic
1177226858 21:18268322-18268344 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
1177289833 21:19096744-19096766 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
1177861701 21:26462236-26462258 CGTGTGTTCAGGTGGTGGCAAGG + Intergenic
1177931889 21:27295637-27295659 CATGTGTCAAGGTCGGGACCAGG - Intergenic
1177931993 21:27296767-27296789 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
1178048154 21:28719320-28719342 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
1178392754 21:32212692-32212714 CACATGTCAAGGTGGGGGCCAGG + Intergenic
1178522573 21:33298913-33298935 CAGGTGTCATGGTGCTGGCCAGG + Intergenic
1179052808 21:37903195-37903217 CATGTGTCAAGGGTGGGGCCAGG + Intronic
1179390944 21:40990570-40990592 GATGTTTGCAGATGGTGGCCTGG + Intergenic
1179551777 21:42147844-42147866 CATGGGTCCTGGGGGTGGCCTGG + Intergenic
1180685811 22:17665568-17665590 CATGTGTCAAGGGCGGGGCCAGG - Intronic
1181146979 22:20855692-20855714 CATGTGTGCAGTTTGTGCCCAGG + Intronic
1182572066 22:31247022-31247044 CCTGTGTCCAGTTGGTGGAATGG + Intronic
1183036116 22:35142217-35142239 CATGTGTGCAGGTAGGGACCGGG - Intergenic
1183988669 22:41583715-41583737 GATGTTCCCAGGTGTTGGCCTGG + Intronic
1184452730 22:44592541-44592563 CTTGTGTCCAGGTGTGGGCAAGG - Intergenic
1184673343 22:46027308-46027330 CATGTGTCCCCGTGTTGGCCCGG - Intergenic
1185258265 22:49848553-49848575 CCTCTGTCCAGGCGGCGGCCGGG - Intergenic
950526432 3:13526793-13526815 GGTGTCTCCAGGTGGGGGCCAGG + Intergenic
950905116 3:16530889-16530911 CATGTGTCCAGGTGATTTCTTGG + Intergenic
953796057 3:45986771-45986793 CCTGTGTTCAGCTGGTGACCTGG - Intronic
954036503 3:47853748-47853770 TCTGTGTGCAGGGGGTGGCCTGG - Intronic
954224365 3:49172769-49172791 CATGTCTGCAGGAGGTGGCCGGG + Exonic
955052446 3:55425620-55425642 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
955405045 3:58620661-58620683 CATGTGCCCAGGTGCTGGCTGGG - Intronic
955416176 3:58694082-58694104 CATGTGTGCTGCTGGTGGGCAGG + Intergenic
957723222 3:84031631-84031653 CGTGTGGCCAGGCTGTGGCCTGG - Intergenic
957956698 3:87196806-87196828 CATGTGTCCAGGGTGGGACCAGG + Intergenic
958649955 3:96926303-96926325 CATGTGTCGAGGAAGGGGCCTGG - Intronic
958671409 3:97210444-97210466 CACGTGTCAAGGTAGGGGCCTGG - Intronic
962684875 3:137837722-137837744 CATGTGTCAAGGGCATGGCCAGG + Intergenic
963333777 3:143947810-143947832 CATGTGTCAAGGATGGGGCCAGG - Intergenic
963539621 3:146568267-146568289 CATGTGTCAAGGGTGGGGCCAGG - Intergenic
964132913 3:153311231-153311253 CATGCATCAAGGTGTTGGCCAGG - Intergenic
965281757 3:166764163-166764185 CATGTGTCCAGGGAGAGACCAGG - Intergenic
965305694 3:167060437-167060459 CATGTGTCCAGGGTGGGACCAGG - Intergenic
965929662 3:174027891-174027913 CATGTGTCAAGGGTGGGGCCAGG + Intronic
967564772 3:190960316-190960338 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
968439944 4:618228-618250 CAGGTGTCCAGGTTGAGTCCAGG + Intergenic
968822784 4:2868353-2868375 CATGTCTCTTGGTGCTGGCCAGG + Intronic
968908951 4:3466948-3466970 CGTGTGTCCTGGCTGTGGCCTGG + Intronic
969261907 4:6038956-6038978 CATGTGTCCATGCTGGGGCCAGG - Intronic
969440476 4:7213871-7213893 CATGTCTCCAGGAGCTGGGCTGG + Intronic
969446730 4:7249152-7249174 CTTGTGTTCAGATGGTGGCTGGG + Intronic
969567892 4:7990735-7990757 CATGAGTCCAGGTGCTGAGCAGG + Intronic
970776944 4:19686053-19686075 CATGTGTCAAGGTCAGGGCCAGG - Intergenic
970887667 4:21005238-21005260 CATGTGACCAGGTGGATGTCAGG - Intronic
970987127 4:22171647-22171669 CATGTGTCAAGGGTGGGGCCAGG - Intergenic
971611430 4:28731242-28731264 CATGTGTCAAGGATGGGGCCAGG - Intergenic
971972081 4:33633870-33633892 CATGTGTCTAGGGAGGGGCCTGG + Intergenic
972300086 4:37777075-37777097 GATGTGTCCAGGTGGCAGCTTGG + Intergenic
972694734 4:41434285-41434307 GATGTCTACAGCTGGTGGCCAGG - Intronic
973565329 4:52180691-52180713 CACGTGTCAAGGGTGTGGCCTGG + Intergenic
973736074 4:53872667-53872689 CATGTGTCGAGGGAGGGGCCTGG + Intronic
974827437 4:67149330-67149352 CATGTGTCAAGGGAGTGACCTGG - Intergenic
975411809 4:74061542-74061564 CATGTGTCTGGTTGGTGGCTGGG - Intergenic
975796380 4:78010888-78010910 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
975800327 4:78054881-78054903 CATGTGCCCCTGTGGTGGACTGG + Intergenic
976288642 4:83395024-83395046 CATGTGTCTAGGTATTGGTCAGG + Intergenic
976365006 4:84223267-84223289 CATGTGTCAAGGGAGAGGCCAGG - Intergenic
976427876 4:84927579-84927601 CATGTGTCAAGGGCGGGGCCAGG + Intronic
976908642 4:90272115-90272137 CATGTGTCCAGGGAGAGACCTGG - Intronic
977393575 4:96445250-96445272 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
979787580 4:124735349-124735371 CATGTGTCCAGGGAGGGACCTGG + Intergenic
979894029 4:126135335-126135357 CATGTGTCAAGGGAGTGACCAGG + Intergenic
981251648 4:142610099-142610121 CATGTGTCAAGGGTGGGGCCAGG + Intronic
981335920 4:143568815-143568837 CATGTGTCAAGGATGGGGCCAGG - Intergenic
982507546 4:156239320-156239342 CATGTGTCCAGGGAGGGACCTGG + Intergenic
982765663 4:159345585-159345607 CATGTGTACTGGTTGTGTCCAGG - Intronic
983348760 4:166560071-166560093 CATGTGTCAAGGGCGGGGCCAGG + Intergenic
983689145 4:170446811-170446833 CATGTGTCAAGGGTGGGGCCAGG - Intergenic
984279041 4:177645299-177645321 CTTGGGTCCAGGTGGTTGTCTGG - Intergenic
984521027 4:180801114-180801136 CATGTATGGAGGTGGCGGCCAGG - Intergenic
985023372 4:185714818-185714840 CATGTGTCAAGGGTGGGGCCAGG - Intronic
985487787 5:161712-161734 CATGTCTCCAGGTGTGGGCTGGG - Intronic
986407368 5:7439448-7439470 CATGTGTCAAGGGTGGGGCCAGG - Intronic
986580176 5:9257743-9257765 CATGCATCAAGGTGGTGGTCAGG + Intronic
987262667 5:16219410-16219432 CATGTGTCAAGGGGGTGGCCAGG + Intergenic
987708902 5:21485232-21485254 CATGTGTCAAGGGTGGGGCCAGG - Intergenic
987893901 5:23919618-23919640 CATGTATCAAGGTGGAGACCAGG + Intergenic
988134991 5:27158846-27158868 CATGTGTCAAGGGAGGGGCCTGG + Intergenic
988750710 5:34188914-34188936 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
989016860 5:36946187-36946209 CATCTCTCCAAGTGGTGGCAGGG + Intronic
989067668 5:37480641-37480663 CATGTGTCAAGGGCGGGGCCAGG - Intronic
989112809 5:37923626-37923648 CATGTGTCAAGGGTGGGGCCAGG - Intergenic
991606026 5:68401900-68401922 CATGTGTCCAGGCAGGGACCTGG - Intergenic
991735848 5:69630839-69630861 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
991738976 5:69652127-69652149 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
991759222 5:69904304-69904326 CATGTGTCAAGGGTGGGGCCAGG - Intergenic
991788114 5:70213818-70213840 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
991790551 5:70231868-70231890 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
991812342 5:70486478-70486500 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
991815301 5:70506955-70506977 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
991818437 5:70528244-70528266 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
991838451 5:70779370-70779392 CATGTGTCAAGGGTGGGGCCAGG - Intergenic
991880561 5:71214182-71214204 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
991882998 5:71232203-71232225 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
992431806 5:76716936-76716958 CTTGTGTCCAGGAGGTGCGCAGG + Intronic
993130176 5:83886924-83886946 CATTTGTGCAGGTGGGGGCAAGG + Intergenic
993303821 5:86249842-86249864 CATGTGTCAGGGTAGAGGCCTGG - Intergenic
994421028 5:99526581-99526603 CATGTGTCAAGGGTGGGGCCAGG - Intergenic
994486016 5:100387733-100387755 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
994905629 5:105838617-105838639 CATGTGTCAAGGGTGGGGCCAGG - Intergenic
996020538 5:118586557-118586579 CTTGTGTTCAGGTGGTAGCACGG + Intergenic
997044277 5:130294898-130294920 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
999249792 5:150175768-150175790 CACATGTCCAGCTGGTGGGCCGG + Intronic
999420618 5:151439238-151439260 CATGTGTCAAGGGAGGGGCCTGG - Intronic
999812295 5:155139299-155139321 CATGAGTCTGGATGGTGGCCTGG + Intergenic
1000221176 5:159216063-159216085 AATATGTACAGGTGGTGACCAGG - Intergenic
1004249587 6:14012613-14012635 CATGAGTCCAGGGGGTAGGCTGG + Intergenic
1005548781 6:26895219-26895241 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
1007088824 6:39169294-39169316 CCTGTGACCAGGTGGAGGACAGG - Intergenic
1007826930 6:44607640-44607662 GTTGTGTCCAGGTGGTTTCCAGG + Intergenic
1009019533 6:57936331-57936353 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
1009498929 6:64386523-64386545 CATGTGTCAAGGGTGGGGCCAGG - Intronic
1009588021 6:65631221-65631243 CTTGTGTCCAGAAGGTGGGCTGG - Intronic
1009838952 6:69041977-69041999 CATGTGTCCTGGGAGGGGCCAGG + Intronic
1010037228 6:71340369-71340391 CCTGGTTCCAGGAGGTGGCCTGG - Intergenic
1010043110 6:71410186-71410208 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
1013213872 6:108009754-108009776 CATGTGTCAAGGTGAGGACCAGG - Intergenic
1013351124 6:109306751-109306773 CATGAGTCAAGATGTTGGCCAGG + Intergenic
1017606147 6:156135365-156135387 CATGTGTCAAGGGTGCGGCCAGG - Intergenic
1017890431 6:158633249-158633271 CATGTGTCCACATGGCGGTCAGG + Exonic
1018585741 6:165356165-165356187 CATGTGTCAAGGGAGGGGCCTGG - Intronic
1018920209 6:168167368-168167390 CATGTGTCAAGGGAGGGGCCTGG - Intergenic
1019791067 7:3014289-3014311 CAGGTGACCAGATGGTGGGCTGG - Intronic
1021411795 7:20337487-20337509 AATGTGTCCAGGAGGGTGCCTGG - Intronic
1021803546 7:24332458-24332480 CATGTGTCAAGGGTGGGGCCAGG - Intergenic
1022820808 7:33958878-33958900 CATGTGTCAAGGGTGGGGCCAGG + Intronic
1023653117 7:42391034-42391056 CATCAGACCAGGTGGTGGGCTGG + Intergenic
1026480152 7:70771675-70771697 CATGTGTCTAAGTGGCGTCCCGG + Intronic
1027462890 7:78477696-78477718 CATGTGTCAAGGGCGGGGCCAGG - Intronic
1027764044 7:82316901-82316923 CATGTGTCAAGGGTGAGGCCAGG - Intronic
1028738922 7:94249835-94249857 CATGTGTCAAGGGTGGGGCCAGG - Intergenic
1028918321 7:96284635-96284657 CATGTGTCCAGGGCGGGGCCAGG + Intronic
1028989877 7:97037245-97037267 CATATGTACAGGTGGTGGTCCGG - Intergenic
1032658054 7:133953300-133953322 AATTTGGCCAGGCGGTGGCCAGG + Intronic
1032963355 7:137066567-137066589 CATGTGTCAAGGGCGAGGCCAGG + Intergenic
1032995305 7:137439568-137439590 CATGTGTCAAGGATGGGGCCAGG - Intronic
1034831815 7:154315273-154315295 AATGTGTACAGGTGATGTCCTGG - Intronic
1034943784 7:155249128-155249150 CATGCGTCAAGGTTGGGGCCAGG - Intergenic
1035050883 7:155998548-155998570 CATGTGGCCAGGCGGGGGCGCGG - Intergenic
1035338285 7:158143970-158143992 CGTCTGGGCAGGTGGTGGCCCGG - Intronic
1035579711 8:731947-731969 CATGTGTCCAGCAGGTGTCTGGG - Intronic
1037243601 8:16805512-16805534 CATGTGTCAAGGGTGGGGCCAGG - Intergenic
1037937952 8:22927877-22927899 CTTGTGTCCGGGTGGTGGACTGG - Exonic
1038676205 8:29624787-29624809 CATATGTCAAGATGGTAGCCTGG + Intergenic
1039067032 8:33617755-33617777 CAGGTTTGCAGGTGCTGGCCTGG + Intergenic
1039335295 8:36582414-36582436 CATATGTCCATGAGGTGGTCAGG + Intergenic
1040380266 8:46865320-46865342 CATGTCTCCCCGGGGTGGCCAGG + Intergenic
1041313395 8:56538604-56538626 CATTTCTCCAGCTGGTGGTCTGG + Intergenic
1042403777 8:68379792-68379814 CATGTGACCAGAGGGTGTCCTGG - Intronic
1042481185 8:69304721-69304743 CATGTGTCGAGGGTGGGGCCAGG - Intergenic
1044609432 8:94077715-94077737 CTTGTCTCCAGGTGTTGGCTGGG + Intergenic
1046822437 8:118648919-118648941 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
1048873110 8:138814954-138814976 CATGTGTCAAGGGTGGGGCCAGG + Intronic
1049247307 8:141569694-141569716 CCTGGATCCAGGTGCTGGCCTGG + Intergenic
1049979638 9:892402-892424 CAGGTGTGCAGGTGGAGGGCTGG - Intronic
1050755694 9:9000610-9000632 CAGGTGTCCAGATGGTGCCATGG - Intronic
1050897637 9:10902928-10902950 CATGTGTCAAGCGGGGGGCCAGG - Intergenic
1050973608 9:11909175-11909197 TATGTGTCCAGGAAGTGTCCAGG + Intergenic
1051218269 9:14821972-14821994 CATGTGTCAAGGATGGGGCCAGG + Intronic
1051422005 9:16897980-16898002 CATGTGTCAAGGGTGGGGCCAGG - Intergenic
1051914889 9:22197046-22197068 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
1055018743 9:71646668-71646690 TCTGTCTCCAGGTGGTGGGCAGG + Intergenic
1055774252 9:79751257-79751279 CATGTGTCAAGGGTGGGGCCAGG - Intergenic
1057440511 9:95079659-95079681 CCTGTGTCCAGAGGGCGGCCAGG + Intronic
1058047303 9:100370394-100370416 CATGTGTCAAGGGTGGGGCCAGG - Intergenic
1059897376 9:118881858-118881880 CATGTGATCAGCTGGTGGCTTGG - Intergenic
1060521638 9:124297430-124297452 CAGGAGTCCAGGTCCTGGCCCGG - Intronic
1060723363 9:125992567-125992589 CAGGGCTCCAGGTGGTTGCCAGG + Intergenic
1061721062 9:132551741-132551763 CATGTGGCCAGGTGGGGACTTGG + Intronic
1061910635 9:133720764-133720786 CATGTGTCAAGGGTGGGGCCAGG - Intronic
1203523892 Un_GL000213v1:68500-68522 CAGGTGTCCAGGGTGTGGCAGGG - Intergenic
1203486774 Un_GL000224v1:63466-63488 CATGTGTCAAGGGTGGGGCCGGG - Intergenic
1203499396 Un_KI270741v1:5366-5388 CATGTGTCAAGGGTGGGGCCGGG - Intergenic
1185766440 X:2729530-2729552 CATGTGTCCAGGGAGAGACCAGG - Intronic
1186025298 X:5304305-5304327 CATGTGTCCAGGGAGGGGCCTGG + Intergenic
1186163053 X:6798344-6798366 CATGTGTCAAGGGTGCGGCCAGG - Intergenic
1187458724 X:19466345-19466367 CATGTGTCAAGGTAGAGACCAGG + Intronic
1187726812 X:22211967-22211989 CATGTGTCAAGGGTGGGGCCAGG - Intronic
1188361511 X:29260556-29260578 CATGTGTCAAGGGCGGGGCCAGG - Intronic
1190429817 X:50368260-50368282 CATATGTCCAGGTGGTGCTCTGG - Exonic
1190486128 X:50927121-50927143 TATGTGTTCAGGGGCTGGCCTGG + Intergenic
1192190250 X:68986899-68986921 CATGAGACCTGGTGGTGGCTGGG - Intergenic
1192215007 X:69151946-69151968 CAGGAGTCCAGGGGGAGGCCAGG + Intergenic
1192960206 X:76122217-76122239 CATGTGTCAAGGTCGGGACCAGG + Intergenic
1194328056 X:92545078-92545100 CATGCTTCCATGTGGAGGCCTGG + Intronic
1196283549 X:113852999-113853021 CATGTGTCAAGGGCGTGACCAGG + Intergenic
1197251086 X:124217084-124217106 CATGTGTCCAGCAGGAGGCCTGG - Intronic
1197441407 X:126495165-126495187 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
1197499209 X:127222990-127223012 CATGTTTCAAGGGTGTGGCCAGG + Intergenic
1197578666 X:128255305-128255327 CATGTGTCAAGGGTGGGGCCAGG - Intergenic
1198946671 X:142023871-142023893 CATGTGTCAAGGGCGGGGCCAGG - Intergenic
1199228795 X:145410418-145410440 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
1199270901 X:145881703-145881725 CATGTGTCCAGGGAGGGACCAGG - Intergenic
1199868004 X:151871572-151871594 CAAGTATGCAGGTGGAGGCCTGG - Intergenic
1200380854 X:155835395-155835417 CATGTGTCAAGGGTGGGGCCAGG + Intergenic
1200636767 Y:5664287-5664309 CATGCTTCCATGTGGAGGCCTGG + Intronic