ID: 1142032106

View in Genome Browser
Species Human (GRCh38)
Location 16:87843773-87843795
Sequence CCCACACAACAGAGAGCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 223}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142032099_1142032106 17 Left 1142032099 16:87843733-87843755 CCGGGGATGCTGCTGGATGTCCT 0: 1
1: 8
2: 44
3: 191
4: 737
Right 1142032106 16:87843773-87843795 CCCACACAACAGAGAGCCCACGG 0: 1
1: 0
2: 1
3: 21
4: 223
1142032102_1142032106 -3 Left 1142032102 16:87843753-87843775 CCTGCAATGCACGGGACACCCCC No data
Right 1142032106 16:87843773-87843795 CCCACACAACAGAGAGCCCACGG 0: 1
1: 0
2: 1
3: 21
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142032106 Original CRISPR CCCACACAACAGAGAGCCCA CGG Intronic
900578727 1:3397061-3397083 CCCACCCCACAGAGAGCTCTGGG - Intronic
900910923 1:5596560-5596582 CCCACACCACATTCAGCCCAGGG + Intergenic
900946010 1:5831846-5831868 CCAACACAACACAGAGAACACGG + Intergenic
900953850 1:5874905-5874927 CCCCCACAACACACAGCACACGG - Exonic
900994921 1:6115821-6115843 CCCACACAACTGTGAGCTCATGG + Intronic
902512944 1:16976063-16976085 CCCACACGAGAGTGAGCACACGG + Intronic
903319323 1:22532751-22532773 CCCTCGGAAGAGAGAGCCCAAGG - Intergenic
908783126 1:67709634-67709656 CCCACCCAAAAGAGAGGCCTAGG + Intronic
909132459 1:71754919-71754941 GACAGACAGCAGAGAGCCCAAGG - Intronic
910503304 1:87919348-87919370 CCCACCCAACAGTGAGCCGATGG + Intergenic
910908520 1:92209047-92209069 TCCACAGAAAACAGAGCCCAAGG + Intergenic
911517971 1:98891560-98891582 CCCACTCAGCAGAGTGCCCAAGG - Exonic
915749134 1:158188147-158188169 CCTAAGCAACAGAGACCCCAGGG - Intergenic
916082855 1:161246560-161246582 CCTACACAACATAGAGCTTATGG - Intergenic
916495020 1:165339009-165339031 TCCACACCTCAGAGAGCTCAAGG + Intronic
916783098 1:168057656-168057678 CCCACTGAACTGAGAGCTCAAGG - Intronic
917534197 1:175862900-175862922 CCACCACACCAGAGAGGCCAAGG + Intergenic
919647909 1:200114425-200114447 CACACACACCAGAGAGCACATGG - Intronic
921419000 1:214924274-214924296 CCCACACAAGGGAGTGCCCGAGG - Intergenic
922789984 1:228306089-228306111 GCCACACACCCCAGAGCCCAGGG - Intronic
922982425 1:229838816-229838838 CCCCCACATCTGAGAGCCAATGG - Intergenic
924612587 1:245586461-245586483 CCCAGACAACAGAGGGCCACTGG - Intronic
924633376 1:245763044-245763066 GCCAGACAGCAGAGAGCCCTGGG + Intronic
1063090476 10:2861965-2861987 CCCTCTCAACAAAGAACCCATGG + Intergenic
1063475730 10:6327430-6327452 GCCTCACCACAGGGAGCCCATGG + Intergenic
1063593532 10:7412744-7412766 CCCACAGGGCAGAGAGCCCAGGG - Intergenic
1064296640 10:14084739-14084761 CCCATATAACCCAGAGCCCACGG + Intronic
1065728039 10:28685082-28685104 CCCAGAAAACTGAGAGGCCATGG - Intergenic
1067197383 10:44133769-44133791 TCCACACAACAAAGAAACCATGG - Intergenic
1069577981 10:69544370-69544392 CCTCCACCCCAGAGAGCCCAAGG - Intergenic
1069949998 10:72012162-72012184 CCCACAGAACAGAGGGCACCAGG + Exonic
1071278564 10:84078545-84078567 CCCACACAAGAAAAAGCCTAGGG - Intergenic
1071432545 10:85617804-85617826 ACCTCCCAACAGAGACCCCATGG - Intronic
1072369663 10:94752377-94752399 CCCACAGAACAGGAAGCTCAGGG + Intronic
1072385463 10:94921519-94921541 CCCACAGAACAGGAAGCTCAGGG + Intergenic
1072693522 10:97586872-97586894 CCCACACACCAGAGAGCCAGCGG + Intronic
1072740713 10:97907456-97907478 CCCACACAAAATAGTGCCCCAGG - Intronic
1073351918 10:102825948-102825970 CTGACACCACAGTGAGCCCAAGG + Intergenic
1073821616 10:107270907-107270929 CCCTCATAAAAGAGACCCCAGGG - Intergenic
1074436703 10:113440437-113440459 TCCTCAGAACAGGGAGCCCAGGG - Intergenic
1076549612 10:131269930-131269952 CGCAACCCACAGAGAGCCCACGG + Intronic
1076673151 10:132134049-132134071 CCCACACGACAGAGCGGCCCAGG - Intronic
1076827005 10:132974142-132974164 CCCACAGGAGCGAGAGCCCAGGG - Intergenic
1077542521 11:3153997-3154019 CACACACAGCAGGGAGCCCCAGG + Intronic
1078405969 11:11070194-11070216 CCCACACTGCAAAGAGCCCTGGG + Intergenic
1079030456 11:16982498-16982520 CCCACTCTACAGAGATCTCAAGG + Intronic
1079305570 11:19318476-19318498 CCCACAAAACTGTGATCCCAAGG - Intergenic
1080167794 11:29261215-29261237 CCCACAGAACAGGAAGCTCAGGG - Intergenic
1082288114 11:50338468-50338490 CCCTCATAAAAGAGACCCCAGGG + Intergenic
1083047385 11:59749076-59749098 CCCCAACAGCAGAGACCCCAGGG - Intronic
1083634891 11:64115446-64115468 CCCACACAACTCGGAACCCAGGG + Intronic
1085085370 11:73663059-73663081 CTCAGACAACAGAGACTCCAAGG - Intergenic
1085658464 11:78339537-78339559 CCCACACAACACTGAGCTGATGG + Intronic
1087331496 11:96786718-96786740 CCCACACAAATGAGAGGACAGGG + Intergenic
1089068398 11:115679565-115679587 CTGACACAACAGGGAGCTCAAGG + Intergenic
1091205371 11:133817487-133817509 CTTCAACAACAGAGAGCCCAGGG + Intergenic
1091456595 12:612648-612670 ACCACACAACAGGGAGATCAGGG - Intronic
1092168774 12:6360301-6360323 CCCCCTCAACAGAAAGTCCATGG - Intronic
1096150083 12:49304103-49304125 CTCACATAACAGAGAGCCAGAGG + Intergenic
1096253947 12:50051561-50051583 CCCCCAAAACAGAGAAACCAGGG + Intergenic
1096672923 12:53210946-53210968 CCTACACTACAGAGGGGCCAGGG - Exonic
1099434145 12:82623518-82623540 CCAACCCAGCAGAGAGCCCTGGG - Intergenic
1103020164 12:117527360-117527382 CACACACAACACAGTGCGCAAGG + Intronic
1104418961 12:128619490-128619512 TCCAAACAAAAGAGTGCCCAGGG - Intronic
1107774428 13:43823065-43823087 CCAACACATCTCAGAGCCCAAGG + Intergenic
1112357943 13:98690442-98690464 CCCACACAAAAGAGAGCATGTGG + Intronic
1113374383 13:109750633-109750655 CTCACACAACAGGAAGCCCAGGG - Intergenic
1114675679 14:24438802-24438824 CCCACACAGAACAGAACCCAGGG - Exonic
1116627570 14:47285192-47285214 GGCACAAAACAGAAAGCCCAAGG - Intronic
1117279537 14:54224506-54224528 CCCACACTACAGGCAGCACAGGG - Intergenic
1118913504 14:70081555-70081577 CCCACATAGCCTAGAGCCCAGGG - Intronic
1119558535 14:75571660-75571682 GCCACACCTCACAGAGCCCATGG - Intergenic
1122116086 14:99527935-99527957 CTCACACCACGGAGAGCCCTCGG + Intronic
1122127787 14:99588434-99588456 CCCAGAGAAAAGAGAGCCCACGG + Intronic
1122193758 14:100068946-100068968 CAAAGACAACAGAGAGACCAGGG - Intronic
1122381864 14:101313574-101313596 TCCACAGGAGAGAGAGCCCAGGG - Intergenic
1123035305 14:105469538-105469560 CCAACACCCCAGAGAGCTCATGG - Intronic
1125523635 15:40361961-40361983 GCTACAGAACAGAGTGCCCAGGG - Intronic
1126883851 15:53128840-53128862 CCCACACAACGGATAGGTCAGGG + Intergenic
1128260522 15:66229733-66229755 CCCAGACAACAGAGAGAGCTGGG + Intronic
1128343238 15:66837185-66837207 CTCAGACTACAGAGAGCCCAGGG + Intergenic
1132409662 15:101567371-101567393 CCCAGACAACAGAGTGCCCGCGG + Intergenic
1132748813 16:1447933-1447955 CGCGCACAGCAGAGAGCCAAGGG + Intronic
1133293677 16:4739131-4739153 CCCACACAAGAGAGATCCCCAGG + Intronic
1133754672 16:8753465-8753487 CCCACAGCATAGAAAGCCCAAGG + Intronic
1135082263 16:19446173-19446195 CACAGACATCAGATAGCCCAGGG + Intronic
1136086574 16:27889678-27889700 CCCACACTACAAAGCCCCCATGG + Intronic
1136163775 16:28438926-28438948 CCCTCACAAAACACAGCCCAAGG - Intergenic
1136199188 16:28676057-28676079 CCCTCACAAAACACAGCCCAAGG + Intergenic
1136215534 16:28790227-28790249 CCCTCACAAAACACAGCCCAAGG + Intergenic
1136260259 16:29070073-29070095 CCCTCACAAAACACAGCCCAAGG + Intergenic
1138629838 16:58284726-58284748 ACCATGCAACAGAGAGCCCAGGG + Intronic
1139911281 16:70399007-70399029 CAATCACAACAGAGAGCACAGGG + Exonic
1141952327 16:87346933-87346955 CCCTCAGACCAGAGAGTCCAAGG + Intronic
1142032106 16:87843773-87843795 CCCACACAACAGAGAGCCCACGG + Intronic
1142407274 16:89897430-89897452 CCCACACTGCAGACAACCCAGGG - Intronic
1142914698 17:3126793-3126815 CCCAAAGAAGAGAGAGACCACGG + Exonic
1146053480 17:29569334-29569356 CCTACACACGAGTGAGCCCAGGG + Exonic
1146380436 17:32323498-32323520 CCCACACCACAGAATCCCCAGGG - Exonic
1148583139 17:48757433-48757455 CCCACACCAGCCAGAGCCCACGG + Intergenic
1151146871 17:72049388-72049410 CCAACACAGCAGAGAAGCCACGG + Intergenic
1151823731 17:76512150-76512172 CCCAGGGAACAGAAAGCCCAGGG - Intergenic
1152088117 17:78232384-78232406 CCCCCAAAACTGACAGCCCAAGG + Intronic
1153768318 18:8395749-8395771 CCCACCCTACGGGGAGCCCATGG + Intronic
1155235131 18:23811217-23811239 TGCACACACCAGGGAGCCCAGGG - Intronic
1156917250 18:42476355-42476377 CACACACACCTGAGATCCCAGGG - Intergenic
1158149778 18:54355495-54355517 CCCTCACAAAAGAGACCCCAGGG + Intronic
1158346466 18:56521419-56521441 GCCACAGAACTGAGAGCCTAGGG + Intergenic
1161419989 19:4171438-4171460 CCAACAAAACCGAGAGCCCTGGG + Exonic
1163085659 19:14978064-14978086 CCTAGAAAAGAGAGAGCCCAGGG - Intronic
1164144758 19:22505164-22505186 CCCTCACAACATGGAGCCCAGGG + Intronic
1165059570 19:33198526-33198548 CCCACACAGCAGGAATCCCAGGG - Intronic
1166895248 19:46018509-46018531 CTCACACACCTGAGACCCCAGGG - Exonic
925050124 2:806998-807020 CCCATGCAACAGAGAGGTCACGG + Intergenic
925332984 2:3073213-3073235 CCCACACAACAGACAGGAAAAGG + Intergenic
926692964 2:15749899-15749921 CAGAGACACCAGAGAGCCCAGGG + Intergenic
927888266 2:26731625-26731647 CCCACAGGCCAGCGAGCCCATGG - Exonic
928028173 2:27756544-27756566 CCTGCACAACAGAGAGCTAAAGG - Intergenic
928434757 2:31247660-31247682 CCCCCACAGAATAGAGCCCAAGG - Intronic
928620434 2:33082964-33082986 CCCACACAGCAAAGAGCCCAAGG - Intronic
928938805 2:36707194-36707216 CTCACATAACAGACAGTCCAGGG + Intronic
930058108 2:47267555-47267577 ACCACACAACAGAACTCCCAGGG + Intergenic
931249637 2:60518615-60518637 ACCACACACCAGAGAGGGCATGG + Intronic
931708157 2:64965045-64965067 CCCACAGAACACAGAACACAGGG + Intergenic
933260426 2:80125867-80125889 CCCACATGATAGAAAGCCCAGGG + Intronic
933813069 2:86045055-86045077 CCCTCAGAACACAGAGCCCTTGG + Intronic
935333352 2:101993830-101993852 CTCACACAAGAGAGAACTCAGGG - Intronic
936516087 2:113182536-113182558 CCCACCCAGGAGAGTGCCCAAGG + Exonic
937228826 2:120385011-120385033 CCCAAACCACAGGGTGCCCAAGG - Intergenic
938071354 2:128310146-128310168 CCCACCCAACACACAGCCCAGGG + Intronic
943189907 2:184663186-184663208 CCCAGGCACCAGAGAGCACAGGG - Intronic
945192017 2:207198444-207198466 CCCACTCAACAAAGAGCTCCAGG - Intergenic
946114250 2:217447579-217447601 CCCACAGCACAGATGGCCCATGG + Intronic
947628322 2:231635110-231635132 CCCACACACCTCAGAGCACAAGG + Intergenic
948050975 2:234979071-234979093 CCCACAGAACAGTGAGGACAGGG - Intronic
948112923 2:235471471-235471493 GCCTCAAAACAGAGAGCCCCTGG - Intergenic
1169247570 20:4035572-4035594 CCCACAAAACAGTTGGCCCATGG + Intergenic
1170626092 20:18031145-18031167 CCCACACGACTGTGAGTCCAAGG + Intronic
1171968914 20:31551217-31551239 CTCACACTACAGCAAGCCCAGGG + Intronic
1172715615 20:36961264-36961286 CACACACCAAAGAGAGGCCATGG + Intergenic
1174524155 20:51157939-51157961 CCCACACAGCAGAGAGTGCTTGG + Intergenic
1174987624 20:55473090-55473112 CCCACATAACAAGAAGCCCAGGG - Intergenic
1175750248 20:61491613-61491635 CCAAAACAACAGAGAGACAATGG - Intronic
1176114286 20:63424354-63424376 CACCCACCCCAGAGAGCCCACGG + Intronic
1177244891 21:18510465-18510487 TGCACACAGCAGAGAGGCCATGG - Intergenic
1178127770 21:29534027-29534049 CCCCAACATCAGAGAGGCCATGG - Intronic
1179495630 21:41769644-41769666 CCCACCCAGCAGGCAGCCCAAGG + Intergenic
1179630904 21:42678169-42678191 CCGACTCAACACAGAGCCCTGGG + Intronic
1179961435 21:44769089-44769111 ACCACACAACAGGGACACCATGG + Exonic
1181004161 22:20001986-20002008 GCCACAGAAGACAGAGCCCAGGG + Intronic
1183148661 22:36019157-36019179 CCCTCCCAACAGAGATCCCACGG + Intronic
1184723038 22:46326585-46326607 CACACACAGGGGAGAGCCCACGG - Exonic
1185020665 22:48372862-48372884 CCGTCACACCACAGAGCCCATGG - Intergenic
1185046256 22:48530048-48530070 CCCACAAAGCAGAGGGCCCACGG - Intronic
1185187924 22:49413969-49413991 CCCACACAGCAGAAAGACCAAGG - Intergenic
1185325283 22:50222598-50222620 GCCACACACCAGAGAGGACACGG + Intronic
949945260 3:9184949-9184971 CCAATACAACAGCCAGCCCAGGG - Intronic
950535439 3:13575651-13575673 CCCAGACCACAGAGAGGCCTCGG + Intronic
951855051 3:27186853-27186875 TCCACACCACACACAGCCCATGG - Intronic
952918451 3:38267325-38267347 CCCACACCACAGGGAGCTCTAGG + Intronic
954748537 3:52800761-52800783 CCCAGACCACAGGGAACCCAGGG - Intronic
955363976 3:58296369-58296391 GGCACACACCATAGAGCCCAGGG - Intergenic
955409939 3:58648977-58648999 CCCACACAGCTGGGAGCCCGAGG - Intronic
958973085 3:100635097-100635119 GCCTCACAACACAGAGCCCTGGG + Intronic
961737565 3:129011675-129011697 CCACCTCGACAGAGAGCCCACGG - Intronic
962689343 3:137878102-137878124 TGCACACAACAGAGAGACCCTGG - Intergenic
964623500 3:158737810-158737832 CCACCACAAAAGAGAGCCAATGG - Intronic
967176694 3:186867075-186867097 CCCACAAAACAGTTGGCCCATGG + Intergenic
968456125 4:700903-700925 CCCACACACCAGAGTCCACAGGG - Intergenic
968485587 4:859462-859484 CCCAGAGCACAGTGAGCCCAAGG - Intronic
968548310 4:1209872-1209894 CTCACACCACAGACAGCCCTTGG + Intergenic
968702116 4:2062147-2062169 CCCTCACACCAGGGAGGCCACGG - Intronic
968770369 4:2501774-2501796 CCCCAACACCAGTGAGCCCAGGG - Intronic
969392526 4:6901121-6901143 CCCACACAACAGGGAGCGGGTGG - Intergenic
969507379 4:7596727-7596749 CTCAGAGAACAGAGAGCCCTGGG - Intronic
969582308 4:8072419-8072441 CCCCCACACCAGAGAGGCCCTGG - Intronic
970375944 4:15457141-15457163 CACTCCCAACACAGAGCCCAGGG + Intergenic
970855116 4:20642220-20642242 CCCACACAAAGGAGAACCTATGG - Intergenic
971900874 4:32656829-32656851 CACAGGCAACAAAGAGCCCAAGG - Intergenic
972075371 4:35079915-35079937 CCCACAGAGCAGTGAGCCGAGGG - Intergenic
976950513 4:90823643-90823665 CCCCCAAAATAGAGAGCTCACGG - Intronic
982071692 4:151701224-151701246 CCCACCCCACTCAGAGCCCATGG + Intronic
982200802 4:152958088-152958110 CCCACCCAACAGAAGACCCATGG - Intronic
986065142 5:4227968-4227990 CGGAAACCACAGAGAGCCCATGG - Intergenic
990284735 5:54289928-54289950 CCCACACACCAGGAAGCCCCAGG + Intronic
992830383 5:80588024-80588046 TTCACATAACAGAGAGTCCAGGG + Intergenic
993315968 5:86406633-86406655 CCCACACAACAAAGAATCCATGG + Intergenic
995641453 5:114261857-114261879 ACCAATCAAGAGAGAGCCCAGGG + Intergenic
995780295 5:115768015-115768037 GCCACACATGAGACAGCCCAGGG + Intergenic
998139516 5:139692005-139692027 ACCACACTGGAGAGAGCCCAGGG + Intergenic
999101616 5:149030110-149030132 CCTCCACATCAGAGAGGCCAGGG - Intronic
1000109095 5:158090079-158090101 CTTACACAAGAAAGAGCCCAGGG - Intergenic
1003643643 6:7896633-7896655 CCCACACAAAACAATGCCCAAGG + Intronic
1007110443 6:39310516-39310538 CCCACCCAACACTGAGCCCCGGG - Intronic
1007901951 6:45421601-45421623 CCGAGACACCAGAGAGCCCCCGG - Intronic
1011304781 6:85914109-85914131 CCCCCACAGCCTAGAGCCCAGGG + Intergenic
1014921847 6:127222789-127222811 CTCAGACAAAAGAGAGACCATGG + Intergenic
1015774565 6:136800650-136800672 CCTCCAAAACATAGAGCCCAAGG - Intergenic
1016428842 6:143962149-143962171 ACAATGCAACAGAGAGCCCAAGG + Intronic
1017333222 6:153223979-153224001 CACACACAGAAGAGAGGCCATGG + Intergenic
1017492960 6:154960136-154960158 CCCCCCCATCAGCGAGCCCAGGG + Intronic
1017829557 6:158113838-158113860 CCCACACACCAGACTGCCCTGGG - Intronic
1019118715 6:169786266-169786288 TCCACACAACCTAGAGCTCAGGG - Intergenic
1019609459 7:1929633-1929655 CCCACACCAGAGACAGCCCTTGG + Intronic
1021175002 7:17440189-17440211 CTCACACAGCAGGGAGGCCATGG + Intergenic
1024763411 7:52628321-52628343 CCCAGCCAACAGGGGGCCCATGG + Intergenic
1025853785 7:65261730-65261752 CCCACAAAACAGTTGGCCCATGG + Intergenic
1028558679 7:92149572-92149594 GACACACAACAGAGAGCTCAAGG + Intronic
1029362556 7:100098031-100098053 CCCAAACAAAACAGAACCCAGGG - Intronic
1029546255 7:101212061-101212083 CCCAGACAGCAGAGAGCCTGGGG - Intronic
1029983538 7:104901375-104901397 ACCACGCAACAGAAACCCCAGGG - Intronic
1032078705 7:128848216-128848238 GCCTCACAGCAGAGAGCCCCGGG - Intronic
1033853974 7:145534427-145534449 CCCATTCTACAGAGTGCCCAGGG - Intergenic
1035006441 7:155665353-155665375 CCCACTCAAGAGAGAGCGCCAGG - Intronic
1035066132 7:156106187-156106209 CCCTCACACCAGGGAGCCCCAGG - Intergenic
1035275967 7:157748112-157748134 CCCAGACACCAGACAGCTCAGGG - Intronic
1035422460 7:158741136-158741158 CTCACACAACGGGGAGGCCAGGG + Intronic
1035625034 8:1065051-1065073 CCCACCAAACAGCGTGCCCAGGG + Intergenic
1037118692 8:15256981-15257003 CACACACAACAGACACCCCAGGG - Intergenic
1038769564 8:30464639-30464661 CCCAGACAACACAGAGTTCATGG - Intronic
1040717238 8:50271936-50271958 CCCTCATAAAAGAGACCCCAGGG + Intronic
1042575762 8:70217195-70217217 CACCCACAACAGACAGCCCGGGG + Intronic
1045188788 8:99863503-99863525 GCCACACACCAGCCAGCCCAGGG - Intronic
1048493107 8:134912909-134912931 GCCACAGAACACAGAGCTCAAGG + Intergenic
1049357040 8:142194043-142194065 ACCAGACCACAGAGGGCCCAAGG - Intergenic
1049649752 8:143760195-143760217 CCTGCACACCTGAGAGCCCAGGG + Intergenic
1049658472 8:143809258-143809280 GCCTCACACCAGGGAGCCCACGG + Intronic
1050291265 9:4157455-4157477 CCCACCCCAAAGAGAGACCAAGG - Intronic
1057026780 9:91740133-91740155 CCCACAGGACAGAGAGAGCAAGG + Intronic
1060113845 9:120925957-120925979 CCTGCACAGCAGAGAGCCCTGGG + Exonic
1060525121 9:124316075-124316097 CCCACTCCACAGGTAGCCCATGG + Intronic
1061664244 9:132151201-132151223 CCCACCCTATAGACAGCCCAGGG - Intergenic
1062340898 9:136093686-136093708 ACCACCCAACAGTGACCCCAGGG + Intronic
1186754607 X:12657376-12657398 CCCACACAGCAAAGAACCAAGGG - Intronic
1188869700 X:35359079-35359101 CCCACTGGACAGAGACCCCAGGG - Intergenic
1189356723 X:40315280-40315302 CCCACACTGCAGAAAGGCCAGGG + Intergenic
1190516007 X:51224101-51224123 CCCACACACCCTAGAACCCAAGG + Intergenic
1190766131 X:53477288-53477310 CTCACAGAACAAAGAGACCAGGG + Intergenic
1191062821 X:56317966-56317988 CCCCCACAACCCAGACCCCATGG + Intergenic
1191205853 X:57833604-57833626 GCCACAAAACAGAGAGCCACAGG + Intergenic
1192167194 X:68833444-68833466 ATGAGACAACAGAGAGCCCAAGG - Intronic
1197202091 X:123757223-123757245 CACAGACAATACAGAGCCCATGG - Intergenic
1199387259 X:147237342-147237364 CCAAAACAACAGAGAGAACAAGG + Intergenic
1199798439 X:151226307-151226329 CCCACTCATCAGAGAGCCTTGGG - Intergenic
1200101551 X:153691146-153691168 CTCACACAAGGGGGAGCCCAGGG + Intronic
1202045593 Y:20734666-20734688 TACACAGAACACAGAGCCCAGGG + Intergenic