ID: 1142029935

View in Genome Browser
Species Human (GRCh38)
Location 16:87833408-87833430
Sequence CACAGCAGGCAGGGCCGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142029924_1142029935 6 Left 1142029924 16:87833379-87833401 CCACCACCTGGACACATGCCTGG 0: 1
1: 0
2: 2
3: 24
4: 333
Right 1142029935 16:87833408-87833430 CACAGCAGGCAGGGCCGGAGGGG No data
1142029919_1142029935 26 Left 1142029919 16:87833359-87833381 CCTGCAGGTCCACACCCGGGCCA 0: 1
1: 0
2: 0
3: 27
4: 175
Right 1142029935 16:87833408-87833430 CACAGCAGGCAGGGCCGGAGGGG No data
1142029926_1142029935 3 Left 1142029926 16:87833382-87833404 CCACCTGGACACATGCCTGGACT 0: 1
1: 0
2: 0
3: 13
4: 254
Right 1142029935 16:87833408-87833430 CACAGCAGGCAGGGCCGGAGGGG No data
1142029921_1142029935 17 Left 1142029921 16:87833368-87833390 CCACACCCGGGCCACCACCTGGA 0: 1
1: 0
2: 2
3: 24
4: 300
Right 1142029935 16:87833408-87833430 CACAGCAGGCAGGGCCGGAGGGG No data
1142029923_1142029935 11 Left 1142029923 16:87833374-87833396 CCGGGCCACCACCTGGACACATG 0: 1
1: 0
2: 2
3: 21
4: 410
Right 1142029935 16:87833408-87833430 CACAGCAGGCAGGGCCGGAGGGG No data
1142029927_1142029935 0 Left 1142029927 16:87833385-87833407 CCTGGACACATGCCTGGACTGTT 0: 1
1: 0
2: 1
3: 14
4: 153
Right 1142029935 16:87833408-87833430 CACAGCAGGCAGGGCCGGAGGGG No data
1142029916_1142029935 30 Left 1142029916 16:87833355-87833377 CCTTCCTGCAGGTCCACACCCGG No data
Right 1142029935 16:87833408-87833430 CACAGCAGGCAGGGCCGGAGGGG No data
1142029922_1142029935 12 Left 1142029922 16:87833373-87833395 CCCGGGCCACCACCTGGACACAT 0: 1
1: 0
2: 4
3: 22
4: 228
Right 1142029935 16:87833408-87833430 CACAGCAGGCAGGGCCGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142029935 Original CRISPR CACAGCAGGCAGGGCCGGAG GGG Intronic
No off target data available for this crispr