ID: 1142029924

View in Genome Browser
Species Human (GRCh38)
Location 16:87833379-87833401
Sequence CCAGGCATGTGTCCAGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 333}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142029924_1142029934 5 Left 1142029924 16:87833379-87833401 CCACCACCTGGACACATGCCTGG 0: 1
1: 0
2: 2
3: 24
4: 333
Right 1142029934 16:87833407-87833429 TCACAGCAGGCAGGGCCGGAGGG 0: 1
1: 0
2: 0
3: 22
4: 305
1142029924_1142029928 -8 Left 1142029924 16:87833379-87833401 CCACCACCTGGACACATGCCTGG 0: 1
1: 0
2: 2
3: 24
4: 333
Right 1142029928 16:87833394-87833416 ATGCCTGGACTGTTCACAGCAGG 0: 1
1: 0
2: 1
3: 14
4: 135
1142029924_1142029938 22 Left 1142029924 16:87833379-87833401 CCACCACCTGGACACATGCCTGG 0: 1
1: 0
2: 2
3: 24
4: 333
Right 1142029938 16:87833424-87833446 GGAGGGGCCAATCTGCTAACGGG 0: 1
1: 0
2: 0
3: 5
4: 85
1142029924_1142029937 21 Left 1142029924 16:87833379-87833401 CCACCACCTGGACACATGCCTGG 0: 1
1: 0
2: 2
3: 24
4: 333
Right 1142029937 16:87833423-87833445 CGGAGGGGCCAATCTGCTAACGG 0: 1
1: 0
2: 0
3: 7
4: 47
1142029924_1142029933 4 Left 1142029924 16:87833379-87833401 CCACCACCTGGACACATGCCTGG 0: 1
1: 0
2: 2
3: 24
4: 333
Right 1142029933 16:87833406-87833428 TTCACAGCAGGCAGGGCCGGAGG 0: 1
1: 0
2: 1
3: 20
4: 262
1142029924_1142029935 6 Left 1142029924 16:87833379-87833401 CCACCACCTGGACACATGCCTGG 0: 1
1: 0
2: 2
3: 24
4: 333
Right 1142029935 16:87833408-87833430 CACAGCAGGCAGGGCCGGAGGGG No data
1142029924_1142029931 -3 Left 1142029924 16:87833379-87833401 CCACCACCTGGACACATGCCTGG 0: 1
1: 0
2: 2
3: 24
4: 333
Right 1142029931 16:87833399-87833421 TGGACTGTTCACAGCAGGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 205
1142029924_1142029940 29 Left 1142029924 16:87833379-87833401 CCACCACCTGGACACATGCCTGG 0: 1
1: 0
2: 2
3: 24
4: 333
Right 1142029940 16:87833431-87833453 CCAATCTGCTAACGGGTCCTCGG No data
1142029924_1142029932 1 Left 1142029924 16:87833379-87833401 CCACCACCTGGACACATGCCTGG 0: 1
1: 0
2: 2
3: 24
4: 333
Right 1142029932 16:87833403-87833425 CTGTTCACAGCAGGCAGGGCCGG 0: 1
1: 0
2: 1
3: 42
4: 419
1142029924_1142029930 -4 Left 1142029924 16:87833379-87833401 CCACCACCTGGACACATGCCTGG 0: 1
1: 0
2: 2
3: 24
4: 333
Right 1142029930 16:87833398-87833420 CTGGACTGTTCACAGCAGGCAGG 0: 1
1: 0
2: 1
3: 12
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142029924 Original CRISPR CCAGGCATGTGTCCAGGTGG TGG (reversed) Intronic
900285220 1:1895804-1895826 CAAGGGATGAGTCCTGGTGGGGG - Intergenic
900592626 1:3466820-3466842 ACAGGCATGGGCCCAGGAGGGGG + Intronic
902504016 1:16927929-16927951 CCATGCACGTGTCCCGGGGGTGG + Intronic
902625795 1:17675581-17675603 GCAGGGATGTGTGCAGGTGTGGG + Intronic
902625808 1:17675653-17675675 GCAGGCATGGGTGCAGGTGTGGG + Intronic
902625815 1:17675710-17675732 GCAGGCCTGTGTGCAGGTGTGGG + Intronic
902625832 1:17675802-17675824 ACAGGCATGGGTGCAGGTGTGGG + Intronic
902625873 1:17676052-17676074 GCAGGCATGGGTGCAGGTGTAGG + Intronic
902625944 1:17676422-17676444 GCAGGCATGGGTGCAGGTGTGGG + Intronic
902992228 1:20196342-20196364 CCAGGGTTGTATGCAGGTGGTGG - Intergenic
903122278 1:21224086-21224108 CCAGGCTTGTGTCTAGTTCGTGG + Intronic
903261515 1:22134110-22134132 CCCTGCGGGTGTCCAGGTGGGGG + Intronic
903452397 1:23463147-23463169 CCAGGCATGGTGCCAGATGGTGG + Intronic
904254981 1:29249199-29249221 CCATGCATGTGTCCACATGCAGG - Intronic
906318330 1:44802063-44802085 TCATGCATGTGTGAAGGTGGAGG + Intronic
907339930 1:53727638-53727660 CCAGGCCAGGGGCCAGGTGGAGG - Intronic
907514996 1:54988246-54988268 CCAGGCGTGAGTGCAGGGGGTGG + Intronic
908249491 1:62253946-62253968 CCAGGCATATGGGCAGGTGAGGG - Intronic
910077560 1:83298814-83298836 CCAAGTCTGTTTCCAGGTGGAGG - Intergenic
910234853 1:85024889-85024911 CCAGGCATGTGCCTAGGAAGGGG - Intronic
912490994 1:110062816-110062838 CCAGGCAGCTGGGCAGGTGGGGG - Intronic
913053824 1:115139486-115139508 ACAGTGATGTGTCCTGGTGGTGG + Intergenic
913460121 1:119076538-119076560 CCAGGTAATTGCCCAGGTGGAGG + Exonic
914341522 1:146764173-146764195 CCAGGCATTCTTCCAGGTGCTGG - Intergenic
916263701 1:162868988-162869010 CCAAGTCTGTTTCCAGGTGGAGG - Intergenic
917150847 1:171943165-171943187 CCAGGCATGTGTCCACCTTAGGG - Intronic
918792458 1:188846777-188846799 CCATGGTGGTGTCCAGGTGGGGG + Intergenic
919087145 1:192933808-192933830 ACAGGGATGTGTCCAGATAGAGG + Intergenic
919768485 1:201142221-201142243 CCAGGCATGTGCGCAGGGTGGGG + Intronic
919984121 1:202661036-202661058 CCAGACATGGCTCCAGGTGCTGG + Intronic
920891697 1:209993281-209993303 CTAGGCATGTGTCCAAGGAGGGG - Intronic
920919737 1:210288668-210288690 CCAGGGAAGGGTCCAGGAGGAGG - Intergenic
921985029 1:221303460-221303482 CGAGGCATGTGTGGGGGTGGGGG + Intergenic
922091347 1:222398397-222398419 CCAGGCATGGTTCCAGGTGTGGG - Intergenic
922715320 1:227867445-227867467 CCAGGTCTGTGTCATGGTGGCGG + Intergenic
1062866524 10:860110-860132 CCATGCATGTGTGGGGGTGGGGG + Intronic
1063501971 10:6563469-6563491 CGAGGCATGTGTCATGGTGAGGG - Intronic
1066006514 10:31150830-31150852 GCAGGCCTGTGTGGAGGTGGAGG + Intergenic
1066716529 10:38292752-38292774 GCAGGCCTGGGGCCAGGTGGCGG + Intergenic
1068480742 10:57585556-57585578 CCAAGTCTGTTTCCAGGTGGTGG - Intergenic
1068699510 10:60004724-60004746 TGAGTCATGTGTCCATGTGGTGG + Intergenic
1068981720 10:63069822-63069844 GCAGCCATGTGCCGAGGTGGTGG + Intergenic
1069325241 10:67225000-67225022 CCAAGTCTGTTTCCAGGTGGTGG - Intronic
1069682403 10:70294634-70294656 CCAGGCATCACTCCAGGTGCTGG + Intergenic
1069845287 10:71366814-71366836 CCATGCATGTCTCCACTTGGTGG + Intergenic
1070128318 10:73639525-73639547 ACAGGCATGTTTCCTGGGGGTGG - Intronic
1073508868 10:104029666-104029688 CTCGGCACGTGTCCAGCTGGAGG + Intergenic
1075551534 10:123396099-123396121 CCTGGCAGGCGTCCAGGTGAAGG + Intergenic
1075654080 10:124149895-124149917 CCAGGCCTGGGAGCAGGTGGTGG - Intergenic
1075660667 10:124193446-124193468 CCAAGTCTGTTTCCAGGTGGTGG + Intergenic
1075703575 10:124484621-124484643 CCAGGGAATTGTCAAGGTGGCGG + Intronic
1075795257 10:125115624-125115646 CCAGACATGTCTCCAGGCTGAGG + Intronic
1076433853 10:130426194-130426216 CCAGGCCTGTGCCCAGGACGGGG + Intergenic
1076647653 10:131964367-131964389 CCAGCCCTGGGTCCCGGTGGTGG - Intergenic
1076796696 10:132801812-132801834 CCAGGCAAGAGGCCAGGCGGTGG - Intergenic
1076858323 10:133128064-133128086 CCAGGCAGGGGGCCAGGTGCAGG - Intronic
1077089257 11:771048-771070 TCTGGCCTGTGACCAGGTGGCGG + Exonic
1077357139 11:2123585-2123607 CCAGGGATGGGGCCAGGTGCTGG + Intergenic
1077535497 11:3122171-3122193 CCAGGGATGGGTCCAGGGGCAGG + Intronic
1078581507 11:12542767-12542789 CCAGAGATGTGTGCATGTGGGGG - Intergenic
1078942565 11:16024129-16024151 CCAGGGATGTGTGCACATGGAGG + Intronic
1082710409 11:56547605-56547627 ACAGGCAGGTGTACAGGTCGTGG - Intergenic
1084620043 11:70263519-70263541 CCAGGCAGGGGACCAGCTGGGGG + Intergenic
1084795434 11:71501872-71501894 CTAGGCATGGGGCCAGGTGTGGG + Intronic
1084981052 11:72828995-72829017 CCAGGCAGGTGGCCAGGTGGAGG - Intronic
1085061933 11:73455130-73455152 CCAAGGCAGTGTCCAGGTGGGGG - Intronic
1087592348 11:100206825-100206847 CCAGGCATGATGCCAGGTGCTGG - Intronic
1087943468 11:104129457-104129479 CCAGTCATGTCTCCAGGAGCAGG + Intronic
1092527321 12:9317151-9317173 CCAGGGATGGGGCCGGGTGGGGG + Intergenic
1092539955 12:9414622-9414644 CCAGGGATGGGGCCGGGTGGGGG - Intergenic
1094513084 12:31107842-31107864 CCAGGGATGGGGCCGGGTGGGGG + Intergenic
1094527690 12:31243339-31243361 CCAGGCCTGAGCCCAGATGGAGG + Intergenic
1094713752 12:32990951-32990973 CCAGGCATGGGTTCAGGCGCTGG + Intergenic
1095048999 12:37540958-37540980 CCAGGCATGTGTCCGGTGGAAGG - Intergenic
1095986103 12:48000901-48000923 CCAGGCAGGGCTACAGGTGGAGG - Intronic
1096501019 12:52063920-52063942 CCAGGGATCTGTCCATGTTGGGG - Intergenic
1097351571 12:58554820-58554842 TCAGTCTTGTGTCCAGGTGAAGG - Intronic
1098120584 12:67232933-67232955 CCAGGCATTTTTCCATGTGAGGG - Intergenic
1098510885 12:71312885-71312907 CCAGGCATCTAGCCAGGAGGGGG - Intronic
1099303604 12:80927860-80927882 CCAGGCCTGTGGGGAGGTGGGGG - Intronic
1099393008 12:82103059-82103081 CCAAGTCTGTTTCCAGGTGGTGG - Intergenic
1099847611 12:88047976-88047998 CCTGGCATGTTTCCAGGTGCTGG + Intronic
1100291038 12:93215106-93215128 CCAAGTCTGTTTCCAGGTGGAGG + Intergenic
1100956677 12:99916479-99916501 CCAGGTACGTGACCAGTTGGTGG - Intronic
1102178603 12:110894665-110894687 CCAGGCATCTGCCCAGCTTGGGG - Intronic
1102350078 12:112185338-112185360 CCAGGCAGGGGTTCAGCTGGAGG + Exonic
1103167537 12:118783250-118783272 CCAATCATGTGCCCAGGAGGTGG + Intergenic
1104002153 12:124866644-124866666 CCAGGCATTTTTCCAGGTGCTGG - Intronic
1104916280 12:132266499-132266521 CCAGGCAGGAGGCCATGTGGAGG + Intronic
1104993935 12:132642528-132642550 ACAGGCAGGTGTCCAGGTTGAGG + Exonic
1107868999 13:44729879-44729901 GCAGGCAGGTGTGCAGGGGGTGG + Intergenic
1107996782 13:45869057-45869079 CAAAGAGTGTGTCCAGGTGGGGG + Intergenic
1108326487 13:49337454-49337476 GCAGCCATGTGGCCAGGGGGAGG - Intronic
1112061261 13:95741938-95741960 CCAGTGATGTGTACAGGTGCTGG + Intronic
1112498874 13:99926878-99926900 CCAGGCAGGTGTTCAGGGAGCGG + Intergenic
1114061779 14:19025183-19025205 CTGGTCATGTGTCCACGTGGCGG - Intergenic
1114100485 14:19374823-19374845 CTGGTCATGTGTCCACGTGGCGG + Intergenic
1114759572 14:25298184-25298206 CCAGGCCTCTGTCCAGGGTGAGG - Intergenic
1116629986 14:47318441-47318463 CAAGGAATGTGTCCATGAGGAGG - Intronic
1119981209 14:79083550-79083572 GCTGGCATGTGTGCAAGTGGGGG + Intronic
1121382480 14:93485341-93485363 CCAGTAAGGTGTCCAGGTGCAGG - Intronic
1121437799 14:93930401-93930423 CTGGGCCTGTGTGCAGGTGGAGG - Intergenic
1122055373 14:99094433-99094455 CCAGGCATGTGCCTAGGGGCCGG + Intergenic
1122093191 14:99353318-99353340 CCAGGGAGGTGTCAAGGAGGAGG + Intergenic
1122112289 14:99510732-99510754 CCCGGCATGCCTCCAGTTGGGGG + Exonic
1122825488 14:104368550-104368572 CCAGGCAGGTGCCCAGGCGGTGG - Intergenic
1122861700 14:104585379-104585401 CCAGGCATCTGTGCAGGTGCAGG - Intronic
1123187746 14:106536667-106536689 CCAGGAATTTGGCCAGGTGATGG - Intergenic
1124238770 15:28013119-28013141 TCTGGCCTGTGTCCAGGAGGAGG - Intronic
1124247063 15:28079887-28079909 CCAGGCAGGATTCCAGGTGGAGG - Intronic
1124432539 15:29619799-29619821 CCAGGCACGTGGCCAGGAGTGGG - Intergenic
1124621489 15:31276574-31276596 CTAAGCATATGTGCAGGTGGTGG + Intergenic
1126253991 15:46603290-46603312 CCAGGCATGTGTGCAGCTTAGGG + Intergenic
1126861182 15:52884537-52884559 CCAGGAAGGTGTGAAGGTGGAGG + Intergenic
1129410682 15:75348708-75348730 CCAGGCACCTGTCCGGGTAGGGG + Intronic
1129670240 15:77603890-77603912 CAAGGCATATGTTGAGGTGGAGG - Intergenic
1129913598 15:79248131-79248153 AGAGGCATGGGCCCAGGTGGGGG + Intergenic
1132149413 15:99448715-99448737 GCAGTCATGTGTCCAGGTGCAGG + Intergenic
1132160323 15:99535502-99535524 CCAGGCATGAGTGCAGGCAGGGG - Intergenic
1132672689 16:1108211-1108233 CCTGGCATGGGTCCTGGGGGAGG - Intergenic
1132941184 16:2509134-2509156 GCAGGCAGGTGGGCAGGTGGAGG - Intronic
1133339092 16:5025302-5025324 CCTGGCAGGTGGCCAGGTGAGGG + Exonic
1133395345 16:5442581-5442603 ACAGCCATGTTTCCAGGAGGAGG + Intergenic
1134107859 16:11496730-11496752 CTATGCATGTGTCCAGGTGTGGG + Intronic
1134308392 16:13054159-13054181 CCAGGCATGGTTCTAGGTGCAGG - Intronic
1134623612 16:15708365-15708387 CCAGGAATGTGCCCAGATAGTGG + Intronic
1134829943 16:17314889-17314911 TCAGGCAGGTGTGTAGGTGGCGG + Intronic
1135975155 16:27103848-27103870 CCTGGCATGTGACCAGAAGGAGG - Intergenic
1136075124 16:27811990-27812012 CCAAGCAGGTGTCCAGCTTGAGG - Intronic
1137458541 16:48637104-48637126 CCAGCCATGCTTCCAGGAGGTGG + Intergenic
1137529463 16:49268862-49268884 CCAAGCATGGAGCCAGGTGGGGG - Intergenic
1138576646 16:57911718-57911740 CCAGGCATGGCCCCAGGGGGAGG + Intronic
1139294166 16:65885624-65885646 CCTGGCTTCTGTGCAGGTGGTGG - Intergenic
1139680292 16:68556319-68556341 CCAGCCATGTGTCCATGGGATGG + Intronic
1139767497 16:69243236-69243258 CCAGCCACGTGTCCAGGTTAAGG + Intronic
1139992757 16:70953269-70953291 CCAGGCATTCTTCCAGGTGCTGG + Intronic
1141012300 16:80414206-80414228 GAAGGCATGTATACAGGTGGGGG - Intergenic
1141850123 16:86639532-86639554 TCAGGCTTGTCTCCATGTGGAGG - Intergenic
1142029924 16:87833379-87833401 CCAGGCATGTGTCCAGGTGGTGG - Intronic
1142416593 16:89946725-89946747 CCAGGCAGGGGCCCCGGTGGGGG + Intergenic
1144726517 17:17505129-17505151 CCCAGCATGTGTCCAGCTGCTGG + Intergenic
1144956238 17:19020236-19020258 CCAGGCCAGGGTCAAGGTGGAGG - Intronic
1145370015 17:22300249-22300271 CCAGGCATGTGCCCAACTGAAGG - Intergenic
1146320415 17:31842350-31842372 CCTGGCATGTGACCCGGTAGAGG + Intergenic
1146667188 17:34713019-34713041 CCAGCCCTGTGGCCAGGTGATGG - Intergenic
1147318274 17:39631503-39631525 CCAGGCAGGAGTTGAGGTGGGGG - Intronic
1147381069 17:40056600-40056622 CCAGGAATGGCTCCAGGTGGAGG - Intronic
1149164638 17:53736623-53736645 CCAGGCATGAGAGCAGGTGTGGG + Intergenic
1150225810 17:63523878-63523900 GCAGGGATGTGACCAGATGGGGG - Intronic
1151496648 17:74462041-74462063 CCAGGGATGTATAGAGGTGGTGG - Intergenic
1152095100 17:78268107-78268129 GCAGGGAGGTGCCCAGGTGGGGG + Intergenic
1152111276 17:78359035-78359057 GCAGGCTGGTGTCCAGGGGGCGG + Exonic
1152225212 17:79089811-79089833 CAAGGCAGGTGTCCAGGTGGCGG - Intronic
1152819369 17:82428708-82428730 CCAGGCTTGTGCCCAGGGGTGGG + Intronic
1154305896 18:13230646-13230668 CCATGCATGGCTGCAGGTGGGGG + Intronic
1156812922 18:41274153-41274175 CCAGGCATGTGACCAGGGGAAGG + Intergenic
1157326982 18:46676373-46676395 CCAGGCATGGTGCCAGGTGCCGG - Intronic
1160150231 18:76392648-76392670 GAAGGCAGGTGACCAGGTGGGGG + Intronic
1160150243 18:76392683-76392705 GAAGGCAGGTGACCAGGTGGGGG + Intronic
1160150255 18:76392718-76392740 GAAGGCAGGTGACCAGGTGGGGG + Intronic
1160150267 18:76392753-76392775 GAAGGCAGGTGACCAGGTGGGGG + Intronic
1160150280 18:76392788-76392810 GAAGGCAGGTGGCCAGGTGGGGG + Intronic
1161425320 19:4199766-4199788 CCAGGCAAGTGCCCAGGGGCAGG + Exonic
1161857139 19:6772543-6772565 CCAGGCCTGTGTCGAGTGGGCGG + Intergenic
1162498204 19:11035200-11035222 CCAGGCCTGAGTCCTGGCGGTGG - Intronic
1163615722 19:18326974-18326996 CAAGGCATGTGGCCAGGGGATGG - Intergenic
1163639167 19:18451702-18451724 CCAGGCCTGTATCCACATGGGGG + Intronic
1163700088 19:18782566-18782588 CCAGGCCTGTGACCATGAGGTGG + Intergenic
1163892866 19:20032253-20032275 TCAGGCATTTGTACAGGAGGAGG + Intronic
1165062507 19:33211715-33211737 ACCAGCCTGTGTCCAGGTGGGGG - Intronic
1165838121 19:38771577-38771599 CCAGCCAAGTGTCCAAGGGGTGG - Intronic
1165841444 19:38791120-38791142 CCAGCCAAGTGTCCAAGGGGTGG + Intronic
1167037991 19:47005472-47005494 GCAGGCTTGTGGCCAGGAGGTGG + Intergenic
1167358235 19:49016839-49016861 AAAGGCAGGTGTCCGGGTGGTGG - Intronic
1167359734 19:49023728-49023750 AAAGGCAGGTGTCCGGGTGGTGG - Intronic
1167361399 19:49032357-49032379 AAAGGCAGGTGTCCGGGTGGTGG + Intronic
1167362254 19:49036428-49036450 AAAGGCAGGTGTCCGGGTGGTGG - Intronic
1167363827 19:49044430-49044452 AAAGGCAGGTGTCCGGGTGGTGG + Intronic
1167364671 19:49048497-49048519 AAAGGCAGGTGTCCGGGTGGTGG - Intronic
1167365960 19:49055133-49055155 AAAGGCAGGTGTCCGGGTGGTGG - Intronic
1168113903 19:54210105-54210127 CCAGGCATGCTGCCAGGAGGAGG + Intronic
925473124 2:4184185-4184207 CCAGGCAGCTGGCCAGGTGTGGG - Intergenic
926088616 2:10035883-10035905 CCAGGAAGGTGTCCAGGGAGGGG + Intergenic
926152946 2:10434783-10434805 CCAGCCCTGTGTACAGCTGGTGG - Intergenic
927024196 2:19048966-19048988 CCAGGTAGGTGTAGAGGTGGAGG - Intergenic
927331697 2:21872234-21872256 CCAGGCCTATTTCAAGGTGGAGG - Intergenic
927966398 2:27272404-27272426 CCAGGCATGACTCTAGGTGCTGG + Intronic
929266929 2:39928844-39928866 CCCTGTATGTGTCCAGATGGAGG + Intergenic
931992979 2:67809590-67809612 CCCGGTCTGTTTCCAGGTGGAGG - Intergenic
935946413 2:108290250-108290272 CCAGGGATGTGTGCACATGGAGG - Intronic
937097561 2:119245616-119245638 CCAGGCGTGTGGCCAGGGAGCGG - Exonic
937340774 2:121089120-121089142 CCAGGCTTCTGTCAAGGGGGTGG - Intergenic
938038119 2:128053390-128053412 CCAAGCCTGTTTCCATGTGGAGG + Intergenic
938135147 2:128750657-128750679 CCAGGCATGTGCACAGGCAGAGG - Intergenic
941289408 2:163656899-163656921 CCTGGCATGTTTCCAGCTGTTGG + Intronic
945347088 2:208731564-208731586 ACACACATGTGTCCTGGTGGTGG + Intronic
946321729 2:218958720-218958742 CCAGCCCTGGGTCCAGGTTGAGG - Intergenic
946408505 2:219505238-219505260 CCAGGCTTGTGGCCAGGGGCAGG + Exonic
946427916 2:219609198-219609220 CCACGCAGCTGTCCAGGTGATGG + Exonic
948425205 2:237882976-237882998 CCAGGCAGGTGACCTGATGGGGG + Intronic
948572814 2:238928000-238928022 GGAGGCATGTGTCCAGCTAGCGG - Intergenic
948645641 2:239401877-239401899 CCAGGCAGGCGTGGAGGTGGCGG + Exonic
948733497 2:239982585-239982607 ACAGGAATGTGTGCAGGTGGAGG - Intronic
949041132 2:241850426-241850448 CTGGGCATGTGTAAAGGTGGAGG + Exonic
1168972055 20:1937765-1937787 CCAGGTATGTGGCAATGTGGGGG - Exonic
1170211150 20:13847302-13847324 CCAGGAACGAATCCAGGTGGTGG - Intergenic
1170400636 20:15979401-15979423 ACAGGCCTGTGTCAATGTGGTGG + Intronic
1170590187 20:17765735-17765757 ACAGGCATGTGTACCCGTGGAGG - Intergenic
1170632842 20:18080082-18080104 CCAGGCATGATTGCAGGTGCCGG + Intergenic
1170873612 20:20231348-20231370 CCATGCATGTCTCCCGGTGCTGG - Intronic
1171316966 20:24203601-24203623 CCAGGCATGTCTTCAAGTAGAGG - Intergenic
1171543540 20:25984460-25984482 CCAGGCATGTGTCCGGTGGAAGG - Intergenic
1171543922 20:25986663-25986685 CCAGGCATGTGCCCGGCTGAAGG - Intergenic
1171996268 20:31734112-31734134 ACAGGCTTGGGTCAAGGTGGGGG - Intergenic
1173276228 20:41586100-41586122 CCAGGCATTTGAGCAGGTAGTGG + Intronic
1174285416 20:49469283-49469305 ACAGGCATGTGGGCATGTGGGGG - Intronic
1174698169 20:52581209-52581231 CAAGGCAGGTGTCCAGATGCTGG + Intergenic
1175656457 20:60775443-60775465 CCAGACCTGTGTCCAGTTTGGGG + Intergenic
1175816756 20:61887072-61887094 CCAGGCATGTGCTCATGAGGCGG - Intronic
1175993361 20:62801006-62801028 CCAGGGATGTTCCCAGGTGGTGG - Exonic
1178487944 21:33030644-33030666 CCAGGCAGGTGTACTGGTGCAGG + Intergenic
1178729213 21:35083691-35083713 CCAGTCATGGGTCAAGGTGAAGG - Intronic
1178936310 21:36865193-36865215 TCAGGCAAGAGTCCACGTGGAGG + Intronic
1179248029 21:39650065-39650087 GCAGGCAGGGGTCCAGGTGCTGG - Intronic
1180480266 22:15747796-15747818 CTGGTCATGTGTCCACGTGGCGG - Intergenic
1182124096 22:27804019-27804041 CCAGGCCTTTGCCCATGTGGGGG - Intergenic
1182257480 22:29049444-29049466 CCAGGCTGTGGTCCAGGTGGAGG - Exonic
1182844640 22:33420245-33420267 CCAGGCATGATTCCAGGTATGGG + Intronic
1183048488 22:35241290-35241312 CCAAATATGTTTCCAGGTGGAGG + Intergenic
1183161728 22:36118146-36118168 CCAGGCATGGGTCTAGGTGCCGG - Intergenic
1183294742 22:37022865-37022887 CCAGCCATGTGCCCTGGTGGGGG + Intronic
1184922005 22:47612576-47612598 CCAGGCACCAGTCCAGGTGCTGG + Intergenic
1185142311 22:49109293-49109315 CCAGGCAGGTGGCAAGTTGGGGG + Intergenic
950254424 3:11492861-11492883 CCACGGCAGTGTCCAGGTGGGGG + Intronic
950265996 3:11573422-11573444 TCAGACATGTGTCCTGGTGCTGG + Intronic
950475712 3:13213845-13213867 CCAGGCAGGTGGGCAGGTGATGG - Intergenic
951269571 3:20608137-20608159 CCAAGTCTGTTTCCAGGTGGAGG - Intergenic
951363786 3:21755823-21755845 CCAGGCATTACTCCAGGTGCTGG + Intronic
953260239 3:41331200-41331222 CCAAGCAGATGTCCAGCTGGGGG + Intronic
954199821 3:49017613-49017635 CCAGACAGTTGTCCAGGTTGGGG + Exonic
954852700 3:53617033-53617055 CCAGGCAGGTGTGCTGGGGGAGG - Intronic
958555643 3:95673113-95673135 CCAGCTATATGTCCAGGAGGAGG - Intergenic
960369623 3:116817779-116817801 CCAGGCATGAGGCCAGGTGCAGG + Intronic
961213015 3:125140391-125140413 CCAGGCCTCTCTCCAGGAGGTGG + Intronic
961468536 3:127096788-127096810 CCAGGGCTGTGTCCTGGGGGTGG - Intergenic
961479712 3:127171952-127171974 CAAGCCGTGTGTCCATGTGGAGG + Intergenic
963877155 3:150489298-150489320 CCAGGCATGTGTGTGGGAGGGGG - Intergenic
963939693 3:151086311-151086333 CCCGGTCCGTGTCCAGGTGGCGG + Intronic
963983413 3:151565513-151565535 CCAGGCCTGCCTCCAGGTTGAGG + Intergenic
964643783 3:158936759-158936781 CCAAGTCTGTTTCCAGGTGGAGG - Intergenic
965381927 3:168000591-168000613 CCAGGAATATTTCCAGGTGTGGG + Intergenic
965792680 3:172406427-172406449 CCAGGGATGGGTCCAGGTGCAGG - Intergenic
966020466 3:175202995-175203017 CCAAGTCTGTTTCCAGGTGGTGG + Intronic
967399901 3:189049268-189049290 CCAAGCCTGTTTCCAGGTGGAGG - Intronic
968964411 4:3762508-3762530 GCAGGCATGTGTGCATGTGTGGG + Intergenic
969109378 4:4832689-4832711 ACAGGTATATGTACAGGTGGTGG - Intergenic
969516840 4:7652696-7652718 CCAGGCCTGGGCCCAGCTGGGGG - Intronic
969683001 4:8653519-8653541 CCAGGCAGGTGCCCAGGCTGGGG + Intergenic
970970565 4:21978830-21978852 CCTGGTATGTGTCCAAGTAGTGG + Intergenic
971251479 4:24976345-24976367 CCAGGCCTGTGTCAGGGTGAAGG + Intronic
972776696 4:42247856-42247878 CCAGGCATAGGGCTAGGTGGAGG - Intergenic
973637280 4:52871696-52871718 CCAGGCCGGTGGTCAGGTGGTGG - Intergenic
973786087 4:54333936-54333958 TCAGGCATGAGTGCTGGTGGAGG + Intergenic
974942820 4:68489476-68489498 ACAGGCATGCGTGCTGGTGGTGG + Intronic
976046006 4:80948739-80948761 CAAGGCATTTTTCCAGGTGATGG - Intronic
981213499 4:142136204-142136226 CCAGGCATGTTGGTAGGTGGGGG + Intronic
981257770 4:142683405-142683427 CCAGACAGGTTTCCATGTGGAGG + Intronic
982417426 4:155152285-155152307 TCAAGCATGAGACCAGGTGGAGG - Intergenic
984573131 4:181417138-181417160 CCTGGCATGACTCCAGGTTGTGG + Intergenic
984919498 4:184751172-184751194 CGAGGCATGTGTTTAGGAGGAGG - Intergenic
985563558 5:603935-603957 CCTGGCATCTGCCGAGGTGGCGG - Intergenic
985630988 5:1013908-1013930 CCAGGCAGGTGTCTGGATGGAGG + Intronic
986092070 5:4519438-4519460 CCAGTCAGGGCTCCAGGTGGAGG - Intergenic
986292371 5:6410468-6410490 CCAGGCATGGGGCAATGTGGAGG + Intergenic
986658634 5:10039397-10039419 CCAGGCATGAGGGCAGGAGGAGG + Intergenic
986746283 5:10747865-10747887 CCAGGCACCTGGGCAGGTGGAGG + Intronic
987787616 5:22522826-22522848 CCATGCATGTTTGTAGGTGGAGG - Intronic
988396596 5:30704158-30704180 CCAAGGATGGGACCAGGTGGAGG - Intergenic
988822712 5:34903386-34903408 CTAGGCATGTGTGCAGGTAGGGG - Intergenic
991037745 5:62144842-62144864 CCAGGGATGTGTGCAGCTGAGGG + Intergenic
991932099 5:71763525-71763547 CCAGGCAGCTGTCTTGGTGGTGG + Intergenic
995709018 5:115015920-115015942 TCAAGCATGGGACCAGGTGGAGG + Intergenic
995817768 5:116191418-116191440 CCAAGTCTGTTTCCAGGTGGTGG - Intronic
995835614 5:116396912-116396934 CCAGGCCTCTGGCCAGGTGCTGG - Intronic
997420681 5:133764391-133764413 CCAGGCATGATTCCAGGAGTGGG + Intergenic
1001298186 5:170514048-170514070 GCAGGCAGGAGCCCAGGTGGTGG - Intronic
1002440527 5:179262188-179262210 CCGGGCAGGTGTGCTGGTGGGGG - Intronic
1002440537 5:179262214-179262236 CCGGGCAGGTGTGCTGGTGGGGG - Intronic
1002637682 5:180616225-180616247 CCAGCCATGTGCCCAGCTGCTGG - Intronic
1003037994 6:2661804-2661826 CCAGGGAGGTGCCCAGGGGGTGG + Intergenic
1003192813 6:3889236-3889258 CCAGGTAGGTGATCAGGTGGAGG + Intergenic
1003234204 6:4281607-4281629 CCAGGCATGTGGGCAGGGGAGGG - Intergenic
1005642197 6:27807129-27807151 CCAGGCCAGGCTCCAGGTGGTGG - Intergenic
1007743171 6:44025101-44025123 CCAGGCCTGAGGCCTGGTGGAGG - Intergenic
1007892619 6:45310057-45310079 CCAAGTCTGTTTCCAGGTGGAGG - Intronic
1008733510 6:54513343-54513365 CCAGGCATTATTCAAGGTGGTGG + Intergenic
1011168592 6:84479286-84479308 CCAAGTCTGTTTCCAGGTGGTGG - Intergenic
1011233284 6:85187750-85187772 CCAAGTCTGTTTCCAGGTGGAGG - Intergenic
1011873732 6:91929545-91929567 GCAGGCATGTGTGTAGGGGGAGG + Intergenic
1013757649 6:113480348-113480370 CCTGGCAGGTTTCCAGTTGGAGG + Intergenic
1014603858 6:123448360-123448382 CCAAGTCTGTTTCCAGGTGGAGG - Intronic
1016896962 6:149062988-149063010 CCTGGCATGAGGCCAGGAGGGGG - Intronic
1017456330 6:154604465-154604487 GGAGGCAGGCGTCCAGGTGGTGG - Intergenic
1018114986 6:160574268-160574290 CCAAGTCTGTTTCCAGGTGGGGG + Intronic
1019550321 7:1599172-1599194 CCTGGCAGGTGTGCAGGGGGTGG + Intergenic
1019565128 7:1675295-1675317 CTGGACATGTGGCCAGGTGGCGG + Intergenic
1019893569 7:3965904-3965926 CTCGGCATGTGTGCAGGTGAAGG + Intronic
1022384784 7:29890764-29890786 CCTGCCCTGTGTTCAGGTGGAGG + Intronic
1022572027 7:31463860-31463882 CCAGTCCTGTGTACAGATGGTGG + Intergenic
1023830395 7:44035866-44035888 CCAGGCATGATTCTAGGTGAGGG - Intergenic
1024991042 7:55234639-55234661 CCAGGCAGGGCTCCAGGCGGAGG + Intronic
1026238232 7:68548130-68548152 GAAGGCATGTGTCCTGGTGAGGG - Intergenic
1026794202 7:73355495-73355517 CCAGGCATGAATGCAGATGGGGG - Intronic
1027226168 7:76244908-76244930 GCAGGCATGGGGCCAGGTGCTGG + Intronic
1027229174 7:76262152-76262174 AAAGGCAGGAGTCCAGGTGGAGG + Intronic
1027295335 7:76764019-76764041 CCAAGTCTGTTTCCAGGTGGAGG - Intergenic
1028558072 7:92143700-92143722 GCAGGCATGTGTGCAGGGAGAGG - Intronic
1029108170 7:98195218-98195240 CCAGGCTTGTACCCAAGTGGTGG - Intronic
1029515949 7:101023083-101023105 CCAGGCCTGTTTCCTGGTTGCGG + Intronic
1029740719 7:102490160-102490182 CCAGGCATGATTCTAGGTGAGGG - Intronic
1029758713 7:102589333-102589355 CCAGGCATGATTCTAGGTGAGGG - Intronic
1032965522 7:137093142-137093164 CCAGGAATGAGTCCTGGTGCAGG - Intergenic
1033735676 7:144219071-144219093 TCAGGTATGTGTGGAGGTGGCGG + Intergenic
1033747376 7:144331882-144331904 TCAGGTATGTGTGGAGGTGGCGG - Intergenic
1035037211 7:155903121-155903143 CCAGGCACGGTTCCAGGTAGGGG + Intergenic
1035108230 7:156459640-156459662 GCAGGCATGAGTCCAGGCGCCGG + Intergenic
1035453538 7:158995051-158995073 ACAGGCATGACTTCAGGTGGAGG + Intergenic
1036002104 8:4617880-4617902 CCAGGCATTGGTCCAGGTTCTGG - Intronic
1036793931 8:11742115-11742137 CCAGGCAGGTGTGGAGGTGCTGG + Intronic
1037845068 8:22275590-22275612 CCAAGAAGGTGTCCAGGTTGGGG + Intronic
1038687372 8:29730651-29730673 CCAGCCATGTTTCCAGGGGTAGG + Intergenic
1044186106 8:89253951-89253973 CCAGGAATGTAACCAGGTGGAGG + Intergenic
1044907213 8:97017533-97017555 CCAAGTCTGTTTCCAGGTGGTGG - Intronic
1049214101 8:141399740-141399762 CCAGGCCTGTGACCTGGGGGAGG + Intronic
1049311637 8:141936727-141936749 ACAGCCAAGTGTCCAGGTGGTGG - Intergenic
1049442211 8:142614654-142614676 CCCGCCATGTGTGCAGGGGGTGG - Intergenic
1049497237 8:142941926-142941948 TGAGGCATCTGTCCAGGTGATGG - Intergenic
1049562464 8:143318560-143318582 GCAGGCATGGGTGCAGGTGCAGG - Intronic
1049604257 8:143521714-143521736 CCAGGCAGGTGCACTGGTGGGGG - Intronic
1049657692 8:143805984-143806006 ACAGCTAGGTGTCCAGGTGGAGG + Intronic
1049686956 8:143942839-143942861 CAGGGCATGGGGCCAGGTGGTGG + Intronic
1050125635 9:2353915-2353937 ACAGGCAGGTGTGCTGGTGGCGG + Intergenic
1056721797 9:89078527-89078549 GCAGGCATGGGTCCCGGTGGAGG + Intronic
1057138355 9:92710982-92711004 GCAGGCATCTTTCCAGGGGGGGG + Intergenic
1057207450 9:93182206-93182228 CCACGCATGTGTACAAGTGTGGG + Intergenic
1061003276 9:127914739-127914761 CCAGGCAGGTGGCCAGGCAGAGG + Exonic
1062158957 9:135069346-135069368 CCAGGCAGGAGTCTGGGTGGTGG + Intergenic
1062674123 9:137730110-137730132 CCAGGATTGTGTGCAGGTCGTGG + Intronic
1185492848 X:532047-532069 CCAGGCACTTGTACAAGTGGGGG - Intergenic
1186119377 X:6342880-6342902 CCAGGAATGTGTCCTGGTTGTGG - Intergenic
1187745109 X:22401154-22401176 CCTGGGATGTGTCCGGGTCGTGG - Intergenic
1189823073 X:44889155-44889177 CCAGGCATGTGTCCAGCACCTGG - Intronic
1190247504 X:48700246-48700268 CCAAGCTTGGGTCCAGGTGCCGG - Exonic
1190580727 X:51891581-51891603 CCAGGCATGGTTCTAGGTGCTGG + Intronic
1191137547 X:57082422-57082444 CCAGGAATGAGTCCTGGTGGTGG - Intergenic
1192340986 X:70263210-70263232 CCAGGCAGGTGTGCCGGTTGGGG - Intergenic
1193826342 X:86231608-86231630 CCAAGTCTGTTTCCAGGTGGAGG + Intronic
1194673735 X:96768444-96768466 CCAGGCATTATTCCAGGTGCTGG + Intronic
1195795415 X:108642012-108642034 CCAAGTCTGTTTCCAGGTGGTGG - Intronic
1201365729 Y:13204584-13204606 CTAGGTAGGTGTCCAGGAGGAGG - Intergenic