ID: 1142032102

View in Genome Browser
Species Human (GRCh38)
Location 16:87843753-87843775
Sequence GGGGGTGTCCCGTGCATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142032102_1142032106 -3 Left 1142032102 16:87843753-87843775 CCTGCAATGCACGGGACACCCCC No data
Right 1142032106 16:87843773-87843795 CCCACACAACAGAGAGCCCACGG 0: 1
1: 0
2: 1
3: 21
4: 223
1142032102_1142032111 13 Left 1142032102 16:87843753-87843775 CCTGCAATGCACGGGACACCCCC No data
Right 1142032111 16:87843789-87843811 CCCACGGTGGCAGAGGTGCCAGG 0: 1
1: 0
2: 1
3: 28
4: 256
1142032102_1142032109 6 Left 1142032102 16:87843753-87843775 CCTGCAATGCACGGGACACCCCC No data
Right 1142032109 16:87843782-87843804 CAGAGAGCCCACGGTGGCAGAGG 0: 1
1: 0
2: 2
3: 33
4: 303
1142032102_1142032108 0 Left 1142032102 16:87843753-87843775 CCTGCAATGCACGGGACACCCCC No data
Right 1142032108 16:87843776-87843798 ACACAACAGAGAGCCCACGGTGG 0: 1
1: 0
2: 1
3: 12
4: 132
1142032102_1142032113 19 Left 1142032102 16:87843753-87843775 CCTGCAATGCACGGGACACCCCC No data
Right 1142032113 16:87843795-87843817 GTGGCAGAGGTGCCAGGCTGAGG 0: 1
1: 0
2: 8
3: 56
4: 574

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142032102 Original CRISPR GGGGGTGTCCCGTGCATTGC AGG (reversed) Intronic
No off target data available for this crispr