ID: 1142032111

View in Genome Browser
Species Human (GRCh38)
Location 16:87843789-87843811
Sequence CCCACGGTGGCAGAGGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 256}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142032104_1142032111 -6 Left 1142032104 16:87843772-87843794 CCCCACACAACAGAGAGCCCACG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1142032111 16:87843789-87843811 CCCACGGTGGCAGAGGTGCCAGG 0: 1
1: 0
2: 1
3: 28
4: 256
1142032105_1142032111 -7 Left 1142032105 16:87843773-87843795 CCCACACAACAGAGAGCCCACGG 0: 1
1: 0
2: 0
3: 11
4: 100
Right 1142032111 16:87843789-87843811 CCCACGGTGGCAGAGGTGCCAGG 0: 1
1: 0
2: 1
3: 28
4: 256
1142032102_1142032111 13 Left 1142032102 16:87843753-87843775 CCTGCAATGCACGGGACACCCCC No data
Right 1142032111 16:87843789-87843811 CCCACGGTGGCAGAGGTGCCAGG 0: 1
1: 0
2: 1
3: 28
4: 256
1142032103_1142032111 -5 Left 1142032103 16:87843771-87843793 CCCCCACACAACAGAGAGCCCAC No data
Right 1142032111 16:87843789-87843811 CCCACGGTGGCAGAGGTGCCAGG 0: 1
1: 0
2: 1
3: 28
4: 256
1142032107_1142032111 -8 Left 1142032107 16:87843774-87843796 CCACACAACAGAGAGCCCACGGT 0: 1
1: 0
2: 0
3: 9
4: 96
Right 1142032111 16:87843789-87843811 CCCACGGTGGCAGAGGTGCCAGG 0: 1
1: 0
2: 1
3: 28
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142032111 Original CRISPR CCCACGGTGGCAGAGGTGCC AGG Intronic
900125764 1:1068404-1068426 CCCCAGGTGGCTCAGGTGCCTGG - Intergenic
900145733 1:1158015-1158037 GCCCCGGTGGCCGAGGAGCCAGG + Intergenic
900204630 1:1426755-1426777 CCCACGCTGGCAGGAGGGCCTGG - Intronic
900399058 1:2465534-2465556 ACCATGGTGGCAGGGGAGCCAGG - Intronic
900525032 1:3124411-3124433 GCCACGGGAGCAGAGGTTCCTGG - Intronic
900957155 1:5893042-5893064 CCCACGGTGGCAGGGGTGTGGGG + Intronic
901066325 1:6496445-6496467 CCCTCGGGGGCAGAGGGGCCAGG - Intronic
901444167 1:9297217-9297239 CCAAGGGTGGCAGAGGTTCTTGG - Intronic
902375350 1:16027726-16027748 CCCAGGGTGGAGGGGGTGCCAGG - Intronic
902380314 1:16049523-16049545 CCCAGGGTGGAGGGGGTGCCAGG - Intronic
902511119 1:16967560-16967582 GGCAGGGTGGCAGAGGGGCCAGG + Intronic
903528122 1:24008427-24008449 CCTGCGGTGGCAGCTGTGCCTGG + Intergenic
904771220 1:32882433-32882455 CCTAGGGCGGCAGAGCTGCCAGG - Intergenic
905343007 1:37292145-37292167 CCCACCATCGCAGAGGAGCCCGG + Intergenic
905475256 1:38221888-38221910 ATGGCGGTGGCAGAGGTGCCTGG - Intergenic
906058885 1:42935711-42935733 CCCCAGAGGGCAGAGGTGCCAGG + Intronic
906306634 1:44724067-44724089 TCCTCGGTGGCGGAGGGGCCTGG + Intronic
906380828 1:45331423-45331445 CCCAAGGTGCCGGAGGTGCGTGG + Exonic
907880550 1:58546276-58546298 TCCCCTCTGGCAGAGGTGCCGGG + Intronic
907954737 1:59217328-59217350 CCCACCATGGCAGAGTGGCCTGG - Intergenic
908515772 1:64891510-64891532 CACACTGTGGCAGTGGTGCCAGG - Intronic
908831350 1:68181703-68181725 CCCACGGTGGCACAGCTGGCTGG - Intronic
909533970 1:76712975-76712997 CCCAGGGTGAAAGAGGAGCCAGG + Intergenic
912522550 1:110255767-110255789 CAAACGATGGCAGAGGTCCCTGG + Intronic
915100980 1:153499931-153499953 CCCCCGGAAGCAGAGGTGCTGGG - Intergenic
915333995 1:155130067-155130089 CCCAGGGTGGGGGAGGGGCCTGG + Intronic
915797483 1:158752234-158752256 CCCAGGAGCGCAGAGGTGCCTGG + Intergenic
915815503 1:158961672-158961694 CCCAGGGTGGCAAAGGTCCGTGG - Intronic
920528187 1:206684186-206684208 CCCACGGAGAGAGAGGTGCAAGG + Intronic
922674039 1:227540343-227540365 ACCAAGCTGGGAGAGGTGCCTGG + Intergenic
922727323 1:227928499-227928521 CCCAGGGTGGGAGAGGTGAGGGG - Intronic
923738258 1:236632328-236632350 GCCACCTTGGCTGAGGTGCCAGG + Intergenic
1063367162 10:5498594-5498616 CCTGCGGTGGCAGAACTGCCTGG - Intergenic
1065529929 10:26658713-26658735 CCCAAGGTGGCAGTGGTGGGAGG - Intergenic
1066313317 10:34219241-34219263 CCAACTGTGGCAGAGGGGCCTGG + Intronic
1067752721 10:48982617-48982639 CTGAGGGTGGCAGAGGTGACTGG + Exonic
1067830975 10:49610821-49610843 GCCCCGGCGGCAGAGGCGCCTGG + Exonic
1069640283 10:69950485-69950507 CCCACTCTGGCAGATTTGCCCGG + Intronic
1069710883 10:70487874-70487896 CCCAAGGTGGGAGTGGTGACCGG - Intronic
1070254803 10:74804835-74804857 CCCAGGGAGGCAGAGGTGGGTGG + Intergenic
1075266770 10:121007272-121007294 GCCAGGGTGGCAGAGGTCTCAGG + Intergenic
1075721601 10:124590731-124590753 CCCTCGGTGGCAGAGGAGGCAGG - Intronic
1077230466 11:1456215-1456237 CTCACGGAAGCAGAGGTGCCTGG + Intronic
1077274008 11:1694931-1694953 CCCACGCTGCCATAGTTGCCAGG + Intergenic
1077484401 11:2832188-2832210 CCCACTGTGCCTGAGGGGCCAGG - Intronic
1078102770 11:8339588-8339610 CGCTCGGCGGCAGAGGCGCCCGG + Intergenic
1078567504 11:12429222-12429244 CCCAGGGAGGCAGAGGTGGGAGG - Intronic
1081650053 11:44817882-44817904 ACCACACTGGCAGAAGTGCCTGG - Intronic
1083720860 11:64602892-64602914 CCCAGGGTGGCTCAGGTGACTGG - Intergenic
1083970127 11:66069823-66069845 CCCGCGGTGGCAGCGGGCCCCGG + Intergenic
1084568637 11:69945837-69945859 GCCACGGGGGCAGAGGTGGGAGG + Intergenic
1085470779 11:76756496-76756518 GCCACGCAGGCAGAGCTGCCAGG - Intergenic
1089376570 11:117999183-117999205 CCCCCGGAGCCTGAGGTGCCTGG + Exonic
1090036256 11:123252241-123252263 CCCAGAGTGGGAGAGGAGCCTGG + Intergenic
1092245023 12:6859253-6859275 CGCTCGGCGGCAGAGGAGCCGGG - Intronic
1092262568 12:6960337-6960359 CCCACAGTCGCAGAAGGGCCAGG + Exonic
1092733750 12:11559284-11559306 CCTACAGTGGCAGAAGTGTCAGG + Intergenic
1094499580 12:31010046-31010068 CTTACGGAGGCAGAAGTGCCTGG - Intergenic
1102207808 12:111102316-111102338 CCCTCGGAGGGAGAGCTGCCAGG - Intronic
1102885231 12:116516842-116516864 CGCACGGTGGACGAGGAGCCAGG + Intergenic
1102978412 12:117222911-117222933 TGCAGGGTGGCTGAGGTGCCAGG + Intronic
1103604973 12:122079416-122079438 CCCGCGTTGCCAGAGGAGCCGGG + Intronic
1103853488 12:123948245-123948267 CCCACGGGGGCAGAGGGGAATGG + Intronic
1104041426 12:125133792-125133814 CCGGCGGTGTCAGAGCTGCCCGG + Intronic
1104398755 12:128458559-128458581 CCCATGATGGGAAAGGTGCCTGG - Intronic
1105295650 13:19086254-19086276 CCCAGGGCTGCAGAGGTGGCTGG - Intergenic
1105442720 13:20428885-20428907 ACCAGGGTAGGAGAGGTGCCAGG - Intronic
1109003242 13:56834675-56834697 CCAACGTTGGAAGAGGGGCCTGG - Intergenic
1112096514 13:96137710-96137732 CCCACGGCGGCAGAAAGGCCAGG - Intronic
1113796746 13:113062748-113062770 GTCACGGCAGCAGAGGTGCCGGG - Intronic
1113796918 13:113063712-113063734 GTCACGGCAGCAGAGGTGCCGGG + Intronic
1114059552 14:19006953-19006975 CACACCGTGGCAGAGTTGACTGG + Intergenic
1114102994 14:19394798-19394820 CACACCGTGGCAGAGTTGACTGG - Intergenic
1118493033 14:66280222-66280244 CACAGAGAGGCAGAGGTGCCTGG - Intergenic
1121115089 14:91337859-91337881 CCCAGGCAGGCTGAGGTGCCGGG + Intronic
1121532371 14:94664512-94664534 CCCAGAGTGGCAGTGGGGCCTGG - Intergenic
1121641318 14:95486393-95486415 CCCTGGGAGTCAGAGGTGCCAGG + Intergenic
1122265978 14:100547057-100547079 CCCTGGGTGGCACAGGTGACTGG + Intronic
1122468321 14:101949129-101949151 CCCATGGCGGCAGAGCTGTCTGG + Intergenic
1122969266 14:105145889-105145911 CCCACTGGGGCAAAGGTGCCTGG - Exonic
1123553146 15:21400940-21400962 CACACGCTTGCAGAGGTGGCTGG - Intergenic
1123589392 15:21838328-21838350 CACACGCTTGCAGAGGTGGCTGG - Intergenic
1123717444 15:23041980-23042002 CCCACCTGGCCAGAGGTGCCGGG + Intergenic
1123717457 15:23042016-23042038 CCCACCTGGCCAGAGGTGCCGGG + Intergenic
1123717489 15:23042124-23042146 CCCACCTGGCCAGAGGTGCCGGG + Intergenic
1123717566 15:23042378-23042400 CCCACCTGGCCAGAGGTGCCAGG + Intergenic
1123718278 15:23044793-23044815 CCCACCTGGTCAGAGGTGCCGGG + Intergenic
1123718631 15:23046047-23046069 CCCACCTGGCCAGAGGTGCCGGG + Intergenic
1123718658 15:23046154-23046176 CCCACCTGGCCAGAGGTGCCAGG + Intergenic
1123719539 15:23049171-23049193 CCCACCTGGCCAGAGGTGCCGGG + Intergenic
1123719707 15:23049756-23049778 CCCACCTGGCCAGAGGTGCCAGG + Intergenic
1123719727 15:23049827-23049849 CACACCTGGGCAGAGGTGCCGGG + Intergenic
1123719839 15:23050222-23050244 CCCACCTGGCCAGAGGTGCCGGG + Intergenic
1123830865 15:24135992-24136014 CCCATGATGGCAGAGGTGGGAGG - Intergenic
1123835943 15:24193365-24193387 CCCATGATGGCAGAGGTGGGAGG - Intergenic
1123992949 15:25696839-25696861 GCCACGGTAGCAGAATTGCCTGG - Intronic
1124197394 15:27644500-27644522 CCTAAGGGGGCAGAGGTGACAGG - Intergenic
1124693622 15:31845723-31845745 CCCACTCTGGCAGACGTGCCAGG + Intronic
1125331619 15:38588269-38588291 CTTAGGATGGCAGAGGTGCCAGG - Intergenic
1128326877 15:66729607-66729629 TCCACGCTGTCAGAGGGGCCCGG - Intronic
1129034919 15:72643053-72643075 CCCAGGGTGGCAGAGGGACATGG - Intergenic
1129214963 15:74094163-74094185 CCCAGGGTGGCAGAGGGACATGG + Intergenic
1129390407 15:75217436-75217458 CCCAGGGTGGCAGAGGGACATGG - Intergenic
1129473866 15:75770168-75770190 CCCGAGGTGGCAGAGGTACATGG + Intergenic
1129732105 15:77938525-77938547 CCCAGGGTGGCAGAGGGACATGG + Intergenic
1130000558 15:80043087-80043109 CCCACTGTGGCCTGGGTGCCAGG - Intergenic
1130697163 15:86142132-86142154 CCCCAGGTCACAGAGGTGCCTGG - Intronic
1202961495 15_KI270727v1_random:128160-128182 CACACGCTTGCAGAGGTGGCTGG - Intergenic
1132550605 16:552509-552531 CCCTGGGGGGCAGGGGTGCCCGG - Exonic
1133109513 16:3538421-3538443 GCCACGGTGTCTGAGGTGGCTGG - Exonic
1137562271 16:49510557-49510579 CCCATGTGGGCAGAGCTGCCAGG + Intronic
1141156827 16:81602921-81602943 CCCAGAACGGCAGAGGTGCCTGG + Intronic
1142032111 16:87843789-87843811 CCCACGGTGGCAGAGGTGCCAGG + Intronic
1142485548 17:245690-245712 CCAAGGGTGGCAGAGGGACCAGG + Intronic
1143137531 17:4720153-4720175 CCCACGGTGGGCCAGGTGACAGG + Intronic
1143631575 17:8143200-8143222 CACAGGGTGGCAGAGGGGCGGGG + Intronic
1145368535 17:22286883-22286905 CCCAAGAGTGCAGAGGTGCCTGG - Intergenic
1147420879 17:40321671-40321693 CCCAGGCTGACAGTGGTGCCTGG - Intronic
1147426814 17:40349726-40349748 CCCACAGTGGGAGCAGTGCCTGG - Intronic
1149535531 17:57430778-57430800 CCCAAGTTGGCAGAGGTGGTGGG + Intronic
1150484637 17:65535256-65535278 TCCACTGTGGCAGAGGTGGAGGG - Intronic
1151514182 17:74581521-74581543 CCCAAGCTGGCAGAGGGGTCTGG - Intronic
1151815191 17:76468304-76468326 CCCACGGTGGGAGGGGAGGCAGG - Intronic
1152039186 17:77892204-77892226 GCCACAGTGGCAGAGGCCCCTGG - Intergenic
1152149714 17:78591369-78591391 GCCACCATGGCAGAGGTGACAGG - Intergenic
1152245342 17:79182420-79182442 CCCACAGAGGCCGAGGGGCCTGG + Intronic
1152358793 17:79820379-79820401 CCCACAGTGTCATATGTGCCAGG + Intergenic
1152718282 17:81910410-81910432 CGCACTGTGGCAGGGGTGCTGGG - Intronic
1154132615 18:11750312-11750334 CCCACGGTGCCGCAGGTGTCTGG - Intronic
1155249288 18:23939962-23939984 CCCACAGAGGCAGAATTGCCCGG + Intronic
1158588778 18:58762648-58762670 CCCAAGGGGGCAGTGGGGCCTGG - Intergenic
1159359571 18:67382177-67382199 CCCACGGTTGCAAAGGTCCCTGG + Intergenic
1159670122 18:71212480-71212502 CCCATGGTGGCAGAGGGGAGGGG + Intergenic
1161104654 19:2437253-2437275 CCCCCGGAGGCAGAGGCCCCAGG + Intronic
1161326548 19:3667071-3667093 CCCTCAGTGGCAGGGGTGCCTGG - Intronic
1161744121 19:6044616-6044638 CCCACAGAGGCAAAGCTGCCTGG - Intronic
1162623255 19:11861480-11861502 CTTATGGTGGCAGAGATGCCTGG + Intronic
1162764918 19:12913250-12913272 CCCACGCTGGCAGGGGGCCCAGG + Intronic
1163148911 19:15399783-15399805 CCCACTGTTGCCGCGGTGCCCGG - Intronic
1163643527 19:18475377-18475399 CCCACGACGGCAGAGGTTCTGGG - Intronic
1163726279 19:18924862-18924884 CCCCTGGAGGCAGAGGTGGCTGG - Exonic
1163773069 19:19202436-19202458 CCCTGGGTGGCAGGGGTTCCAGG - Intronic
1164918347 19:32070059-32070081 CCCAGGGTGTCTCAGGTGCCAGG - Intergenic
1165783113 19:38445177-38445199 ACCTGGGTGGCAGAGGAGCCTGG + Intronic
1167248855 19:48390373-48390395 CCCACTGAGGCAGAGGAGCCGGG - Intronic
926217426 2:10914044-10914066 CCAGCCTTGGCAGAGGTGCCGGG - Exonic
926341042 2:11904456-11904478 GCCACATTTGCAGAGGTGCCTGG + Intergenic
927200113 2:20572884-20572906 CCCATGGGAGCAGAGGGGCCTGG + Intronic
928143521 2:28751581-28751603 GCCACGGTGGCGCAGGCGCCAGG - Intergenic
929548948 2:42876930-42876952 CCCAAGGAGGCAGAGGTTGCAGG - Intergenic
929893625 2:45939059-45939081 GCCAGGGTGGAGGAGGTGCCGGG + Intronic
932595814 2:73092895-73092917 CCCAGGGTGGCCAAGGTGCCAGG - Intronic
934556647 2:95290050-95290072 CCCACTGTGGCCCAGGTCCCAGG - Exonic
935704876 2:105847604-105847626 CCCAGGGTGGGAGAGGGGCCTGG + Intronic
935791063 2:106590613-106590635 CACCCGGTGGCAGAGGTGTGAGG - Intergenic
937164143 2:119795666-119795688 CCCAAGATTGCAGAGATGCCTGG + Intronic
937438132 2:121896120-121896142 CCCACTGTGGCTGAGGTGCCAGG + Intergenic
938103117 2:128511894-128511916 CCCACGGTGGAGGTGGGGCCTGG - Intergenic
938137365 2:128770322-128770344 CACACAGTGTCAGGGGTGCCCGG + Intergenic
938469179 2:131543998-131544020 CCCACGGTGGCGGGGGTGGTGGG + Intergenic
939630548 2:144522931-144522953 CCCAACGTGGCAGAGGTGATGGG + Intronic
940002497 2:148980311-148980333 CCCACATTGGCACAGCTGCCTGG + Intronic
941267460 2:163380361-163380383 CACATGATGGCAGAGGTGTCTGG - Intergenic
946176726 2:217926927-217926949 CATGCTGTGGCAGAGGTGCCAGG + Intronic
948414880 2:237795954-237795976 CCAAACGTGGCAGAGCTGCCTGG + Intronic
948703618 2:239776265-239776287 GCCACAGTAGCAGAGGTGGCAGG + Intronic
948861081 2:240752839-240752861 CCCACAGTGGGAGTGGTCCCAGG - Intronic
949027323 2:241772670-241772692 CACATGGAGGCAGAGGTGACAGG + Intergenic
1169953011 20:11068172-11068194 CTCACGGTTGCAGAGTTTCCAGG + Intergenic
1169966293 20:11221378-11221400 CACATGTTGGCAGAGGAGCCTGG + Intergenic
1172240190 20:33408047-33408069 CCCACGGTGGCAGGGCTGAGGGG + Exonic
1172517425 20:35544653-35544675 CCCGCGGCGGCAGCTGTGCCTGG + Intronic
1172772492 20:37389659-37389681 CCCACGCTGGCACATGTCCCAGG + Intronic
1173493933 20:43505376-43505398 CCCACGTTGGCATAAGTGCTGGG + Intergenic
1173647814 20:44644471-44644493 CACACGGGGGCAGAGGAGCCAGG + Intronic
1173720609 20:45254480-45254502 CCCAAGGTGCCAGAGTTCCCAGG + Exonic
1173919231 20:46731443-46731465 ACCAGTGTGGCAGAGATGCCAGG - Intronic
1174332586 20:49831878-49831900 CCCACTGTGGCAGTGGTGTCTGG - Intronic
1174480819 20:50830166-50830188 CCAATGATGGCTGAGGTGCCAGG - Intronic
1175173356 20:57094581-57094603 CCCACAGAGGCGGAGGTCCCGGG - Intergenic
1175199127 20:57266172-57266194 CCCCAGGTGGCAGAGGGGGCAGG + Exonic
1175726345 20:61321038-61321060 CCCACGGTGTCAGGGGACCCTGG - Intronic
1175929300 20:62486064-62486086 CCCATGGTGCTGGAGGTGCCAGG - Intergenic
1175948661 20:62570688-62570710 CCATTGGTGGCATAGGTGCCAGG - Exonic
1176820334 21:13650239-13650261 CACACGCTTGCAGAGGTGGCTGG + Intergenic
1178552166 21:33550462-33550484 ACCCCGGTGCCAGAGTTGCCAGG + Exonic
1180037087 21:45255651-45255673 GTCACCGTGGCAGAGGAGCCTGG + Intergenic
1180142547 21:45901126-45901148 GCCAGGCTGGCAGAGGTGCCTGG - Intronic
1180247136 21:46555534-46555556 CCCAGGGAGGCAGTGGTGTCTGG + Intronic
1180478032 22:15729568-15729590 CACACCGTGGCAGAGTTGACTGG + Intergenic
1180866164 22:19121153-19121175 CCCATGAAGGCAGAAGTGCCAGG - Intronic
1180955181 22:19738261-19738283 CCCAGTTGGGCAGAGGTGCCTGG + Intergenic
1182319591 22:29470130-29470152 CCCACGGACACACAGGTGCCAGG + Intergenic
1182494637 22:30697191-30697213 CCCACAGTGGCAGAAATGCCTGG + Intronic
1182744566 22:32595670-32595692 CCCATGTTGGAAGAGGGGCCTGG + Intronic
1182954621 22:34410672-34410694 CTCAGGGTGGCAGAGGTGTAGGG + Intergenic
1183315931 22:37136773-37136795 CCCAGGGTGGGAGAGGTGTGCGG - Intronic
1184090301 22:42289792-42289814 GCCAGGGTGGCAGCTGTGCCCGG - Intronic
1184248536 22:43247758-43247780 GGCAGGGTGGCAGAGGGGCCCGG + Intronic
1184359236 22:44004224-44004246 CCCCTGCTGGCAGAGGTGCTGGG + Intronic
1184989506 22:48157329-48157351 CTCATGCTGGCAGAGGTTCCAGG + Intergenic
950461651 3:13125761-13125783 CATAGGGTGGCAGAGGTGTCTGG - Intergenic
954863283 3:53708038-53708060 CCCAGGGTGGCAGAGTCCCCGGG - Intronic
955465292 3:59230560-59230582 CACACGGCAGCAGGGGTGCCTGG + Intergenic
956859444 3:73307925-73307947 CCCAAGGTGGCAGGGGACCCAGG + Intergenic
961447153 3:126986228-126986250 CTCACAGTGGCAGTGGGGCCGGG - Intergenic
962114556 3:132489400-132489422 CCCAAAGTGGCAGAAGTGCTAGG + Intronic
965231569 3:166060802-166060824 CCCACAGTGGCAGAGCTTGCTGG - Intergenic
966884816 3:184371345-184371367 ACCACGGAGGTAGAGGAGCCAGG - Intronic
968462716 4:733285-733307 CCCGCGAAGGCAGAGCTGCCGGG - Intronic
968652602 4:1766188-1766210 CCCAGGCTGGCTGGGGTGCCAGG + Intergenic
969466110 4:7357437-7357459 CCCATGTTGGCAGAGAAGCCTGG + Intronic
969608934 4:8216456-8216478 CCCAGGGACACAGAGGTGCCTGG + Intronic
969668108 4:8573872-8573894 CCCAGGGTGGAACAGGGGCCTGG - Intronic
970193888 4:13538166-13538188 CCCACGCTGGTAAAGGTGACAGG - Intergenic
974892265 4:67896641-67896663 CCCACGGTGGCAGGGGTTGGGGG + Intergenic
975862249 4:78690079-78690101 CCCAGGGAGGCAGAGGTGCGTGG - Intergenic
975897242 4:79107196-79107218 GCCAGGGTTCCAGAGGTGCCTGG + Intergenic
986306393 5:6519977-6519999 CCCACTGTGGCAGGGAGGCCTGG + Intergenic
988578014 5:32444866-32444888 CCCGCGGGGGAAGAGGGGCCTGG + Intergenic
990308770 5:54518436-54518458 TCCACGGTGGCGGACGAGCCGGG + Exonic
992150403 5:73896843-73896865 CACACCGTGACAGAGGTGCCGGG + Intronic
992400278 5:76404517-76404539 GCCTTGGTGGCAGAGGTACCAGG + Intronic
992911634 5:81401183-81401205 CCAAGGGTGGCAGAGGAGCAGGG - Intergenic
992946987 5:81820818-81820840 ACCAGGTGGGCAGAGGTGCCAGG - Intergenic
994593853 5:101806767-101806789 CCCAAGGAGGCTGAGGTGGCAGG - Intergenic
998227407 5:140337601-140337623 CCAGCAGTGGCAGAGGGGCCAGG + Intronic
999310813 5:150550761-150550783 GCCATGGTGTCAGAGATGCCTGG + Intronic
1001569548 5:172721177-172721199 CCCACGGTGACAGAAGAGGCAGG - Intergenic
1002373996 5:178775339-178775361 GCAAGGGCGGCAGAGGTGCCCGG + Intergenic
1002538610 5:179891953-179891975 CCCAGGGTGGAAGAGCTGCCCGG - Intronic
1005333963 6:24775003-24775025 CCCACGGTCGCTGGAGTGCCCGG - Exonic
1006171318 6:32095059-32095081 CCCACGGTGAGAGAGATGCCAGG - Intronic
1006732706 6:36248041-36248063 TACACGGTGGCAGATGAGCCCGG - Intronic
1007123397 6:39402250-39402272 CCAACCCTGGCAGAGGTGCCAGG + Intronic
1009614890 6:65991262-65991284 CCATCCTTGGCAGAGGTGCCTGG - Intergenic
1010465690 6:76165458-76165480 CCCAAGGTTGCAGAGGTCCATGG - Intergenic
1017872991 6:158502418-158502440 CTCAAGGTGGCAGAGCTACCCGG - Exonic
1017962616 6:159234299-159234321 CTCACGGTGGCAGCGCTGCGAGG - Exonic
1018659666 6:166074162-166074184 CCCACGGCGTCTGAGGTGCCAGG + Intergenic
1018746223 6:166764349-166764371 CCCAGGGTGGCCGAGGAGCAGGG + Intronic
1018807228 6:167270844-167270866 CCCACGGTGTCAGCCGGGCCAGG - Intergenic
1019306005 7:336054-336076 CCCATGGTGGTGGAGGGGCCCGG - Intergenic
1019306029 7:336137-336159 CCCATGATGGTAGAGGGGCCTGG - Intergenic
1019537629 7:1537497-1537519 CCCACGGTGGCGGAGGCAGCTGG + Intronic
1019556503 7:1634089-1634111 CTGACAGTGGCACAGGTGCCTGG + Intergenic
1020500210 7:8908963-8908985 CTCACAGTGGAAGAGGTGCCTGG + Intergenic
1021385144 7:20020242-20020264 CCCTCTGTTGCAGAGGTACCTGG - Intergenic
1022139562 7:27481459-27481481 CCCAAGGTGGCGGGGGTGGCGGG + Intergenic
1022503566 7:30897120-30897142 CCCAGGGTGGGACAGGTACCTGG - Intergenic
1023940518 7:44766099-44766121 CCACCGCTGGCAGAGGAGCCAGG - Intronic
1029234185 7:99099591-99099613 CCCACTGTGGCAGCGGTGGGAGG + Intronic
1032730260 7:134634732-134634754 CTCAGGGTGGCAGAGGTGGAAGG - Intergenic
1035444103 7:158928087-158928109 CCCAGGGTGGCAAAGGTCCCCGG + Intronic
1038021184 8:23552915-23552937 CCGATGATGGCAGAGCTGCCGGG + Intronic
1039943002 8:42107319-42107341 CTGATGGTGGCAGAGGTGCAAGG + Intergenic
1040360423 8:46659224-46659246 CCCACAGTGGGAGTGGTGGCAGG - Intergenic
1041255046 8:55972738-55972760 CCCACGGTGACAGAGATCCCTGG + Intronic
1041454901 8:58048368-58048390 CCCACAGAGGCAAAGGTGTCAGG - Intronic
1041812526 8:61927532-61927554 CCCATGGTGGGAGACATGCCAGG - Intergenic
1045173460 8:99696119-99696141 TCCACTGTGGCAGAGGTCCATGG - Intronic
1045532105 8:102994814-102994836 GCCACTGTGCCAAAGGTGCCTGG + Intergenic
1048805232 8:138234926-138234948 CCTATGGAGGCAAAGGTGCCTGG - Intronic
1049796072 8:144497773-144497795 CCCACGGGAGCAGGGGTGGCCGG + Intronic
1052312844 9:27087001-27087023 CCCACGCTGGAAGATATGCCTGG - Intergenic
1054792360 9:69268022-69268044 CCCACAGTGGCACAAGTGACAGG + Intergenic
1057228820 9:93306558-93306580 GCCGAGGGGGCAGAGGTGCCAGG - Intronic
1058943436 9:109835138-109835160 CCCACACTGGCAGAGGTGGAGGG + Intronic
1060956669 9:127646341-127646363 GACACGGTGGCAGAGGTGAGGGG - Intronic
1060970423 9:127734596-127734618 CCCACCGAGGCAGAGGTTCAAGG + Intronic
1061010239 9:127950389-127950411 GTCAGGGTGGCAGAGGTGGCAGG + Intronic
1061402495 9:130376051-130376073 CCAAGGGTGGCTCAGGTGCCTGG - Intronic
1061700316 9:132410508-132410530 CCCCCGGCGGCGCAGGTGCCCGG - Intronic
1062064310 9:134518037-134518059 CCCAAGGGGACAGAGGTGTCAGG - Intergenic
1062343381 9:136103698-136103720 CCCAGGGCGGCGGAGGTGGCGGG + Intergenic
1203527026 Un_GL000213v1:99312-99334 CACACGCTTGCAGAGGTGGCTGG - Intergenic
1185593121 X:1291663-1291685 CCCACTGGGGCAGGGGTTCCAGG - Intronic
1185623100 X:1465393-1465415 GCCACGGTGCCAGAGGTTCAGGG - Exonic
1191861102 X:65667426-65667448 ACCAGGGTGGGAGAGGAGCCGGG + Intronic
1192244875 X:69363708-69363730 CCCCAGGGGGCAGAGATGCCTGG + Intergenic
1192268234 X:69555297-69555319 CGCACGGTGGCAAATGTGCTTGG + Intergenic
1192274649 X:69616558-69616580 CTTAGGGTGCCAGAGGTGCCAGG - Exonic
1194511456 X:94801120-94801142 GCCAAGTTTGCAGAGGTGCCTGG - Intergenic
1197371308 X:125628861-125628883 CCCACCGTGACAGAGGTGGCTGG - Intergenic
1200966579 Y:9044652-9044674 CCTAGGGTGGCAAAGGTGCAGGG - Intergenic
1201416250 Y:13751796-13751818 GCCATGGTGCCCGAGGTGCCCGG + Intergenic