ID: 1142029927

View in Genome Browser
Species Human (GRCh38)
Location 16:87833385-87833407
Sequence AACAGTCCAGGCATGTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 153}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142029927_1142029938 16 Left 1142029927 16:87833385-87833407 CCTGGACACATGCCTGGACTGTT 0: 1
1: 0
2: 1
3: 14
4: 153
Right 1142029938 16:87833424-87833446 GGAGGGGCCAATCTGCTAACGGG 0: 1
1: 0
2: 0
3: 5
4: 85
1142029927_1142029930 -10 Left 1142029927 16:87833385-87833407 CCTGGACACATGCCTGGACTGTT 0: 1
1: 0
2: 1
3: 14
4: 153
Right 1142029930 16:87833398-87833420 CTGGACTGTTCACAGCAGGCAGG 0: 1
1: 0
2: 1
3: 12
4: 263
1142029927_1142029931 -9 Left 1142029927 16:87833385-87833407 CCTGGACACATGCCTGGACTGTT 0: 1
1: 0
2: 1
3: 14
4: 153
Right 1142029931 16:87833399-87833421 TGGACTGTTCACAGCAGGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 205
1142029927_1142029937 15 Left 1142029927 16:87833385-87833407 CCTGGACACATGCCTGGACTGTT 0: 1
1: 0
2: 1
3: 14
4: 153
Right 1142029937 16:87833423-87833445 CGGAGGGGCCAATCTGCTAACGG 0: 1
1: 0
2: 0
3: 7
4: 47
1142029927_1142029940 23 Left 1142029927 16:87833385-87833407 CCTGGACACATGCCTGGACTGTT 0: 1
1: 0
2: 1
3: 14
4: 153
Right 1142029940 16:87833431-87833453 CCAATCTGCTAACGGGTCCTCGG No data
1142029927_1142029934 -1 Left 1142029927 16:87833385-87833407 CCTGGACACATGCCTGGACTGTT 0: 1
1: 0
2: 1
3: 14
4: 153
Right 1142029934 16:87833407-87833429 TCACAGCAGGCAGGGCCGGAGGG 0: 1
1: 0
2: 0
3: 22
4: 305
1142029927_1142029933 -2 Left 1142029927 16:87833385-87833407 CCTGGACACATGCCTGGACTGTT 0: 1
1: 0
2: 1
3: 14
4: 153
Right 1142029933 16:87833406-87833428 TTCACAGCAGGCAGGGCCGGAGG 0: 1
1: 0
2: 1
3: 20
4: 262
1142029927_1142029935 0 Left 1142029927 16:87833385-87833407 CCTGGACACATGCCTGGACTGTT 0: 1
1: 0
2: 1
3: 14
4: 153
Right 1142029935 16:87833408-87833430 CACAGCAGGCAGGGCCGGAGGGG No data
1142029927_1142029932 -5 Left 1142029927 16:87833385-87833407 CCTGGACACATGCCTGGACTGTT 0: 1
1: 0
2: 1
3: 14
4: 153
Right 1142029932 16:87833403-87833425 CTGTTCACAGCAGGCAGGGCCGG 0: 1
1: 0
2: 1
3: 42
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142029927 Original CRISPR AACAGTCCAGGCATGTGTCC AGG (reversed) Intronic
901713219 1:11132040-11132062 AACAGTCCTGGCATGCATACAGG + Intronic
901845230 1:11977947-11977969 AGCAGTCCAGGCAAGTGACCAGG + Intergenic
902530250 1:17086248-17086270 CACACTCCACGCCTGTGTCCTGG - Intronic
902616871 1:17628580-17628602 AACAGTCCTGCAATGTGCCCAGG - Intronic
907929483 1:58986058-58986080 AACAGTCCAGGCAGAGATCCTGG - Intergenic
910234858 1:85024895-85024917 CACAGCCCAGGCATGTGCCTAGG - Intronic
910662470 1:89688568-89688590 AGCAGGCCAGGCAGATGTCCTGG + Intronic
919768480 1:201142215-201142237 AGCAGTCCAGGCATGTGCGCAGG + Intronic
922248538 1:223824850-223824872 AACACACCAGGCATGTTCCCAGG + Intronic
923858750 1:237871956-237871978 AACTGTCTTGGCATGTGTCTAGG + Intergenic
1062864442 10:839335-839357 AAGAGGCCATGCATGTGTACAGG + Intronic
1066226188 10:33385973-33385995 AGCATTCCAGGCAGGTGTGCAGG - Intergenic
1069008817 10:63348249-63348271 AAAAGTCCTGGCATTTGACCAGG + Intronic
1069894610 10:71672714-71672736 GACAGTCCAGTCCTGTCTCCTGG + Intronic
1070128322 10:73639531-73639553 AACTGCACAGGCATGTTTCCTGG - Intronic
1073132035 10:101195912-101195934 ACCAGCCCAGGCATTTGGCCTGG - Intergenic
1074542919 10:114380242-114380264 AACAGTCCAGGGAAGTGTGGTGG - Intronic
1077210923 11:1370607-1370629 AGCAGTCCCTGCATGTGTCGGGG + Intergenic
1078580938 11:12539206-12539228 CACAGTTCAGGCAGGTGTACAGG + Intergenic
1079000377 11:16749483-16749505 AACAGGCCAGGGATGGGTACCGG - Intronic
1081407577 11:42715733-42715755 TACAGTCATGTCATGTGTCCTGG + Intergenic
1081563768 11:44243309-44243331 AGCAGGTCAGGCATGTGTTCGGG - Intronic
1085029212 11:73259478-73259500 AGTAGTCCAGGCAGGTGGCCAGG - Intergenic
1086450993 11:86916716-86916738 AACAGACCAGGAATGTGTAGGGG + Intronic
1086520202 11:87660478-87660500 ACCAGGGAAGGCATGTGTCCTGG - Intergenic
1086816820 11:91382060-91382082 AAAGGTCCAGGAATGAGTCCTGG - Intergenic
1086921206 11:92589176-92589198 AAAAGTCAAGCCATGTGCCCTGG - Intronic
1087371111 11:97285322-97285344 AACACTAAAGGCATGTGCCCAGG - Intergenic
1087425853 11:97984756-97984778 AAGAATCCAGGCATGTGTACTGG + Intergenic
1091668352 12:2435365-2435387 CACAGTCCAGGCAAGTGGGCAGG - Intronic
1091899345 12:4132671-4132693 AACAGTCCAGGGATGAGGCTGGG - Intergenic
1094281921 12:28749646-28749668 AGCTGTCCAGGCATGAGTGCAGG - Intergenic
1095814492 12:46406615-46406637 AAAAATCCATTCATGTGTCCAGG + Intergenic
1096858969 12:54509284-54509306 AACAGGTAAGGCATGTGTCTAGG - Intronic
1101079962 12:101172298-101172320 AACATTCCTGCCCTGTGTCCAGG - Intronic
1102577659 12:113866591-113866613 ACCAGTCCAGGTATCAGTCCAGG - Intronic
1102715651 12:114969797-114969819 AACAGTCCAGAGTTATGTCCTGG - Intergenic
1104633570 12:130424501-130424523 CACAGTCCAGGCCGCTGTCCGGG + Intronic
1105504115 13:20995476-20995498 GACAGTTCAGGTATGTGTTCTGG + Intronic
1106750742 13:32763943-32763965 AAAGGTCCAGGCCTCTGTCCTGG - Intronic
1108345920 13:49546873-49546895 ACCAGTACAGGCATATGGCCTGG + Intronic
1108941455 13:55961036-55961058 ACCACTCCAGACATGGGTCCTGG - Intergenic
1111453844 13:88453852-88453874 TTCAGTCCATTCATGTGTCCTGG - Intergenic
1113004929 13:105690072-105690094 CACACTCCAGGCATTTTTCCAGG + Intergenic
1114499653 14:23158854-23158876 AGCAGGCTAGGCATTTGTCCAGG - Intronic
1116551903 14:46251192-46251214 AACAGTCCTGGAATCTCTCCAGG + Intergenic
1118692392 14:68352624-68352646 AAGAGTCCAGGCCTATGCCCAGG - Intronic
1119327744 14:73771437-73771459 ACCAGCCCAGGAATGTGACCAGG - Intronic
1123009426 14:105340630-105340652 AACAGGCCAGGAACCTGTCCTGG + Intronic
1125184585 15:36915730-36915752 AACAGTCCATGAATCTGACCTGG + Intronic
1125472879 15:40021688-40021710 CAAAGGGCAGGCATGTGTCCTGG - Intronic
1127261982 15:57333098-57333120 CACAGTCCAGGTATGTGTGGGGG - Intergenic
1129124447 15:73426501-73426523 CACAGTCCTGCCATGTGACCAGG + Intergenic
1129195594 15:73964238-73964260 AACTGTCCATGCATGTGCACTGG - Intergenic
1131514506 15:93068041-93068063 TACAGGCTAGGCATGAGTCCAGG + Intronic
1134353081 16:13456198-13456220 GAAAGTCCCGTCATGTGTCCCGG - Intergenic
1135259694 16:20970165-20970187 AAAAGGCCATGCATGTGTTCCGG - Intronic
1136288503 16:29258069-29258091 AGAGTTCCAGGCATGTGTCCTGG - Intergenic
1136475455 16:30510401-30510423 AAGAGTCCAGGCTTCTGTCCAGG + Exonic
1137562249 16:49510399-49510421 AAGGGTTCAGGCCTGTGTCCTGG - Intronic
1138211207 16:55164682-55164704 CACAGTCCAGCCAGGTGTGCTGG + Intergenic
1142029927 16:87833385-87833407 AACAGTCCAGGCATGTGTCCAGG - Intronic
1143972356 17:10804761-10804783 AAAAGTCAAGGGATGTTTCCGGG + Intergenic
1145194270 17:20874311-20874333 AACAGTCCAGATATGAGTCCAGG + Intronic
1145297769 17:21606795-21606817 AACAGTCCAGATATGAGTCTAGG - Intergenic
1145404640 17:22576056-22576078 AACAGTCCAGATATGAGTCTAGG + Intergenic
1146292680 17:31621862-31621884 AAAAGGCCATGCATGTGCCCAGG - Intergenic
1147851189 17:43444395-43444417 ACCAGTCCAGACATGTGTCTGGG + Intergenic
1150515524 17:65806182-65806204 AACATGCCAGGCATGTGCCCAGG + Intronic
1151964404 17:77423858-77423880 GAAAGTCCAGGCATGTGCTCTGG + Intronic
1153543308 18:6180372-6180394 AGCACTTCAGGCATGTGGCCTGG - Intronic
1156322732 18:36042667-36042689 AACAGTCAAGACATGTGCACAGG + Intronic
1160387626 18:78506060-78506082 AACAGTCCATGCGTGTTTCTTGG + Intergenic
1161723173 19:5914755-5914777 CACAGTCAAGGCGTGTGCCCTGG + Intronic
1163615725 19:18326980-18327002 GAAAGTCAAGGCATGTGGCCAGG - Intergenic
1168650570 19:58089709-58089731 AGGAGCCCAGGCATCTGTCCTGG + Intronic
925729836 2:6911330-6911352 CACAATCCAGGTCTGTGTCCTGG - Intergenic
927017255 2:18977597-18977619 AACACTCCAGCCTTGTGCCCAGG - Intergenic
930186036 2:48413075-48413097 TACAGTCCAGGCATGGGGCAAGG - Intergenic
931777613 2:65553852-65553874 AACAGTCCGGGCAGGCCTCCAGG + Intergenic
932073195 2:68641745-68641767 ACCAGGCCTGGCATGGGTCCTGG - Intergenic
932222457 2:70010266-70010288 AAGAGTCCAGGTGTGTGTACAGG + Intergenic
933223124 2:79714184-79714206 GACAGTCCATGCAACTGTCCGGG + Intronic
933625002 2:84588155-84588177 AAAAGCCAAGGGATGTGTCCAGG - Intronic
933944740 2:87276228-87276250 AACAGTCCAGCCAGGGGTCTAGG + Intergenic
935346651 2:102114433-102114455 AACAGTGAAGGAATGTGTACTGG + Intronic
936089078 2:109489352-109489374 AACAATCCAGGCATGTGGCCTGG + Intronic
936335471 2:111585351-111585373 AACAGTCCAGCCAGGGGTCTAGG - Intergenic
937066329 2:119020626-119020648 AACCCTCCAGGCATGTATCCTGG - Intergenic
940169016 2:150806631-150806653 AAAAGTCAAGGCATGTGCCTGGG - Intergenic
941733670 2:168948270-168948292 AAGAATCCAAGCCTGTGTCCTGG - Intronic
942689174 2:178567124-178567146 AACAGTCCAGGCAAGTCGACTGG + Exonic
943059037 2:183018490-183018512 CACAGTGCATGCATGTGTCAAGG + Intronic
946883546 2:224200505-224200527 AAGAGTCTAAGCATGGGTCCCGG - Intergenic
948271506 2:236677399-236677421 AACAGTCCTGGCCTGGGTCTTGG + Intergenic
1170455259 20:16526918-16526940 AAAAGTCTAGGCATCTGTTCTGG + Intronic
1171562813 20:26141899-26141921 AACAGTCCAGATATGAGTCTAGG + Intergenic
1173384111 20:42572493-42572515 AGCATTCCAGGCATGTGCCAGGG - Intronic
1173823197 20:46031580-46031602 AAGAGCCCAGGGATGTGTCCCGG + Intronic
1176132462 20:63502078-63502100 AACAGCTCAGGGATGGGTCCTGG - Intergenic
1176260444 20:64176734-64176756 AGCAGTTCAGCCATGTGACCAGG - Intronic
1177702632 21:24658162-24658184 ACCAGTCCAGTCATGAGTCCTGG - Intergenic
1179960887 21:44766525-44766547 CACAGTCCAGGCATGGGAACGGG + Intergenic
1180951481 22:19722530-19722552 AACAGTCCGGTCTGGTGTCCAGG - Exonic
1182844637 22:33420239-33420261 TACAGGCCAGGCATGATTCCAGG + Intronic
954852705 3:53617039-53617061 AACATTCCAGGCAGGTGTGCTGG - Intronic
955522717 3:59790933-59790955 AATAGTACAGGAATGTGACCTGG - Intronic
956853671 3:73255416-73255438 AACAGCCCCTGCATGTCTCCCGG + Intergenic
957007195 3:74963450-74963472 AACAGTTAAGACATGTGCCCTGG + Intergenic
959664153 3:108902962-108902984 AACAGTCAAGGAGTGTTTCCTGG - Intergenic
960517380 3:118617251-118617273 AGGAGTCCAGGCATGTGGCATGG + Intergenic
961198165 3:125021287-125021309 GAGAGTGCAGGCATGTGTCCTGG - Intronic
961637765 3:128343784-128343806 CATAGGCCAGGCATGTCTCCTGG - Intronic
963273289 3:143306330-143306352 CACAGTACAGGCATCTGCCCTGG - Intronic
964763475 3:160156427-160156449 AACTGCCCAGGCAGGAGTCCTGG + Intergenic
968579723 4:1384223-1384245 ACCAGCCAAGGCCTGTGTCCTGG - Intronic
969134813 4:5021065-5021087 CTCAGTCCAGCCCTGTGTCCAGG - Intergenic
969512987 4:7630180-7630202 AGCAGTCCTGGGCTGTGTCCAGG - Intronic
971998949 4:34004387-34004409 AACAGTCCAGATATGAGTCTAGG - Intergenic
972183822 4:36503121-36503143 AACACTCAAAGCATGTGGCCTGG - Intergenic
981077055 4:140602579-140602601 AAGAGTCCAGTGATGTGACCAGG + Intergenic
982889215 4:160825769-160825791 AACATTCCAGGTATGTGTAAGGG - Intergenic
986533041 5:8759249-8759271 AACCATCAAGGCATGTCTCCAGG + Intergenic
990958674 5:61369517-61369539 AACAGTCCAGGCAAGCCCCCAGG - Intronic
991480345 5:67071420-67071442 AACAGTCCATGGATCTTTCCTGG + Intronic
994213190 5:97108674-97108696 AGAAGTCCAGGCCTGGGTCCTGG + Intronic
997845372 5:137281387-137281409 TAAAGTCCAGGAATGTTTCCAGG + Intronic
998205217 5:140152802-140152824 AACAGTGCAGGCTTGGGCCCGGG - Intergenic
999442980 5:151616836-151616858 ATCAGTTCAGACTTGTGTCCTGG - Intergenic
1001403434 5:171460013-171460035 CACAGCCCAGGCCTCTGTCCTGG + Intergenic
1005855383 6:29858049-29858071 AACACTCCAGACATGGGTCTGGG + Intergenic
1005878298 6:30032578-30032600 AACAGTACCTGCCTGTGTCCTGG - Intergenic
1007166358 6:39831676-39831698 AACAGTCCAGGTCTGTGGCCTGG + Intronic
1012130086 6:95480046-95480068 AAGATTCCAGGCATGTGCCTCGG - Intergenic
1013169237 6:107621233-107621255 AACAGTTCAGGCATTTGGCCTGG + Intronic
1015914794 6:138204925-138204947 AACAGTTCAGTGATGTCTCCTGG + Intronic
1016591643 6:145752043-145752065 AACAGTTCAGTCATGTTTTCAGG + Intergenic
1018007688 6:159638582-159638604 AAGAGTCTGGGCATGTGACCTGG - Intergenic
1018466431 6:164050574-164050596 AACAGTCTAAGCATGTGTGTTGG + Intergenic
1019385105 7:750701-750723 ACCAGTCCCAGCCTGTGTCCAGG + Intronic
1023998991 7:45178669-45178691 TCCATTCCAGGCCTGTGTCCAGG - Intronic
1025274986 7:57573520-57573542 AACAGTCCAGATATGAGTCTAGG - Intergenic
1026929728 7:74217134-74217156 AGAAGTCCAGGCATCTGGCCAGG + Intronic
1027833927 7:83217435-83217457 AACTTTTCAGGCATGTGTCTTGG - Intergenic
1032970346 7:137155505-137155527 TAGAGTCCAGTCATGTATCCTGG + Intergenic
1033087054 7:138352433-138352455 AACATTTTAGGCATTTGTCCAGG - Intergenic
1034989122 7:155536493-155536515 AACAGTCGAGCTGTGTGTCCAGG - Intergenic
1036285192 8:7438343-7438365 AACAGTCCAGGGACGGGTACTGG - Intergenic
1036336284 8:7873186-7873208 AACAGTCCAGGGACGGGTACTGG + Intergenic
1038687368 8:29730645-29730667 AAAAGGCCAGCCATGTTTCCAGG + Intergenic
1040694276 8:49977588-49977610 AAGAGGCTAGGCATGTGGCCTGG + Intronic
1041197219 8:55412128-55412150 ACCAGTCCAGGGATCTCTCCAGG - Intronic
1041536397 8:58930680-58930702 ATCTGTCCAGGCATGTGTAGGGG - Intronic
1044251075 8:90004504-90004526 ATCATTCCAGGCATCTGTTCTGG + Intronic
1045490289 8:102663087-102663109 AACACTCCAGCCACGTGACCAGG + Intergenic
1048342814 8:133553963-133553985 AAGAGTACAGGGAGGTGTCCGGG + Intronic
1049407927 8:142460026-142460048 AACACTGCAGCCATGTGACCTGG + Intronic
1052118969 9:24685188-24685210 CACATTCCACGCATGTGTCTAGG + Intergenic
1053539364 9:38957919-38957941 GACAATTCAGGCCTGTGTCCTGG - Intergenic
1054626775 9:67405999-67406021 GACAATTCAGGCCTGTGTCCTGG + Intergenic
1057135416 9:92684106-92684128 ATCAGGCCATGCATGTCTCCAGG - Intergenic
1060110715 9:120904601-120904623 AAGAGAGCAGGCCTGTGTCCAGG + Exonic
1061583526 9:131552423-131552445 AACAGTCTTGGATTGTGTCCTGG + Intergenic
1203626258 Un_KI270750v1:27359-27381 AACAGTCCAGATATGAGTCTAGG - Intergenic
1186147912 X:6644158-6644180 AACAGTGCAGTAATGAGTCCTGG - Intergenic
1186375738 X:8997770-8997792 AAAAATCCAGGCATGCATCCAGG + Intergenic
1189387127 X:40546160-40546182 AACCTTCCAGGCCTGTCTCCAGG - Intergenic
1190060293 X:47206468-47206490 AAGAGGCCAGGCATCTGGCCAGG + Intronic
1197700781 X:129597976-129597998 AACAGTGCAGTGATGTGTACAGG - Intergenic