ID: 1142030269

View in Genome Browser
Species Human (GRCh38)
Location 16:87835088-87835110
Sequence CAGGGCTGCAAGGAGCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 577
Summary {0: 1, 1: 2, 2: 3, 3: 73, 4: 498}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142030266_1142030269 -6 Left 1142030266 16:87835071-87835093 CCGGCACAGAAGCCAGGCAGGGC 0: 1
1: 0
2: 6
3: 37
4: 378
Right 1142030269 16:87835088-87835110 CAGGGCTGCAAGGAGCCTGCAGG 0: 1
1: 2
2: 3
3: 73
4: 498
1142030259_1142030269 15 Left 1142030259 16:87835050-87835072 CCTTCAGCAGATGAGCTCCACCC 0: 1
1: 0
2: 2
3: 18
4: 154
Right 1142030269 16:87835088-87835110 CAGGGCTGCAAGGAGCCTGCAGG 0: 1
1: 2
2: 3
3: 73
4: 498
1142030262_1142030269 -2 Left 1142030262 16:87835067-87835089 CCACCCGGCACAGAAGCCAGGCA 0: 1
1: 0
2: 1
3: 15
4: 190
Right 1142030269 16:87835088-87835110 CAGGGCTGCAAGGAGCCTGCAGG 0: 1
1: 2
2: 3
3: 73
4: 498
1142030258_1142030269 27 Left 1142030258 16:87835038-87835060 CCTAAACTGTCACCTTCAGCAGA 0: 1
1: 0
2: 1
3: 18
4: 182
Right 1142030269 16:87835088-87835110 CAGGGCTGCAAGGAGCCTGCAGG 0: 1
1: 2
2: 3
3: 73
4: 498
1142030264_1142030269 -5 Left 1142030264 16:87835070-87835092 CCCGGCACAGAAGCCAGGCAGGG 0: 1
1: 0
2: 5
3: 56
4: 488
Right 1142030269 16:87835088-87835110 CAGGGCTGCAAGGAGCCTGCAGG 0: 1
1: 2
2: 3
3: 73
4: 498

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142030269 Original CRISPR CAGGGCTGCAAGGAGCCTGC AGG Intronic
900085287 1:890819-890841 CAAGGCTGCAAGGTGGCTGAGGG - Intergenic
900122507 1:1054813-1054835 CTGTGCTGCAGGGGGCCTGCCGG + Exonic
900140450 1:1137392-1137414 CAGGGCCACAGAGAGCCTGCGGG - Intergenic
900247953 1:1647855-1647877 CAAGGCAGCAAGGAAACTGCAGG + Intronic
900259181 1:1715007-1715029 CAAGGCAGCAAGGAAACTGCAGG + Intronic
900367071 1:2315675-2315697 CAGGCCTGCAGGGAGCCAGGGGG - Intergenic
900524272 1:3120804-3120826 CAAGAGTGCAAGGAGGCTGCCGG + Intronic
900920485 1:5667327-5667349 CAAGGCTGCAAGGTGACTGAGGG - Intergenic
900933717 1:5752546-5752568 CAGGCCTGCAAGGTGACAGCAGG - Intergenic
901323238 1:8351872-8351894 AGGGGCTGCAGGCAGCCTGCAGG - Intergenic
901392609 1:8956870-8956892 CTGGGCGGGAAGGAGCGTGCTGG + Intronic
901428902 1:9200401-9200423 CAGGGCTGCAAGGAGGGAACGGG + Intergenic
901941171 1:12663070-12663092 AAGGGCTTCCAGGAGGCTGCAGG + Intronic
902163096 1:14548131-14548153 CTGGGCTGCATGTGGCCTGCAGG + Intergenic
902208704 1:14889089-14889111 CCGGGCCGCATGCAGCCTGCGGG + Intronic
902242691 1:15099515-15099537 CAGGGTTGCAAGGGGCTGGCCGG + Intronic
902331048 1:15731408-15731430 GAGGGCTGCAAGGAGCCCACAGG + Intronic
902906694 1:19563554-19563576 TAGAGCTGCCAGGAGCCTGGGGG - Intergenic
903223536 1:21882166-21882188 CAGGGCTGGAACAACCCTGCAGG + Intronic
903548429 1:24141483-24141505 CTGGGTTGCAAGGAGGCTGGTGG + Intronic
904965752 1:34371263-34371285 AAGGGCTACATGGAGCCTGATGG + Intergenic
907092179 1:51735275-51735297 AAGAGCTGCAAGTAGCCTGAAGG - Intronic
907319249 1:53592523-53592545 CAGGGCTGCTGGGAGACAGCTGG - Intronic
907333220 1:53684763-53684785 TAGGGGTGCTGGGAGCCTGCTGG - Intronic
907418679 1:54331994-54332016 CAGGGCTGCAAGGTCACTGGAGG + Intronic
907594274 1:55705096-55705118 CAGGGCTGGAAGGATCATCCTGG - Intergenic
907653353 1:56317905-56317927 CAGGGGTGCCCTGAGCCTGCTGG + Intergenic
907758772 1:57337447-57337469 AAAGGCTCCAAGGAGGCTGCAGG - Intronic
908651039 1:66333617-66333639 CAGGGCTGGAAAGGGCATGCTGG - Intronic
909387390 1:75074745-75074767 CTGAGCTGGAAGGAACCTGCTGG - Intergenic
910655087 1:89610538-89610560 CAGCGTTCCACGGAGCCTGCAGG - Intergenic
911617468 1:100030395-100030417 CTGGGCTGCATGCAGCCTGCAGG - Intergenic
911828972 1:102525983-102526005 CTGGGCTGCATGCAGCCCGCGGG + Intergenic
911851505 1:102826909-102826931 CAAGGCTGCAGGGAGGCTGGGGG + Intergenic
912032642 1:105268601-105268623 TAGTGCTGCAATGAACCTGCAGG - Intergenic
914884552 1:151574435-151574457 CTGGGCTGGAAGGGGCCTGCAGG + Intronic
915030025 1:152871151-152871173 CAAGGCTGCAAGGAGGCAGAGGG + Intergenic
916347551 1:163811106-163811128 CTGAGCTGCATGCAGCCTGCAGG - Intergenic
917316655 1:173732903-173732925 CAGGACTCCAAAGAGCCTCCAGG - Intronic
917967126 1:180185980-180186002 AGGGGCTGCAAGGAGCATCCAGG - Intronic
919409134 1:197222176-197222198 CAGGGCAACAAGGAGCGGGCCGG - Intergenic
919736343 1:200954325-200954347 CAGGGCTGCGTGGGGCCTGTGGG + Intergenic
919945701 1:202317945-202317967 CAGGGCTTGAAGGGGCCTGTAGG - Exonic
920039535 1:203086358-203086380 CGGGACTGCAAGGAGACAGCAGG - Intergenic
920137432 1:203781369-203781391 CTGGGCTGCATGGAGCCTGCAGG + Intergenic
920173251 1:204084478-204084500 CAGGGCTGCCAGGACCAGGCAGG + Intronic
920184424 1:204151534-204151556 CAGGGCTGCCAGGGGGATGCGGG - Intronic
920232513 1:204480042-204480064 CAGGTCTGCAAGGAGCAAGGAGG + Intronic
921432157 1:215078195-215078217 CTGGGCTGCATGTAGCCTGCAGG + Intronic
921688626 1:218121150-218121172 CTGGGCTGCACGCAGCCTGCAGG - Intergenic
922346959 1:224704297-224704319 CAGAGCTGTTAGGACCCTGCAGG - Intronic
922505411 1:226122815-226122837 CAGGGCAGGAAGGAACCTGGAGG + Intergenic
922534566 1:226370404-226370426 CAGGGCTACCAGGGGCCTCCTGG - Intronic
923573779 1:235140306-235140328 CAGGGCTGCGCGGCGCTTGCGGG + Intronic
924261638 1:242237627-242237649 CAGGGCTGCAAGGGCACTGAGGG - Intronic
1062974572 10:1674090-1674112 GAGGGCTGCAAGGAGGCCACTGG + Intronic
1063224129 10:3998724-3998746 CTGGGCTGCATGGGGCCTGCAGG + Intergenic
1063361226 10:5460654-5460676 CAGGACTCCAGGGAACCTGCCGG + Intergenic
1064605723 10:17036593-17036615 CAGGGCTGCCAGGGGGCTGAAGG + Intronic
1066697232 10:38090393-38090415 CAGTGCAGCATGGAGCCTACTGG + Intergenic
1066995299 10:42557083-42557105 CAGTGCTGCATGGAGCCTACTGG - Intergenic
1067078201 10:43199889-43199911 CTGGGCAGCAAGGAGCACGCAGG - Intronic
1067083765 10:43227629-43227651 CAGGGCAGCAAGGAGCCTGCAGG + Intronic
1067177636 10:43961283-43961305 GAGGACTGGAAGGAGACTGCTGG + Intergenic
1069987674 10:72295585-72295607 AAGGGCTTCAAGGACCCTCCAGG + Intergenic
1071801417 10:89066316-89066338 CAGGGCTGGAGGGAGCCTGGGGG - Intergenic
1072034043 10:91548321-91548343 CTGGGCTGCATGCAGCCTGCAGG - Intergenic
1073453586 10:103623439-103623461 CAGGGCTCCAGGGTGCCAGCTGG + Intronic
1074045822 10:109838214-109838236 AAGGGCTGAAAGAAGCCTGAAGG + Intergenic
1074162497 10:110845994-110846016 AAGGGCTGCAGGGAGGCTCCTGG + Intergenic
1074327591 10:112467542-112467564 CTGGGCTGCCTGCAGCCTGCTGG + Intronic
1074368047 10:112875956-112875978 CAGGGCTGCCAGGAGCAGGGAGG + Intergenic
1074687902 10:115976702-115976724 CAGAGCTGCTGGGAGGCTGCTGG - Intergenic
1075187902 10:120279387-120279409 CAGGGCTGCAAGGTGCCAAGAGG + Intergenic
1075399992 10:122154031-122154053 CAGGGCTGCAAAGAGACCCCAGG - Intronic
1076287761 10:129317060-129317082 CTGGGCTGCATGCAGCCTGTGGG - Intergenic
1076512756 10:131024057-131024079 GAGGGCTGCAGGGAGCATGGTGG + Intergenic
1076804637 10:132849359-132849381 CAGGGCTGCACGGCACCTGGTGG + Intronic
1076809312 10:132878481-132878503 CAGGGCCGCGAGGGGCCCGCAGG - Intronic
1077069505 11:661938-661960 CTGGGCTGCATGCAGCCCGCGGG - Intronic
1077293954 11:1815358-1815380 ATGGGCGGCCAGGAGCCTGCTGG + Intergenic
1077295403 11:1824059-1824081 CAGGGCTGCCCAGCGCCTGCAGG - Intergenic
1077310664 11:1887645-1887667 CAGGGCTCCAGGCAGCCTCCAGG - Intronic
1077348344 11:2075473-2075495 CAGGGCCACATTGAGCCTGCAGG + Intergenic
1077673465 11:4178336-4178358 CTGGGCTGCATGTGGCCTGCAGG + Intergenic
1079135444 11:17773889-17773911 CAGGTCTGGCAGGAGGCTGCTGG + Intronic
1080295911 11:30727225-30727247 CTGGGCTGCACGTGGCCTGCTGG + Intergenic
1080383972 11:31799725-31799747 CGGGACTGCGAGGAGGCTGCCGG - Intronic
1080395870 11:31889492-31889514 TTGGGCTGCATGCAGCCTGCAGG + Intronic
1080450395 11:32374566-32374588 CAGGGCTGCAAAGTGGCTGAGGG - Intergenic
1081874929 11:46401974-46401996 CAGGGCTGCCGGGTACCTGCAGG - Intronic
1083129908 11:60615651-60615673 CATGGCTCCGCGGAGCCTGCAGG - Intergenic
1083316503 11:61817659-61817681 CAGGGCTCCTAGGCGCCTCCAGG - Intronic
1083768310 11:64852901-64852923 CAGCGCTGCTCGGAGTCTGCAGG - Exonic
1083990740 11:66244355-66244377 CAGGGAGGGAAGGAGCCTGCTGG - Exonic
1084241844 11:67826574-67826596 CAGCTCTGCAAGGAGCTGGCGGG - Intergenic
1084399709 11:68936554-68936576 CAGGGCCGGAAGAAGCCGGCTGG + Exonic
1084760640 11:71268459-71268481 CAGGGCTGCAACTAGGATGCTGG + Intergenic
1085389057 11:76172925-76172947 CAGAGAAGGAAGGAGCCTGCTGG - Intergenic
1085781130 11:79410118-79410140 CTGGGCTTCATGGAGCCTGCAGG + Intronic
1087262473 11:96026241-96026263 CAGGGCTGCAGGTATACTGCTGG - Intronic
1088746073 11:112806086-112806108 AAGGGAGGCAAGGAGCCAGCAGG + Intergenic
1089109285 11:116042298-116042320 CAGGTCTATAAGGAGCCTGCTGG - Intergenic
1089290959 11:117437765-117437787 CAGGGATGCAGGGAGACTGAAGG - Intronic
1089499428 11:118923757-118923779 CAGGCCTGGAAGCAGCCTTCTGG - Intronic
1089604722 11:119635255-119635277 GAAGGCTGCAGGGAGCCTGGGGG - Intronic
1090414911 11:126534237-126534259 CAGGGCTGCAAGGGGGCTACTGG + Intronic
1091074847 11:132605915-132605937 CAGAGCTGAAAGGAAGCTGCTGG - Intronic
1091372755 11:135074286-135074308 CAGGGCCACATTGAGCCTGCAGG - Intergenic
1094849241 12:34374994-34375016 CAGGGATGCCAAGAGTCTGCTGG + Intergenic
1095088684 12:38084925-38084947 CAGACCAGCAAGGAGCCTCCAGG - Intergenic
1095455272 12:42377017-42377039 CTGGGCTGCACGCGGCCTGCAGG - Intronic
1098856539 12:75659047-75659069 CTAGGCTGCTCGGAGCCTGCAGG + Intergenic
1098999312 12:77159292-77159314 CTGGGCTGCATGCAGCCTGTGGG + Intergenic
1100493170 12:95100462-95100484 CACGGCAGCAAGCAGCCAGCTGG - Intronic
1100647139 12:96543453-96543475 AAGGGCTGCTAGGAGACTGGGGG + Intronic
1100948865 12:99822732-99822754 TAGTGCTGCAATGAGCATGCAGG + Intronic
1101302308 12:103495351-103495373 CAGGGCTGCAAAGAGCAAGGCGG + Intronic
1101319581 12:103661777-103661799 CAGAGCAGAAAGGAGCATGCTGG + Intronic
1103118758 12:118362419-118362441 CTGGGGTGCATGCAGCCTGCGGG + Intronic
1103398038 12:120623006-120623028 AGGGGCAGCAAGGAGACTGCGGG - Intergenic
1103488326 12:121297186-121297208 CGGGGCTGCAGGGCGCCTCCGGG + Intronic
1104917724 12:132274457-132274479 CAGGGGTGCAAAGAGCAAGCCGG - Intronic
1104963912 12:132500647-132500669 CCGGGCTGGATGGAGTCTGCAGG - Intronic
1104963929 12:132500705-132500727 CCGGGCTGGACGGAGTCTGCAGG - Intronic
1105736035 13:23271491-23271513 CTGGGCTGCATGCAGCCGGCGGG + Intronic
1106370323 13:29126541-29126563 CTGGGCTGCATGGAGCCAGGAGG - Intronic
1107832955 13:44390583-44390605 CAGGGCACAAAGGAGGCTGCAGG - Intronic
1107882283 13:44843245-44843267 CAGAGCAGGAAGGAGCCAGCGGG + Intergenic
1108481806 13:50880226-50880248 CTGGGCTGCATGCAGCCTGCAGG - Intergenic
1108589761 13:51902666-51902688 CAGGGCTGCAAGTGACCTGCAGG - Intergenic
1109119398 13:58435140-58435162 CAAGGCTGAAAGGAGTGTGCAGG - Intergenic
1111503632 13:89158358-89158380 CAGGGATCCAAGGATCCTTCAGG - Intergenic
1113556494 13:111239708-111239730 CTGGGCGGCGAGGTGCCTGCTGG + Intronic
1113925248 13:113938365-113938387 CAGGGCTGGCAGGAGCCTGGTGG + Intergenic
1114602868 14:23970188-23970210 CAGGGCCGGAAGGAACGTGCTGG - Intronic
1114607233 14:24007317-24007339 CAGGGCCGGAAGGAACGTGCTGG - Intergenic
1116515171 14:45796177-45796199 CAAGGCAGCAAGGAGGCTGGGGG + Intergenic
1117595249 14:57320661-57320683 TAGAGCTGGAAGGAGCCTGGTGG - Intergenic
1117939789 14:60950511-60950533 CTGGGCTGCATGTGGCCTGCAGG - Intronic
1117964892 14:61196910-61196932 TAGGGATGCAATAAGCCTGCAGG - Intronic
1118595061 14:67428827-67428849 CTGGGCTGTAGGGGGCCTGCTGG + Intergenic
1118852264 14:69593078-69593100 CAGGGCTGTACAGAGCCTTCAGG + Intergenic
1119062495 14:71489797-71489819 CTGGGCTGCATGTGGCCTGCGGG + Intronic
1119474907 14:74921529-74921551 CAGGGCAGCCATGAGCCTGGTGG - Exonic
1119859392 14:77925380-77925402 GAGGGCTTGGAGGAGCCTGCAGG + Intronic
1120067000 14:80054096-80054118 CTGGGCCGCATGGAGCCTGTGGG + Intergenic
1120585965 14:86312639-86312661 CAAGGCGGCAAGGAGGCTGGGGG + Intergenic
1121665520 14:95669107-95669129 CAGGGCTGGAAAGAGGCTGCTGG + Intergenic
1121856705 14:97276825-97276847 GAGAGCTGCACTGAGCCTGCTGG + Intergenic
1121865641 14:97359916-97359938 CAGGGAGACAAGGAGCCTGAGGG - Intergenic
1121985473 14:98501351-98501373 GAGGGCTACAAGGAGCCGGGAGG - Intergenic
1122797384 14:104212804-104212826 CAGGGCAGCAAGGTGGCTGCAGG + Intergenic
1122917370 14:104865324-104865346 CCGGGCTGCCACGAGCGTGCGGG + Exonic
1122940586 14:104979251-104979273 CAGGGCAGCAAGGAGGCTGAGGG + Intergenic
1123043435 14:105499831-105499853 CAGGGCCGGCAGGAGCCTGGAGG - Intergenic
1124160644 15:27265605-27265627 CAGGTCTTCAAGGACCATGCTGG + Intronic
1124631218 15:31338722-31338744 CAGGGGGGCCAGCAGCCTGCTGG + Intronic
1124785145 15:32672325-32672347 CAGGGCTGCAGGCAGCGTGAGGG + Intronic
1125035625 15:35121161-35121183 CCGGGCTCCAGGTAGCCTGCAGG - Intergenic
1125604867 15:40934476-40934498 ATGGACTGCAAGGAGCCTGGAGG + Intronic
1127218375 15:56849275-56849297 CTGGGCTGCATGCAGCCTGTGGG - Intronic
1127255363 15:57286867-57286889 CAGGGCTGCACGGAGGAGGCTGG - Exonic
1127355363 15:58193777-58193799 CAAGGCTGCAGGGAGGCTGGGGG + Intronic
1127381168 15:58431634-58431656 CAGCGCTGCAAGGGGGATGCTGG - Intronic
1128083981 15:64873421-64873443 CAGATCTGCAAGCTGCCTGCTGG - Intronic
1128301614 15:66569705-66569727 AAGGGCTGGAGGGAACCTGCCGG + Intergenic
1128476194 15:67998780-67998802 CAGGGCTGCCAGGAGCTGGCTGG + Intergenic
1128604661 15:69027836-69027858 CAGGGCTGGAAGGAGCCTGCAGG + Intronic
1128741795 15:70088942-70088964 CAGGGATGCAGGGAGCCACCGGG + Intronic
1128796681 15:70471409-70471431 CAGTGCTGCATGGAGACTGGAGG - Intergenic
1128894811 15:71363061-71363083 CTGGGCTGCATGTGGCCTGCGGG + Intronic
1129704672 15:77787434-77787456 CACAGCTGCAGGGAGCCTCCGGG + Intronic
1130109811 15:80954757-80954779 CAGGGCTGCATGTAGCCCACTGG - Intronic
1131121171 15:89824136-89824158 CAGGGAGGCAAAGAGCCTGATGG - Intergenic
1131230823 15:90658053-90658075 CAGGTCTGAAAGGAGCATGCAGG - Intergenic
1131538250 15:93255029-93255051 CAGGGCTGCCAGGCCCCTGTGGG + Intergenic
1131574994 15:93579950-93579972 CTGGGCTGCATGTGGCCTGCAGG - Intergenic
1132203572 15:99971324-99971346 CTTGGCTGCAGGGAGCCTGCTGG - Intergenic
1132685640 16:1160934-1160956 CAGGGCTGCACCGAGGCTGGGGG - Intronic
1132792354 16:1698806-1698828 CACAGCTGCAAGGAGCATCCCGG + Exonic
1132806107 16:1775877-1775899 CAGGGCTGCAGGCGGCCTGGCGG + Exonic
1133403299 16:5504308-5504330 AGGGCCTGCCAGGAGCCTGCTGG + Intergenic
1133506547 16:6418065-6418087 CATGGCAGTAAGGAGCCTGAGGG - Intronic
1133742356 16:8661084-8661106 CAGGGACGCAAGGTGCCTGACGG - Intergenic
1134363506 16:13554834-13554856 AATGGCTGCCAGGAGCTTGCAGG - Intergenic
1135048397 16:19172539-19172561 CAGGGCTGCTGGTAGCCTCCTGG - Intronic
1135325142 16:21520964-21520986 CCAGGCTGGAAGGAGGCTGCAGG - Intergenic
1135561459 16:23479854-23479876 CAGGTCTTCATGCAGCCTGCTGG + Exonic
1135922907 16:26667337-26667359 CCGGGCAGCAAGAAGCCGGCTGG - Intergenic
1135977457 16:27118284-27118306 CTGGGCTGCATGTGGCCTGCAGG - Intergenic
1136336626 16:29614232-29614254 CCAGGCTGGAAGGAGGCTGCAGG - Intergenic
1138373194 16:56543538-56543560 GAGGGATCAAAGGAGCCTGCTGG + Intergenic
1138485433 16:57339928-57339950 CAAGGCTGCAATGAGCCGGGGGG - Intergenic
1139671810 16:68497384-68497406 CAGGGCTCCAGAGAGCCTGGTGG - Intergenic
1140106802 16:71968096-71968118 CAGGGCTGCCAGACACCTGCCGG - Intronic
1140309024 16:73831351-73831373 CAGGGCTGCTCTGACCCTGCAGG - Intergenic
1141624251 16:85253084-85253106 CGGGCCTGCAAGCAGCCTGCTGG - Intergenic
1141873592 16:86806424-86806446 CTGGGCTGGAAGCAGTCTGCAGG + Intergenic
1142030269 16:87835088-87835110 CAGGGCTGCAAGGAGCCTGCAGG + Intronic
1142037350 16:87870016-87870038 CCAGGCTGGAAGGAGGCTGCAGG - Intergenic
1142131519 16:88433596-88433618 CAGGGCAGCCATGAGCCTTCAGG + Exonic
1142218769 16:88842630-88842652 CAGGGCTGGAAGGACCCGGGAGG + Intronic
1142424556 16:89994429-89994451 CAGGGGTGGCAGGAGCCGGCGGG - Intergenic
1142614726 17:1127606-1127628 CAGGGCAGCCTGGAGCCTCCTGG - Intronic
1142685368 17:1574593-1574615 CAGGGCCCCACGGAGCCCGCCGG + Exonic
1142851068 17:2704989-2705011 CTGGGCTGCAGGGGGGCTGCAGG + Intronic
1144519449 17:15944583-15944605 CCGGACTGCAAGGAGCCCTCGGG - Intergenic
1145259102 17:21344101-21344123 CGGGGCTGCCAGGGCCCTGCGGG + Intergenic
1145317516 17:21743902-21743924 CGGGGCTGCCAGGGCCCTGCGGG - Intergenic
1145788783 17:27611323-27611345 TAGGGCTGGGAGGAGCCTCCAGG + Intronic
1146062590 17:29614892-29614914 CAGGTCTCCCAGGAGCCTGGGGG + Exonic
1146496868 17:33330359-33330381 CAGGACTGCAGGGAGGCTGCTGG + Intronic
1147623784 17:41886020-41886042 AGGGGCAGCAAGCAGCCTGCAGG + Intronic
1147649107 17:42051814-42051836 CAGTGCTGCATGGAGGATGCTGG - Intronic
1147883984 17:43672181-43672203 CAGGGCTGGGAGTAGCCTGGGGG + Intergenic
1148489168 17:48012301-48012323 CAGGGCTGCTGGGAGCCAGGGGG - Intergenic
1148775734 17:50094983-50095005 AAGGGTTAAAAGGAGCCTGCAGG + Intronic
1149152270 17:53581487-53581509 CAAGGCTGCAAGGTGCCTGTGGG - Intergenic
1150229753 17:63543602-63543624 CTTGGCTGCCAGGAGCCTGTCGG - Exonic
1150394737 17:64812418-64812440 CAGAGCTGCAAGGAGGCCGGTGG + Intergenic
1150644001 17:66966721-66966743 CAGGGCTGAGTGGAGTCTGCAGG + Intronic
1151498397 17:74473448-74473470 CAGGGCCGCATGGACCCTGGGGG - Intronic
1151620755 17:75243409-75243431 GAGGGCTGCCTGGAGGCTGCGGG + Intronic
1152221802 17:79072845-79072867 CAGGACAGCCAAGAGCCTGCAGG + Intergenic
1152276396 17:79360324-79360346 CAGGGAACCAAGGAACCTGCAGG + Intronic
1152571672 17:81123803-81123825 CAGGGGTGCACAGAGCGTGCAGG + Intronic
1152638058 17:81438280-81438302 CAGGGAGGCAAGAAGCCGGCAGG - Intronic
1153102294 18:1487595-1487617 CAGGGCTGGAGGGAACCTGTCGG + Intergenic
1153648682 18:7219784-7219806 CTGGCCTGCAAGGTGTCTGCGGG + Intergenic
1155655119 18:28183677-28183699 GAGGGCTTTGAGGAGCCTGCTGG + Intergenic
1155880149 18:31136765-31136787 CTGGGCTGCATGCTGCCTGCAGG + Intronic
1156178546 18:34576165-34576187 CAGAGCTGCATGGAGCCTTCAGG + Intronic
1156600414 18:38598927-38598949 CAGACCTTCAAGGAGCATGCTGG + Intergenic
1157560209 18:48640206-48640228 GAGTGCAGCAAGGAGCCAGCCGG - Intronic
1158260526 18:55601298-55601320 CAGGGGTTCAAGGAGCCCTCTGG - Intronic
1158734645 18:60065843-60065865 CTGGGCTGCATGTAGCCTGCAGG + Intergenic
1158746208 18:60202535-60202557 GAGGGTAGCAAGGAGCATGCAGG - Intergenic
1159243561 18:65775730-65775752 CTGGGCTGCATGTAGCCTGTGGG + Intronic
1159497229 18:69222288-69222310 CAGGACTACAAGGGGCCTGGTGG + Intergenic
1159670238 18:71212818-71212840 CAGGGCTGCGCGGCGCTTGCGGG - Intergenic
1160561138 18:79756308-79756330 CAGGGCTGCAAGGACACGGCTGG - Exonic
1161014371 19:1976338-1976360 CAGGGCTGCAGGGAGGCACCTGG + Intronic
1161108273 19:2455311-2455333 CTGGGCTCCAAGGAGACTGGGGG - Intronic
1161295706 19:3519226-3519248 CAGGGCAGCAGGGACTCTGCAGG - Intronic
1161429723 19:4224560-4224582 CCGGTCTGCAAGGGGCCTGCAGG - Exonic
1161585479 19:5103159-5103181 CAGGGCTGCCCGGTGCCTGCAGG - Intronic
1161726732 19:5933641-5933663 CAGGCCTGGAAGGCGCCTGGAGG + Intronic
1161767774 19:6216551-6216573 CAGGGCTCCACTGAGCCTCCAGG + Intronic
1162015836 19:7846124-7846146 CGGGGCTCCATGGACCCTGCTGG - Intronic
1162345070 19:10114068-10114090 CAGGGCGGCCAGGACCCAGCCGG - Exonic
1165256934 19:34582682-34582704 CTGGGCCGCAAGCATCCTGCGGG + Intergenic
1165265674 19:34661740-34661762 CTGGGCTGCATGGGGCCTGCAGG - Intronic
1165352802 19:35285405-35285427 CAGGGCTGCATGTGGCCTCCAGG - Intergenic
1165419326 19:35715329-35715351 CTGGTTTGCAGGGAGCCTGCTGG - Exonic
1165445753 19:35856174-35856196 CTGGGCTGCATGGAGCCGTCAGG + Intronic
1166441278 19:42817477-42817499 CAGGGCAAAATGGAGCCTGCAGG - Intronic
1166449459 19:42885789-42885811 CAGGGCAAAACGGAGCCTGCAGG - Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166859069 19:45799273-45799295 GAGGGCTGCCAGGTGCCTGCGGG + Intronic
1166959006 19:46486887-46486909 CAGGGGTGCAAGGAGCCCTTGGG + Intronic
1167321393 19:48799201-48799223 CAGGGCAGGAAGGAGACAGCTGG - Intronic
925004369 2:429684-429706 AAGGGCGGCAGGGAGCCGGCAGG - Intergenic
925273698 2:2634137-2634159 CAGTGCTGCAGTGAGCCTGGGGG + Intergenic
925540574 2:4962187-4962209 CAGGTCTGCAGAGAGGCTGCTGG - Intergenic
925580126 2:5401658-5401680 CAGGGCTGCAGGGATCCCACGGG + Intergenic
925891568 2:8438953-8438975 GAGGGCTCCTAGGAGCCTGAAGG + Intergenic
925985482 2:9211702-9211724 CAGGGCCCCTGGGAGCCTGCAGG - Intronic
926797316 2:16629594-16629616 TAGGGCTGCTAGGAGCTGGCAGG - Intronic
927184728 2:20474010-20474032 CAGGGCAGCAAGCAGCCTGGTGG - Intergenic
927207247 2:20618400-20618422 CGTGGCTGCCAGGGGCCTGCAGG - Exonic
927869637 2:26615425-26615447 CAGGGGTGAAGGGAGCCTGTAGG - Intronic
927873804 2:26640968-26640990 CTGGGCTGCATGTGGCCTGCAGG - Intronic
928793856 2:34992143-34992165 CAGGGCTGGTGGGTGCCTGCTGG + Intergenic
929230526 2:39555514-39555536 CCGGTCTGCATGCAGCCTGCAGG - Intergenic
929789337 2:45012037-45012059 CAGACCTGCCAGGAGCCTCCAGG + Intergenic
930395703 2:50821201-50821223 CTGGGCTGCATGGGGCCTGTGGG - Intronic
931667366 2:64618940-64618962 CTGGGCTGCACGTGGCCTGCAGG - Intergenic
932067441 2:68580741-68580763 CAGGGCTGGATGCAGCGTGCTGG - Intronic
932213325 2:69949171-69949193 CAGAGCCGCAGGGGGCCTGCAGG - Intergenic
932768850 2:74489355-74489377 CAAGGCTGGAGGGAGCCTGGTGG + Intronic
932784707 2:74590031-74590053 CTGGGCTGCATGCAGCCTGCGGG + Intronic
932958870 2:76388763-76388785 CTGGGCTACATGCAGCCTGCAGG + Intergenic
933763869 2:85694432-85694454 CATGGCTGCAAGGAGCAGGAGGG - Exonic
933813556 2:86048371-86048393 CAGGGCTGCAGAGAGGCTTCAGG - Intronic
933935231 2:87198557-87198579 CATGGCTCTAAGGAGGCTGCAGG - Intergenic
934519011 2:95007573-95007595 AAGGGCTTTAAGGAGCCTGCTGG - Intergenic
935173619 2:100629382-100629404 CAGGTTTGCAAGGAGACTTCTGG - Intergenic
936258814 2:110939698-110939720 CAGGGCTGCATGAGGCCTGAGGG - Intronic
936357918 2:111767342-111767364 CACGGCTCTAAGGAGGCTGCAGG + Intronic
936501795 2:113072531-113072553 CAGAGCTGCCTGGAGCCTGCTGG + Exonic
937097778 2:119247090-119247112 GAGGACTGCAATGTGCCTGCAGG + Intronic
937100764 2:119266217-119266239 CAGGGCTGCCAGGGGAATGCAGG - Intergenic
937256593 2:120560441-120560463 AAGTGCTGCAGGGAGCCTGGTGG - Intergenic
937259078 2:120573973-120573995 CAGGACTGCAATCAGCCTGGTGG - Intergenic
937378085 2:121351582-121351604 CAGGGCTGCAAGGAGTTAGCGGG - Intronic
937708257 2:124946838-124946860 CAGGGCTACATGCAGCCTGTGGG + Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938697287 2:133845664-133845686 CAGGGCTGAAAGGAACATACTGG - Intergenic
939575284 2:143887889-143887911 CAGGGCTCCAGTGAGCCTGTGGG + Intergenic
940024169 2:149187819-149187841 CTGGGCTGCATGCAGCCTGTGGG + Intronic
940075649 2:149739151-149739173 CAGGGCTGCTGGGTGCCTCCAGG - Intergenic
940725532 2:157331776-157331798 CTGGGCTGCATGCAGCCTGCAGG + Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941379012 2:164768337-164768359 CTGGGCTGCATGTGGCCTGCAGG - Intronic
942123466 2:172801364-172801386 CAGGGCAGCAAGGAGCAGGCTGG - Intronic
943484773 2:188465490-188465512 CAGGACTGCTAGGGGACTGCTGG - Intronic
946783879 2:223221952-223221974 CTGGGCTGCATGTAGCCTGAAGG - Intergenic
946903795 2:224396841-224396863 CAGAGCTGCTAGCAGCCAGCTGG + Intronic
947030336 2:225785077-225785099 CTGGGCTGCATGCAGCCCGCAGG - Intergenic
948093057 2:235311888-235311910 CTGGGCTGCATGTGGCCTGCAGG - Intergenic
948452976 2:238089555-238089577 CTGGGCCGCATGCAGCCTGCAGG - Intronic
948602775 2:239116734-239116756 CAGGGTGGCAGGGAGGCTGCAGG - Intronic
949011689 2:241683375-241683397 TTGGGCTGCATGCAGCCTGCGGG - Intronic
1168998125 20:2147586-2147608 CAGGGCTGGAAGGAGCCATATGG - Exonic
1169186421 20:3620898-3620920 CTGGGCTGCATGTAGCCCGCGGG - Intronic
1169198701 20:3697247-3697269 CAGGGCTGCCAGCAGCTTCCCGG + Exonic
1169334824 20:4747566-4747588 CAGGACTGCCAGGAGCCACCAGG + Intergenic
1169958475 20:11132041-11132063 CAGGTCAGCAAAGAGCCTGCTGG - Intergenic
1170013131 20:11749787-11749809 CATGTCAGAAAGGAGCCTGCAGG + Intergenic
1170724671 20:18915784-18915806 GAGGGCTCAGAGGAGCCTGCCGG + Intergenic
1170893750 20:20396392-20396414 TGGGGCTGCAGGGAGCCAGCGGG - Intronic
1170957161 20:20991789-20991811 CAGGGCTGCAAGGAGTCTTGTGG - Intergenic
1170974610 20:21150390-21150412 CAGTGATTCAAGGAGGCTGCTGG - Intronic
1172422011 20:34825620-34825642 CAGGGCCTCACGGAGCCGGCGGG + Intronic
1172806472 20:37615452-37615474 CAGTGCTGCCCGGAGCCTCCTGG - Intergenic
1172993272 20:39051266-39051288 GGGGGCTGCTAGGAGCCGGCAGG + Intergenic
1173798720 20:45881054-45881076 CAGGGTTACAAGGAGCTGGCTGG - Intergenic
1174648126 20:52103556-52103578 CAGCGCTGCGAGGCGCCTTCTGG - Intronic
1175084535 20:56447454-56447476 CAGGGCTGCAAGAGGCAGGCAGG + Intronic
1175554012 20:59835006-59835028 CTGAGCTGCATGCAGCCTGCAGG + Intronic
1175788076 20:61724230-61724252 CAGGGCAGTGAGGAGCCCGCTGG - Intronic
1175899343 20:62353867-62353889 CTGGGCTGCAGGGAGCAAGCGGG + Intronic
1176073892 20:63239862-63239884 CAAGGCTGAGAGGAGCCAGCAGG - Intronic
1177567923 21:22847672-22847694 CAGGGCTGCAAGGATTCTTGGGG + Intergenic
1178674679 21:34621090-34621112 CTGGGCTGCATGCAGCCTGCAGG + Intergenic
1179023634 21:37660727-37660749 CAGGGCTGGAGGGAGCTTGTTGG + Intronic
1179524226 21:41965387-41965409 CAGGACTGCAATGAGCCTGTGGG + Intergenic
1179549578 21:42135503-42135525 CCGGGCTGCAAAGGGCCAGCAGG + Intronic
1179993223 21:44959442-44959464 CAGGGGTGGGATGAGCCTGCAGG - Intronic
1180037325 21:45256558-45256580 CAGGGCTGCAGGGAGCCCCTCGG - Intergenic
1180176500 21:46093032-46093054 CAGGGCAGCCTGCAGCCTGCTGG + Intergenic
1180657821 22:17438541-17438563 CTGGGCTGCAGGCGGCCTGCGGG - Intronic
1181048404 22:20227413-20227435 CAGGGCTGCCAGGGGCTTGCAGG - Intergenic
1181092537 22:20483921-20483943 CAGGGCTGCATGGGGTCTGGGGG - Intronic
1181342900 22:22197006-22197028 CTGGGCTGCATGCAGCCTGCGGG - Intergenic
1182364672 22:29770439-29770461 CTGGGCTGCGTGCAGCCTGCAGG + Intergenic
1183260908 22:36795297-36795319 AGGGGCTGTGAGGAGCCTGCAGG + Intergenic
1183449968 22:37888000-37888022 CAGGGCTGTTATGATCCTGCAGG - Intronic
1183495712 22:38142691-38142713 CTGGGCTGCATGCAGCCTGCAGG + Intronic
1184037738 22:41926517-41926539 GAGGGCTGAAAGGACCCTGTGGG - Intronic
1184525315 22:45019292-45019314 GAGGGAAGCAAGGAGCCTGCAGG - Intergenic
1184624671 22:45715439-45715461 CTGGGCTGCATGCGGCCTGCAGG - Intronic
1184682673 22:46080408-46080430 CAGGGCTGCCAGGAGCCATGTGG - Intronic
1184750837 22:46485645-46485667 GAGAGGTGCATGGAGCCTGCTGG - Intronic
1184902407 22:47456123-47456145 CAGTTCTGCAGGGATCCTGCAGG - Intergenic
1185040013 22:48499041-48499063 AGGGGCTGCACTGAGCCTGCAGG - Intronic
1185139909 22:49094318-49094340 CTGGGCTGCCAGGGACCTGCAGG + Intergenic
1185266144 22:49905326-49905348 GAGGGCTCCGAGGAGCCTGGTGG - Intronic
1185365625 22:50435387-50435409 CTGAGCTGCAAGGAGCCCGGTGG - Intronic
950187077 3:10951879-10951901 AAGGGCTGCAGGGCGCTTGCAGG - Intergenic
950449531 3:13057888-13057910 CTGAGCTGCAGGGAGCCTGGGGG - Intronic
950722145 3:14891132-14891154 CAGGGCTCAGAAGAGCCTGCAGG + Intronic
952961975 3:38598067-38598089 CAGGGCTGCTAGGTGACAGCGGG + Intronic
953469928 3:43157982-43158004 GAGGGCTGCCCGCAGCCTGCTGG + Intergenic
953810674 3:46109720-46109742 GTGGGCAGCAAGAAGCCTGCTGG - Intergenic
953885433 3:46712249-46712271 GAGGGCAGCAAGGAGGCTGAGGG + Exonic
954277496 3:49552199-49552221 CAGGGCAGCAAAGACCCTGGAGG + Intergenic
954317392 3:49808512-49808534 CAGGGCTCCAAGAAGAGTGCAGG - Intronic
955070938 3:55572033-55572055 CTGGGCTGCACAGACCCTGCGGG - Intronic
956828924 3:73026613-73026635 CTGGGCTGCATGCAGCCTGCGGG - Intronic
958696273 3:97531355-97531377 CAGGGCAGCAAGGAGACAGAAGG - Intronic
960836245 3:121909732-121909754 CTGGGCTGCATGTGGCCTGCAGG - Intronic
961638562 3:128350212-128350234 CAGGGCACCAGGGAGCGTGCTGG + Intronic
962262883 3:133926259-133926281 CCTGGCTGCCAGGAGCCTGTGGG + Intergenic
962286836 3:134093436-134093458 CAGGGCTCCAAGGTGCCTCTGGG - Intronic
962593817 3:136918592-136918614 CTGGGCTGCATGCAGCCCGCAGG - Intronic
962808200 3:138941469-138941491 TGGGGCTGCAAGGAGCCCCCTGG - Intergenic
963276286 3:143333548-143333570 CAGGTCAGGAAGCAGCCTGCTGG - Intronic
964842315 3:161007559-161007581 CTGGGCTGCATGCAGACTGCAGG - Intronic
966130879 3:176637523-176637545 CTGGGCTGCATGTAGCCTGTTGG - Intergenic
967114207 3:186321988-186322010 AAGGACTGAAAGGTGCCTGCTGG - Intronic
967794521 3:193585043-193585065 CTGGGCCGCATGCAGCCTGCAGG - Intronic
967851154 3:194083598-194083620 CTGGGCAGCAGGGAGCCTCCTGG - Intergenic
967851164 3:194083628-194083650 CTGGGCAGCAGGGAGCCTCCTGG - Intergenic
967851174 3:194083658-194083680 CTGGGCAGCAGGGAGCCTCCTGG - Intergenic
967889684 3:194356403-194356425 CAGGGCTGGAATGAGCCGGCTGG - Intronic
967932280 3:194698754-194698776 CAGGGCTGGAGAGAGGCTGCAGG - Intergenic
968655702 4:1777651-1777673 CAGGGCTGGGAGGAGCCTCCTGG - Intergenic
968664183 4:1811669-1811691 CAGGGCTAGCAGGAGCGTGCTGG - Exonic
968690744 4:1988546-1988568 CGGGGCTGCACGGAGCCTCCCGG + Intronic
968702405 4:2063172-2063194 CTGGGCTGCAGGGAGCCTTCTGG + Intronic
968965071 4:3765695-3765717 CAGGGCCGCCTGCAGCCTGCGGG - Intergenic
969099429 4:4757679-4757701 CAGCGCTGTCAAGAGCCTGCAGG - Intergenic
969217783 4:5735856-5735878 CAGAGCAGGAAGGACCCTGCTGG - Intronic
969509758 4:7611063-7611085 CTGGGCTGCATGGTGGCTGCAGG - Intronic
969569184 4:7998584-7998606 CAGGACTGCGGGGTGCCTGCTGG + Intronic
969929267 4:10614186-10614208 GATGTCTGCATGGAGCCTGCTGG + Intronic
969966529 4:11002675-11002697 CAGTGATGGATGGAGCCTGCTGG + Intergenic
970018596 4:11540816-11540838 CTGGGCTGCATGCAGCCTGTGGG + Intergenic
971174389 4:24266716-24266738 CCAGGCTGCAAAGATCCTGCAGG + Intergenic
972170276 4:36337019-36337041 CAGGGATGCTAGGAACCTGTGGG + Intronic
972859930 4:43155108-43155130 CAGTGCTGCAATGAGCATACAGG + Intergenic
977680982 4:99798329-99798351 CAAGGCTGCAGTGAGCCTGGGGG - Intergenic
979378043 4:119972199-119972221 CTGGGCTGCACGTGGCCTGCAGG + Intergenic
979520939 4:121665790-121665812 CAAGGCTGCAGAGAGCCTGAAGG - Intergenic
979669417 4:123346560-123346582 CAGCTCTGCAAGGAGCCTAACGG + Intergenic
980035740 4:127881053-127881075 CAGCGCTCCAAGCAGCCAGCCGG - Exonic
980339538 4:131526444-131526466 CTGGGCTGCCTGAAGCCTGCGGG + Intergenic
980930802 4:139180697-139180719 CAGGGCCGCATGCAGCCTGCAGG - Intergenic
982693489 4:158573410-158573432 CCGGGCCGCATGCAGCCTGCAGG - Intronic
984723054 4:182994388-182994410 CTGGGCTGCATGAGGCCTGCAGG - Intergenic
985031352 4:185793935-185793957 CAGGCCAGGCAGGAGCCTGCGGG - Intronic
985608527 5:872528-872550 CCTGCCTGGAAGGAGCCTGCAGG + Intronic
985668745 5:1195666-1195688 CAGGGCAGGTAGGACCCTGCTGG + Intergenic
985720997 5:1489022-1489044 CAGAACTGAAAGCAGCCTGCGGG - Intronic
985780716 5:1869468-1869490 CCGGCCTGCCGGGAGCCTGCAGG + Intergenic
985781070 5:1872155-1872177 CAGGGCTGGAGGGAGCCTTAAGG - Intergenic
985802108 5:2011313-2011335 CAGGGTGGCAAGGTGTCTGCAGG - Intergenic
985962638 5:3314358-3314380 GAGGGCTGCAAGGAGGATGAGGG - Intergenic
986212783 5:5689922-5689944 TAGGGCAGGAGGGAGCCTGCAGG + Intergenic
987192681 5:15495149-15495171 CTTGGCTGCCAGGCGCCTGCAGG - Intergenic
988790329 5:34601949-34601971 CTGGGCTGCATGCAGCCTACGGG + Intergenic
989379432 5:40798470-40798492 CAGGGGAGAAAGGAGCCTGGGGG - Intergenic
989398251 5:40981567-40981589 CAGGGCCTCCAGGAGCCTACTGG - Exonic
991200768 5:63988803-63988825 CTGTGCTGCATGCAGCCTGCAGG - Intergenic
991206233 5:64053006-64053028 CCTGGCTGCAACGAGCCTACAGG + Intergenic
992228511 5:74641161-74641183 AAGGGCTGCAAGGGGCGAGCTGG + Exonic
994281085 5:97902860-97902882 CAAGGCTGCAATGAGGCTGGGGG - Intergenic
995191626 5:109324261-109324283 CTGGGCTGCATGCAGCCTGTGGG - Intergenic
996606232 5:125326863-125326885 CTGGGCTGCATGCAGCCTGTGGG - Intergenic
996735594 5:126755578-126755600 CAGAGCAGAATGGAGCCTGCAGG - Intergenic
997422306 5:133779217-133779239 CAGGAGTGGAAGGAGGCTGCGGG - Intergenic
997828307 5:137127408-137127430 CAGGGCTGCCTGGAGCCATCAGG + Intronic
998705879 5:144759626-144759648 CAGTGCTGCAATTAGTCTGCAGG + Intergenic
999126718 5:149251427-149251449 CAGGCCTGCAGGGGGTCTGCAGG + Intronic
999281873 5:150371447-150371469 CAGGGCCGCAAGGGGTCTGATGG + Intronic
999877992 5:155829577-155829599 CAGGCCTCGAAGGAGGCTGCTGG + Intergenic
1001749309 5:174116789-174116811 GAGGGCTGCGAGGAGGCTGGAGG - Intronic
1001926447 5:175640529-175640551 CTGGGGGGCAGGGAGCCTGCTGG + Intergenic
1002159482 5:177306808-177306830 CGGGGCTCCAGGTAGCCTGCAGG + Exonic
1002285541 5:178160401-178160423 AAAGGCTGCAAGGGGACTGCAGG - Intergenic
1002350303 5:178578396-178578418 CTGGTCTGAAAGGAGGCTGCAGG + Intronic
1002457037 5:179351165-179351187 CCTGGCTGCAGGGAGCCTGCAGG - Intergenic
1002604229 5:180372289-180372311 CAGGGCTGCTTTGAGCCTGCTGG + Intergenic
1002643384 5:180641106-180641128 CCGGGCAGGGAGGAGCCTGCTGG - Intronic
1003144444 6:3498132-3498154 AAGGGCCGCAAGGAGCTAGCTGG + Intergenic
1005718979 6:28582169-28582191 CTGGGCTGCAAGTGGCCTGCAGG - Intronic
1006303268 6:33205086-33205108 CAGGGCCGCCAGGTGCCTGCTGG + Exonic
1006796499 6:36735617-36735639 CAGGGCAGCAACGTGCCTGAGGG - Intergenic
1007696875 6:43739816-43739838 CAGGGATGCAAGGAGACACCAGG - Intergenic
1008641442 6:53466590-53466612 CTGGGCTGCATGCAGCCTGCAGG - Intergenic
1010746019 6:79562895-79562917 CTGGGCTGCATGCAGCCTACTGG + Intergenic
1011540780 6:88426133-88426155 CAGGGCTGCTGAGGGCCTGCAGG + Intergenic
1013010863 6:106118572-106118594 CTGGGCTGCATGTGGCCTGCGGG + Intergenic
1013045585 6:106481781-106481803 CTGTGCTGCAAGGACCCTGATGG - Intergenic
1014711985 6:124817154-124817176 CTGGGCTGCATGTAGCCTGTGGG - Intronic
1015681622 6:135814824-135814846 CTGGGCTGCATGTGGCCTGCAGG - Intergenic
1015799263 6:137044459-137044481 CGGGGCTGCAGGGAGCCCGGGGG - Intronic
1016932537 6:149425192-149425214 CGTGGCTGGAAGCAGCCTGCAGG + Intergenic
1017146470 6:151240100-151240122 CAGGGGAGCAAAAAGCCTGCCGG - Intronic
1019114809 6:169751579-169751601 CAGGGCTCCAAAGCGCCTGGAGG + Intergenic
1019413072 7:914994-915016 CCCGGCTGCAGGGAGGCTGCTGG - Intronic
1019511529 7:1419944-1419966 CAGGGTTGCACGGAGCAGGCAGG - Intergenic
1019605074 7:1906101-1906123 CAGTGCTGCCTGGTGCCTGCGGG - Intronic
1019696148 7:2447138-2447160 CTGGGCTGCAGAGAGCCTGAAGG + Intergenic
1019700119 7:2470758-2470780 CAGGGCTGCAAGAGCCCAGCAGG + Intergenic
1019797768 7:3064435-3064457 CAGTCCTGCTAGGAGCCTCCAGG - Intergenic
1020138366 7:5598971-5598993 CAGGGCTGCAGGGAGCCGTCAGG - Intronic
1020276122 7:6625608-6625630 CAGGGCTGGGAGGAGACTCCAGG - Intergenic
1020375379 7:7478881-7478903 CAGGGCTGCCTGGCGCTTGCAGG - Intronic
1020379101 7:7522908-7522930 CTGGGCTGCATGTAGCCTGTGGG + Intronic
1021128423 7:16880910-16880932 CAGGCCTTCTAGAAGCCTGCTGG - Intronic
1023040909 7:36172539-36172561 CTGGGCTGCATGCAGCCTGCAGG - Intronic
1023058584 7:36309242-36309264 CAGGGGAGGAAGGGGCCTGCAGG - Intergenic
1024074600 7:45812076-45812098 CAGGGCCGCACGCAGGCTGCCGG + Intergenic
1024075074 7:45813993-45814015 CAGGGCCGCACGCAGGCTGCCGG + Intergenic
1024636250 7:51292794-51292816 CAGGGCTGCTCGGGGCCTGCAGG - Intronic
1024648520 7:51387348-51387370 CAGGGCCGCACGCAGGCTGCCGG - Intergenic
1025052371 7:55741816-55741838 CAGGACTGCACGCAGGCTGCCGG - Intergenic
1025052762 7:55743364-55743386 CAGGACTGCACGCAGGCTGCCGG - Intergenic
1025129328 7:56367499-56367521 CAGGGCCGCACGCAGGCTGCCGG - Intergenic
1025705377 7:63857955-63857977 CTGGGCTGGAAGGAGACTTCAGG + Intergenic
1026286603 7:68969014-68969036 CATGGCTGCAAGGAGGCTCATGG + Intergenic
1027132279 7:75599414-75599436 CAGCGCTCCCAGGAGCCAGCTGG + Intronic
1028752309 7:94394758-94394780 CACAGCTGGGAGGAGCCTGCGGG - Exonic
1029206199 7:98870421-98870443 CTGCGCTGCAAGCCGCCTGCAGG + Intronic
1029529923 7:101118544-101118566 CAGGCCTGCAGGGTGCCTCCAGG - Intergenic
1029677528 7:102080644-102080666 CAGGGTGGCGAGGAGACTGCTGG - Intronic
1029715283 7:102322160-102322182 CAGGGCAGGAAGAAGCCTGGCGG + Intergenic
1029715293 7:102322197-102322219 CAGGGCAGGAAGAAGCCTGGCGG + Intergenic
1029715303 7:102322234-102322256 CAGGGCAGGAAGAAGCCTGGCGG + Intergenic
1030466106 7:109905842-109905864 CAGGGCGGCAGGGAGGCTGGGGG + Intergenic
1030567621 7:111179292-111179314 CTGGGCTGCATGCAGCCTGTGGG - Intronic
1031334279 7:120507690-120507712 TAGGGCTACTAGGAGCCTGAGGG - Intronic
1031489394 7:122368807-122368829 CATATCTGCATGGAGCCTGCTGG - Intronic
1032757699 7:134906787-134906809 CAGGGCTGCTAGGAGACTATAGG - Intronic
1032965064 7:137086925-137086947 TAGGGCTGTAAGGAGCCTGCAGG + Intergenic
1033239020 7:139661779-139661801 CTGGGCTGCATGCAGCCTGCAGG + Intronic
1033662530 7:143412225-143412247 CTGGGCTGCAGGGACTCTGCAGG - Intergenic
1034324844 7:150220773-150220795 CACCGCTGCAAGGAGCCCACGGG + Intergenic
1034417034 7:150970683-150970705 CAGGGCTGCCAGGTGCGGGCGGG - Intronic
1034768350 7:153748459-153748481 CACCGCTGCAAGGAGCCCACGGG - Intergenic
1034818962 7:154199083-154199105 CAGGGCTCCAAGCAGCCTCGAGG - Intronic
1034881876 7:154768867-154768889 GTGTGCTGCAAGGAGCATGCTGG + Intronic
1035010387 7:155710711-155710733 CAGGGCCACAAAGAGCCTCCAGG - Intronic
1035090671 7:156307518-156307540 CAGCTCAGCAAGGGGCCTGCCGG + Intergenic
1035726902 8:1830343-1830365 CCAGGCTGCCAGGAGCCTCCGGG + Intronic
1035930813 8:3777870-3777892 CTGCGCTTCAAGGAGACTGCGGG - Intronic
1037060113 8:14497451-14497473 CTGGGCTGCATTCAGCCTGCAGG - Intronic
1038973425 8:32663826-32663848 CAGGGATGTAAAGAGACTGCAGG - Intronic
1039476199 8:37840609-37840631 CAGGGATGCAAGGTCCCTGCAGG - Intronic
1040385218 8:46910693-46910715 CTGGGCTGCATGTGGCCTGCAGG + Intergenic
1042669382 8:71245142-71245164 CTGGGCTGCACGCAGCCTGCAGG - Intronic
1044143675 8:88686119-88686141 CAGGGCGGCAACGAGGCTGGGGG + Intergenic
1045259624 8:100560615-100560637 CTTGGCTGCATGCAGCCTGCAGG - Intergenic
1045261407 8:100578077-100578099 CTGGGCTGCATGCAGCCCGCAGG + Intronic
1045300771 8:100908316-100908338 GAAGGCTGAAAGGGGCCTGCAGG - Intergenic
1045336136 8:101205694-101205716 CGGGGCTGCGAGGAGCAGGCGGG - Intronic
1047571058 8:126099093-126099115 GAGGGCTCCAAGGAGACTGCTGG + Intergenic
1047750225 8:127874948-127874970 CTGGGCTGCACTGTGCCTGCTGG + Intergenic
1047752181 8:127890201-127890223 CAGGGCTGAGAGGTCCCTGCAGG - Intergenic
1047842570 8:128768917-128768939 CTGAGCTGCATGCAGCCTGCAGG - Intergenic
1048136402 8:131750559-131750581 CTGGGCTGCATGCAGCCTGTGGG - Intergenic
1048373300 8:133799363-133799385 CAGGGCTGCATGTGGCCTGTGGG + Intergenic
1048783466 8:138025909-138025931 GAGTGCTGCAAGGAGCCTGTGGG - Intergenic
1049298342 8:141855707-141855729 CGGGCCTGCAAGGAGACTGCTGG + Intergenic
1050976085 9:11940368-11940390 CTGGGCTGGATGCAGCCTGCAGG + Intergenic
1053173761 9:35908223-35908245 CAGGGCTGCAGGGAGCAGGCTGG - Intergenic
1053275902 9:36783173-36783195 AAGGGCAGCAGGGAGCCTGAAGG - Intergenic
1053412324 9:37923755-37923777 CTGAGCTGCAAGCAGCCTGGGGG + Intronic
1056790739 9:89623841-89623863 CATGGCTGCAAAGAGCCTGCTGG - Intergenic
1056967539 9:91177754-91177776 CACCGCTGCAAGGAGCTTCCTGG - Intergenic
1057037175 9:91819272-91819294 CAGCTCTGCTAGGAGCCTGGGGG - Intronic
1057215112 9:93223689-93223711 AAGGGCAGGCAGGAGCCTGCTGG + Intronic
1057496104 9:95562703-95562725 CAAGGCTGCAAGGTGCCTTGTGG - Intergenic
1059706216 9:116825967-116825989 CAGGGCAGTAAGGAGCTTCCTGG - Intronic
1060845860 9:126837227-126837249 CAGGGCTGTAGGTTGCCTGCAGG + Exonic
1061238904 9:129357948-129357970 CAGGGCTGGAAGGAGGATTCCGG + Intergenic
1061330680 9:129890377-129890399 CAGGGCCGCAGGGAGCATGCTGG + Exonic
1061486903 9:130924651-130924673 CAGGGGTGGCAGGTGCCTGCTGG - Intronic
1061490520 9:130941441-130941463 CAGGACTGGCATGAGCCTGCAGG + Intergenic
1061568528 9:131460883-131460905 CCCAGCAGCAAGGAGCCTGCTGG - Intronic
1061862470 9:133475156-133475178 CAGGGCAGGATGGCGCCTGCTGG - Intronic
1061892734 9:133631268-133631290 CATGGCTGGCAGGAGCCAGCGGG + Intergenic
1062014932 9:134286631-134286653 CGGGGCTGCAGGAAGCCTGGGGG - Intergenic
1062716748 9:138014428-138014450 CAGGGATGGGAGGGGCCTGCAGG + Intronic
1185691022 X:2155325-2155347 CAGGGATGCCTGGAGCCTCCAGG - Intergenic
1185924072 X:4127276-4127298 CAGGGATGCCTGGAGCCTCCAGG - Intergenic
1185987753 X:4854975-4854997 CTGGGCCGCATGCAGCCTGCAGG - Intergenic
1186469138 X:9807594-9807616 CAGGACTGCATGCTGCCTGCTGG + Intronic
1186485110 X:9928214-9928236 CACTGCTGCTTGGAGCCTGCCGG + Intronic
1186689250 X:11957469-11957491 CAGGGCTCTAAGGATCCTCCTGG - Intergenic
1187669943 X:21657795-21657817 CAGGGCTGGAAGCAGCCTGGTGG + Exonic
1188359825 X:29239633-29239655 CTGGGCTGCATGCAGCCCGCAGG - Intronic
1189255291 X:39633479-39633501 CAATGCAGCAAAGAGCCTGCAGG - Intergenic
1190228430 X:48563109-48563131 CAGGGCAGCAAGGGCCCTGCAGG + Intergenic
1193010038 X:76665994-76666016 CAGGGCTGCAGCGAGACTGGGGG - Intergenic
1195281071 X:103333013-103333035 CAGGCCTGCCAGGAGCCTTCAGG - Intergenic
1195750774 X:108160626-108160648 CAGGGCAGCAAGGCCCCTTCGGG - Exonic
1197342432 X:125289108-125289130 CAGGGCTGCCAGAAGCCTTGGGG + Intergenic
1197739385 X:129877649-129877671 CTGGGCTGCATGTGGCCTGCGGG - Intergenic
1197817967 X:130517789-130517811 CAAGGCGGCAAGGAGGCTGGGGG + Intergenic
1198024289 X:132689798-132689820 CTGGGCTGCATGCAGCCTGCAGG - Intronic
1198592415 X:138198705-138198727 CAAGGCTGCAATGAGGCTGGGGG + Intergenic
1200100528 X:153687617-153687639 CAGGGCTGGGAGGGGCCGGCCGG + Intronic
1200181982 X:154156179-154156201 CAGGGCTGGAAGATGGCTGCTGG + Intronic
1200187631 X:154193293-154193315 CAGGGCTGGAAGATGGCTGCTGG + Intergenic
1200193280 X:154230433-154230455 CAGGGCTGGAAGATGGCTGCTGG + Intronic
1200199035 X:154268237-154268259 CAGGGCTGGAAGATGGCTGCTGG + Intronic
1202161547 Y:21940446-21940468 CAGGGTTGCGGGGAGCCAGCTGG + Intergenic
1202229809 Y:22645927-22645949 CAGGGTTGCGGGGAGCCAGCTGG - Intergenic
1202313347 Y:23550238-23550260 CAGGGTTGCGGGGAGCCAGCTGG + Intergenic
1202557456 Y:26120357-26120379 CAGGGTTGCGGGGAGCCAGCTGG - Intergenic