ID: 1142032113

View in Genome Browser
Species Human (GRCh38)
Location 16:87843795-87843817
Sequence GTGGCAGAGGTGCCAGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 639
Summary {0: 1, 1: 0, 2: 8, 3: 56, 4: 574}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142032103_1142032113 1 Left 1142032103 16:87843771-87843793 CCCCCACACAACAGAGAGCCCAC No data
Right 1142032113 16:87843795-87843817 GTGGCAGAGGTGCCAGGCTGAGG 0: 1
1: 0
2: 8
3: 56
4: 574
1142032107_1142032113 -2 Left 1142032107 16:87843774-87843796 CCACACAACAGAGAGCCCACGGT 0: 1
1: 0
2: 0
3: 9
4: 96
Right 1142032113 16:87843795-87843817 GTGGCAGAGGTGCCAGGCTGAGG 0: 1
1: 0
2: 8
3: 56
4: 574
1142032104_1142032113 0 Left 1142032104 16:87843772-87843794 CCCCACACAACAGAGAGCCCACG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1142032113 16:87843795-87843817 GTGGCAGAGGTGCCAGGCTGAGG 0: 1
1: 0
2: 8
3: 56
4: 574
1142032102_1142032113 19 Left 1142032102 16:87843753-87843775 CCTGCAATGCACGGGACACCCCC No data
Right 1142032113 16:87843795-87843817 GTGGCAGAGGTGCCAGGCTGAGG 0: 1
1: 0
2: 8
3: 56
4: 574
1142032105_1142032113 -1 Left 1142032105 16:87843773-87843795 CCCACACAACAGAGAGCCCACGG 0: 1
1: 0
2: 0
3: 11
4: 100
Right 1142032113 16:87843795-87843817 GTGGCAGAGGTGCCAGGCTGAGG 0: 1
1: 0
2: 8
3: 56
4: 574

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142032113 Original CRISPR GTGGCAGAGGTGCCAGGCTG AGG Intronic
900299745 1:1970627-1970649 GTGGCAGAGGTGCCACCGGGAGG - Intronic
900306523 1:2011829-2011851 GTGGAAGGGGAGCCAGGGTGGGG + Intergenic
900398228 1:2462042-2462064 GTGGAGGAGGTGTCAGGCAGAGG - Intronic
900792794 1:4691007-4691029 AAGCCAGGGGTGCCAGGCTGAGG + Intronic
900946541 1:5834251-5834273 GGGGCAGGGGGCCCAGGCTGGGG - Intergenic
901665854 1:10825818-10825840 GGGGCAGAGGGGCATGGCTGTGG - Intergenic
901843303 1:11966721-11966743 GGGGCAGAGGCCCCAGGCTCGGG - Intronic
901849472 1:12006570-12006592 GTGGCAGTGGGGGCATGCTGGGG - Exonic
902511120 1:16967566-16967588 GTGGCAGAGGGGCCAGGCTCAGG + Intronic
902807390 1:18869494-18869516 GAGGCAAAGGTGACAGGTTGAGG + Intronic
902944729 1:19826718-19826740 GTGGCAGAGGTGGGAGGTGGAGG - Intergenic
903211463 1:21821675-21821697 GGGGCAGAGGACCCAGGCCGAGG + Intronic
903213957 1:21833029-21833051 GTGGCAGAGGAGCCACGAGGAGG + Intronic
903214186 1:21834137-21834159 GTTGAAGAGGTCTCAGGCTGTGG - Intronic
903214900 1:21838533-21838555 CTGGCAGGGGAGGCAGGCTGGGG + Intronic
903276200 1:22223503-22223525 GGGGCAGAGGAGACAAGCTGGGG + Intergenic
903971687 1:27122947-27122969 AAGGGAGAGGTGCCAGGCAGTGG + Intronic
904003159 1:27349868-27349890 GGGTCATAGGTGGCAGGCTGGGG - Intronic
904016385 1:27424621-27424643 AAGGCTGAGGTGCAAGGCTGGGG - Intronic
904058174 1:27686035-27686057 GTGGCAGATGAGCAAGGATGAGG + Intergenic
904063087 1:27726263-27726285 GTGGCAGGCCCGCCAGGCTGAGG + Intronic
904288431 1:29468678-29468700 GTGCCAGAGGTCTGAGGCTGAGG + Intergenic
904458694 1:30662753-30662775 GTGGCACGGGTGCCAGGCAAGGG + Intergenic
904503357 1:30930676-30930698 CTTGCAGAGGTGGCATGCTGCGG - Intergenic
905120860 1:35680753-35680775 GAGGCTGAGGTGGGAGGCTGAGG + Intergenic
905465772 1:38152063-38152085 GATGCAGAGCTGCCTGGCTGAGG - Intergenic
905944792 1:41892448-41892470 GTGGCAGCAGTGGTAGGCTGTGG - Intronic
906078960 1:43071191-43071213 GTGGATGAGATGCCACGCTGAGG + Intergenic
906130249 1:43451511-43451533 GTGGCACAGGTCCCAGGCCGAGG - Exonic
906149391 1:43578668-43578690 GCAGCAGGGGTGCCAGGGTGTGG + Intronic
906247887 1:44289846-44289868 GGGGGAGAGCTGCTAGGCTGAGG + Intronic
906508914 1:46400198-46400220 GGGGCAGTGGTGCCTGGGTGGGG + Intronic
907322968 1:53617134-53617156 GTGGCAGAGGTTCCAAGGTGGGG + Intronic
907464746 1:54627682-54627704 GTGGCAGTGGGCCCAGGTTGGGG + Intronic
908060824 1:60346823-60346845 ATGGCAGAGCTGCAAGACTGTGG - Intergenic
911457215 1:98140700-98140722 TTGGCAGAGGTGCAAGGCCAAGG - Intergenic
912042392 1:105408765-105408787 GTGGAAGAGATTCCAGGCAGAGG + Intergenic
912518892 1:110232120-110232142 GTGGTAGACATCCCAGGCTGAGG + Intronic
915343242 1:155187519-155187541 GGGGCTGGGGTGCCAGGCTGGGG - Exonic
918413977 1:184288280-184288302 CTGGCCGAGGTGCCTGGCTTGGG + Intergenic
919487238 1:198159259-198159281 GCGGAAGGGGCGCCAGGCTGAGG + Intronic
920100936 1:203516622-203516644 GTGGCACAGATGACAGGTTGGGG + Intergenic
920682706 1:208084895-208084917 GAGGTAGGGGTGCCAGGTTGGGG - Intronic
922471586 1:225880410-225880432 GGGACAGTGCTGCCAGGCTGAGG + Intronic
922478539 1:225923293-225923315 GAGGCTGAGGTGGGAGGCTGAGG + Intronic
922555438 1:226528739-226528761 GTGGCAGGGGTCGCAGGGTGTGG - Intergenic
922592771 1:226790670-226790692 GTGGCTGAGGAGGGAGGCTGAGG + Intergenic
923498405 1:234544482-234544504 GTGGCAGGGGTGGGAGGCGGTGG + Intergenic
924350475 1:243109526-243109548 GTGGCAGGTGTTCCATGCTGTGG - Intergenic
1062890689 10:1057237-1057259 GTGCCAGAGGGACCAGGGTGCGG + Intronic
1064464092 10:15562368-15562390 GGGGTAGAGAAGCCAGGCTGTGG + Intronic
1065903726 10:30229995-30230017 GGAGCACAGGTGCCAGGCTCTGG + Intergenic
1067090195 10:43262507-43262529 GTGGCAGAGGTGCCTGGCCTGGG - Intronic
1069606050 10:69739405-69739427 GGGGCAGAGGAATCAGGCTGAGG + Intergenic
1069773183 10:70912114-70912136 GAGGCAGTTGAGCCAGGCTGAGG - Intergenic
1069834703 10:71301250-71301272 ATGGCAGGGAAGCCAGGCTGGGG - Exonic
1069893817 10:71668141-71668163 GTGGCAGGGGTCTCTGGCTGTGG - Intronic
1069893823 10:71668163-71668185 GTGGCAGGGGTCTCTGGCTGTGG - Intronic
1069893829 10:71668185-71668207 GTGGCAGGGGTCTCTGGCTGTGG - Intronic
1069963737 10:72096226-72096248 GAGGCAGGGGTGGGAGGCTGGGG + Intronic
1070557310 10:77538693-77538715 GTGGCAGAGGGACCAAGGTGGGG - Intronic
1071921010 10:90350480-90350502 GTGGCAGAGCAGCCAGGGTATGG + Intergenic
1072257009 10:93630399-93630421 GTGGCAGAGATGACAGGTGGGGG - Intronic
1073435698 10:103514482-103514504 GGGGCAGATGGCCCAGGCTGGGG - Intronic
1073450241 10:103604793-103604815 GTGGCAGAACTGTCAGGCTCAGG - Intronic
1074606215 10:114970654-114970676 ATAGCACAGATGCCAGGCTGGGG - Intronic
1074744492 10:116518158-116518180 TTGGCAAAGGTGGGAGGCTGTGG - Intergenic
1075073519 10:119334963-119334985 GGAGCAGAAGTCCCAGGCTGTGG + Intronic
1075621128 10:123929130-123929152 CTGTCAGAGGTGACAGGATGGGG + Intronic
1075689079 10:124383682-124383704 GTGGGTGAGGTGCCTGCCTGGGG - Intergenic
1076094667 10:127721229-127721251 GTGGCAGAGGCTACAGGGTGAGG + Intergenic
1076528238 10:131126264-131126286 GTGGCACATGGGCCATGCTGGGG + Intronic
1076736597 10:132461861-132461883 CTGGGCGAGGTTCCAGGCTGAGG + Intergenic
1076746203 10:132515942-132515964 CTGGCAGAGCTGGGAGGCTGGGG + Intergenic
1076767642 10:132645237-132645259 GTGGCCGTGATGCCAGGCTCAGG + Intronic
1076946550 10:133655656-133655678 AGGGGAGAGGTGCCAGGCTGTGG - Intergenic
1077061704 11:620436-620458 GAGTCAGAGGGGCCAGGCTGGGG - Intronic
1077108810 11:853237-853259 GAGAGAGGGGTGCCAGGCTGGGG - Intronic
1077490000 11:2856636-2856658 GTGGGAGAGGTGTGTGGCTGTGG - Intergenic
1078407878 11:11087042-11087064 GTTGCAGAGGCCACAGGCTGAGG + Intergenic
1078432142 11:11296352-11296374 GAGGCCCAGGTGGCAGGCTGAGG - Intronic
1078609727 11:12809843-12809865 GTGGCAGACTTGCCAGGCACAGG - Intronic
1078610284 11:12813768-12813790 GTGGCAGTGGTGCCAGGGGGTGG + Intronic
1078771942 11:14359185-14359207 GGGGCCGGGCTGCCAGGCTGAGG + Intronic
1079032016 11:16993016-16993038 GTGGCAGAGTTGGCAGGGTGAGG - Intronic
1079349046 11:19677330-19677352 CTTGCAGAGGTCCCTGGCTGCGG + Intronic
1080502668 11:32885506-32885528 GTGGCGGAGGTGGCAGTCAGTGG - Intergenic
1081908021 11:46681417-46681439 GTGGGACAGGTGCCACGCTAGGG + Intronic
1081960267 11:47130803-47130825 TTGGCAGAGCAGCCTGGCTGAGG + Intronic
1082707605 11:56511705-56511727 ATGGCAGAGGTGAGGGGCTGAGG + Intergenic
1082717715 11:56635378-56635400 GTGGCAGAGGTAGCTGGCTTAGG - Intergenic
1082983115 11:59142666-59142688 GTCGCGGAGGCACCAGGCTGGGG - Intergenic
1083629244 11:64087338-64087360 GTGGCAGGGGTGGCAGGGTTGGG - Intronic
1083630628 11:64093444-64093466 CTGGCAGAGATGCCAGGCAGCGG - Intronic
1083633413 11:64107470-64107492 GTGGCGCTGGTGCCAGGCGGCGG - Intronic
1084182123 11:67452053-67452075 GTGGCAGGTGCGACAGGCTGTGG + Exonic
1084288515 11:68146931-68146953 GTGGTAGAGCTGGTAGGCTGGGG + Intergenic
1084427099 11:69090354-69090376 GTGGCAGTGATGGGAGGCTGGGG - Intronic
1084575057 11:69983635-69983657 GTGATAGTGATGCCAGGCTGGGG - Intergenic
1085181644 11:74541572-74541594 CTGGCCGAGGTGCCCGGCTTGGG + Intronic
1085243193 11:75075367-75075389 TTGGAGGAGGTGGCAGGCTGGGG + Intergenic
1086007052 11:82049097-82049119 GTGGCAGTGGCTCCAGGGTGAGG + Intergenic
1086342173 11:85857725-85857747 GTAGCAGTGGTAGCAGGCTGTGG + Intronic
1086611183 11:88757749-88757771 GTGGCAGAGGTAGCATGGTGGGG - Intronic
1088742794 11:112780639-112780661 ATGGCAAAGGGGCCATGCTGAGG - Intergenic
1088793381 11:113246410-113246432 GTGCCCTATGTGCCAGGCTGTGG - Intronic
1089094343 11:115906407-115906429 GTGGCAGATGTAACAAGCTGGGG + Intergenic
1089127396 11:116186327-116186349 GAGGCCGAGGTGGGAGGCTGAGG + Intergenic
1089962272 11:122626534-122626556 GGTGCAAAGGTGCCAGGCTTTGG + Intergenic
1090238386 11:125165487-125165509 GCGGGAGCGGTCCCAGGCTGGGG + Intronic
1091368982 11:135043144-135043166 GGGACAGAGGGGCCATGCTGGGG - Intergenic
1092140662 12:6180987-6181009 GGGGGAGAGGATCCAGGCTGAGG + Intergenic
1092177852 12:6423111-6423133 AGGGCAGAGGTGCCAGGCGTCGG - Intergenic
1092226980 12:6753740-6753762 GGGGCAGAGGATCCAGGTTGGGG + Intronic
1092914518 12:13177963-13177985 CTGGCAGTGTAGCCAGGCTGAGG + Intergenic
1094152136 12:27296589-27296611 GTGGCATAGGTGGCAGGTTTGGG + Intronic
1095089297 12:38088825-38088847 GGGGGAGAGATGCCAGGCTGTGG + Intergenic
1096109734 12:49021547-49021569 GGGGCAGAGATGCCAGCCTGAGG + Exonic
1096663495 12:53145597-53145619 GTGGCAGAGCTCCCAGTCTGAGG + Intergenic
1098046512 12:66406856-66406878 GTAGCAGAGGTGCAAGCCTTAGG - Intronic
1098528850 12:71517968-71517990 GTGGCAGAGGTGGCATGAAGTGG - Intronic
1102578027 12:113869341-113869363 ATGGCAGAGGTGCCTGGGTCTGG - Intronic
1102586033 12:113923688-113923710 GGGGCAGAGCAGCCAGGCGGCGG - Intronic
1102764633 12:115422179-115422201 GTGGTAGAGGTGATAGGATGCGG - Intergenic
1102978415 12:117222917-117222939 GTGGCTGAGGTGCCAGGGATGGG + Intronic
1103239824 12:119403794-119403816 GAGGAAGATGTGCCAGGCAGAGG - Intronic
1103965794 12:124638572-124638594 GGGGAAGGCGTGCCAGGCTGGGG + Intergenic
1104054258 12:125217262-125217284 GGGGAAGAGAGGCCAGGCTGGGG + Intronic
1104720321 12:131041753-131041775 CAGGCAGAGGCGCCAGGCAGGGG - Intronic
1104861177 12:131924721-131924743 GTGGAGCAGCTGCCAGGCTGTGG + Intergenic
1105832700 13:24178257-24178279 GTGGCAGAGGTGGCAAGCAGTGG - Intronic
1106342241 13:28841527-28841549 GTGGAAAAGATGCCATGCTGTGG + Intronic
1106707366 13:32295492-32295514 CTGGCAGTGCTGCCATGCTGGGG + Exonic
1106780168 13:33051294-33051316 GAGGCTGAGGTGGGAGGCTGAGG + Intronic
1107326663 13:39250959-39250981 GTGGCAGAACTCCTAGGCTGTGG + Intergenic
1107458518 13:40578028-40578050 GTGGTAAAGGTGCCAGTCAGTGG - Intronic
1107554349 13:41504368-41504390 CTGGGAGAGGTGCCAGCCTCTGG + Intergenic
1109922352 13:69082274-69082296 GTGGCAGAGGGTGAAGGCTGTGG + Intergenic
1110308767 13:74022450-74022472 GTGGCAGAAGTGGGAGACTGTGG - Intronic
1111290550 13:86163146-86163168 GTGGTAGAAGAGCCAGGGTGTGG + Intergenic
1112148869 13:96733917-96733939 GTGGTCTAGGTGCAAGGCTGTGG - Intronic
1112462251 13:99613418-99613440 GTGGCTGAGGGGCCTGGATGGGG + Intronic
1112571425 13:100597005-100597027 GTTGCAGTGGTGCCAATCTGGGG - Intergenic
1113255402 13:108499926-108499948 GGGTCAGAGAAGCCAGGCTGAGG - Intergenic
1113453702 13:110432161-110432183 TTGGCAGAGATGACATGCTGGGG - Intronic
1113512561 13:110867666-110867688 GTGGCAGAGATGCAGGGCCGTGG + Intergenic
1114083314 14:19219766-19219788 GAGGCAGAGGTACTAGGATGGGG - Intergenic
1114429761 14:22650733-22650755 ATGCCAGTGGTGCGAGGCTGGGG - Intergenic
1115462162 14:33673680-33673702 TTGGGAATGGTGCCAGGCTGTGG - Intronic
1115559334 14:34568929-34568951 GAGGTACAGGTGCCACGCTGTGG + Intronic
1116925790 14:50635561-50635583 GAGGCTGAGGTGGGAGGCTGAGG + Intronic
1117192405 14:53305918-53305940 TGGGCAGAGGAGGCAGGCTGAGG + Intergenic
1118376945 14:65185689-65185711 CTTGCAGAGGTGCTGGGCTGAGG - Intergenic
1118452888 14:65919788-65919810 GTGACAGTTGTGCCAGGCTTGGG + Intergenic
1118620496 14:67610112-67610134 GGGGCAGAGGCGCCAGTCTATGG + Intergenic
1119417492 14:74482922-74482944 GTGGAGGAGGTGCCAGACTGGGG + Intronic
1119437330 14:74605865-74605887 CAGGCAGAGAGGCCAGGCTGGGG + Intronic
1119476285 14:74931748-74931770 GAGGCTGAGGTGAGAGGCTGAGG + Intergenic
1119476292 14:74931787-74931809 GAGGCTGAGGTGAGAGGCTGAGG + Intergenic
1119476296 14:74931800-74931822 GAGGCTGAGGTGGGAGGCTGAGG + Intergenic
1119932960 14:78566029-78566051 GAGGCAGAGCTGCCAGTGTGGGG - Intronic
1121303738 14:92891920-92891942 GTGCCAGGAGTCCCAGGCTGTGG - Intergenic
1121304631 14:92898426-92898448 GTGCCAGAGCTGAGAGGCTGCGG - Intergenic
1121774137 14:96579032-96579054 GTGGAAGAGGGGACAGGCTTCGG - Intergenic
1122314871 14:100820048-100820070 GTGGCATTGGTGGCAGGCAGTGG + Intergenic
1122314895 14:100820169-100820191 GTGGCAGTGGTGGCAGGCAGTGG + Intergenic
1122314908 14:100820231-100820253 TAGGCAGTGGTGCCAGGCAGCGG + Intergenic
1122499579 14:102187794-102187816 TGGGCAGGGGTGCCAGGCAGGGG + Intronic
1122638509 14:103142428-103142450 GGGGAAGAGGAGTCAGGCTGGGG + Intergenic
1122687053 14:103514060-103514082 GTGGCAGAGGGGCCAGAGTCTGG - Intergenic
1122816969 14:104318745-104318767 GGGGCAGAGGAGCTGGGCTGCGG + Intergenic
1202920653 14_KI270723v1_random:28278-28300 AGGGGAGAGGTGCCAGGCTGTGG - Intergenic
1202924276 14_KI270724v1_random:9370-9392 AGGGGAGAGGTGCCAGACTGTGG + Intergenic
1123469351 15:20538752-20538774 GGGGCAGTGGTGCCATTCTGGGG - Intronic
1123682602 15:22773496-22773518 GGGACAGTGGTGCCATGCTGGGG - Intronic
1123729628 15:23133738-23133760 GGGGCAGTGGTGCCATTCTGGGG - Intronic
1123747795 15:23331220-23331242 GGGGCAGTGGTGCCATTCTGGGG - Intergenic
1123828894 15:24113202-24113224 TTGGGAGATGTTCCAGGCTGTGG - Intergenic
1123858891 15:24442916-24442938 TTGGGAGATGTTCCAGGCTGTGG - Intergenic
1123863529 15:24493305-24493327 TTGGGAGATGTTCCAGGCTGTGG - Intergenic
1123870312 15:24565218-24565240 GGGTCAGATGTCCCAGGCTGAGG - Intergenic
1124010902 15:25837842-25837864 GTGGAAGGGGAGCCAGGCAGTGG + Intronic
1124226278 15:27897673-27897695 GGGTCAGAGGTGCCACACTGAGG + Intronic
1124280163 15:28355072-28355094 GGGGCAGTGGTGCCATTCTGGGG - Intergenic
1124302537 15:28556540-28556562 GGGGCAGTGGTGCCATTCTGGGG + Intergenic
1124690970 15:31822547-31822569 GAGGCAGGGTGGCCAGGCTGGGG - Intronic
1125301006 15:38253005-38253027 GTGGCCGGGGTTCCCGGCTGGGG + Exonic
1125462871 15:39922677-39922699 GGAGCATAGCTGCCAGGCTGTGG - Intergenic
1125519294 15:40339268-40339290 GTGGCATAGGCGCAGGGCTGTGG + Intronic
1125610896 15:40969553-40969575 GCTGCAGAGGAGCCAGCCTGAGG - Intergenic
1125732062 15:41898198-41898220 GTGGGAGAGGCGTCAGGCAGCGG - Exonic
1127693555 15:61421538-61421560 GTGGCAGATGTGGGAGCCTGAGG + Intergenic
1127906580 15:63380667-63380689 AGGGCAGGGGAGCCAGGCTGTGG - Intronic
1129004308 15:72359298-72359320 GCTGCAGAGGTAGCAGGCTGTGG - Intronic
1129669514 15:77599408-77599430 ATGACATAGGTACCAGGCTGGGG - Intergenic
1130293836 15:82628688-82628710 GTGGCAAAGGTGGAAGGATGTGG - Intronic
1130559844 15:84949499-84949521 GAGGCTGAGGTGGGAGGCTGAGG - Intergenic
1130906364 15:88243328-88243350 TTGGCAGACGGGCCAGGCTCAGG - Intronic
1131052568 15:89358512-89358534 ATAGCAGAGGTGCCAGTCTTAGG + Intergenic
1132215501 15:100058776-100058798 GTGGGAGAGGTGTCAGGAAGAGG + Intronic
1132550601 16:552503-552525 GGGGCAGGGGTGCCCGGCAGGGG - Exonic
1132676447 16:1123185-1123207 GGGGCCCAGGTCCCAGGCTGTGG + Intergenic
1132845735 16:2000047-2000069 GTGGGGGCGGTGCCAGGCTTGGG + Exonic
1132859131 16:2061429-2061451 GTGGCAGAGGTCATAGCCTGGGG + Intronic
1132923797 16:2416243-2416265 GAGGCAGAGGCGGGAGGCTGAGG + Intergenic
1132928612 16:2446713-2446735 GAGGCAGAGGTTCCAGGCTCAGG + Intronic
1133072327 16:3254639-3254661 GGGGCGGAGCTGCCAGCCTGCGG - Exonic
1134009708 16:10842957-10842979 CTGGCAGGAGGGCCAGGCTGAGG + Intergenic
1134013450 16:10871922-10871944 GTTGGAGAAGTGCCAGGCTTGGG - Intergenic
1134418251 16:14062913-14062935 GTGGCAGAAGTGGCTGGCTTTGG - Intergenic
1135589020 16:23692021-23692043 GGGGCAGAGGGGCGTGGCTGCGG + Exonic
1136049524 16:27640480-27640502 GTGGCAGAGGAGCCTCCCTGGGG + Intronic
1136656471 16:31712226-31712248 GGGGGAGGGGTGCTAGGCTGTGG + Intergenic
1137450548 16:48569974-48569996 GTTGCAGAGGTACAAGGCAGTGG - Intronic
1137802874 16:51277282-51277304 GTGGCACAGACGGCAGGCTGTGG - Intergenic
1138009262 16:53362517-53362539 GGGGCAGTGGTGCCATTCTGGGG - Intergenic
1138127688 16:54452379-54452401 GTGGCCGAGGTTCCAGGCTTTGG + Intergenic
1139529365 16:67535457-67535479 GTGGCTGTGGATCCAGGCTGGGG + Intronic
1140124799 16:72110327-72110349 GTGGCAGAGATGCCTGCATGTGG + Intronic
1140670429 16:77272248-77272270 TTGGCACAGGTGCATGGCTGAGG - Intronic
1141141004 16:81496914-81496936 ATGGCCCAGCTGCCAGGCTGTGG - Intronic
1141466082 16:84206643-84206665 GTGGCTGGGGTGCCAGGCTGTGG - Intergenic
1142032113 16:87843795-87843817 GTGGCAGAGGTGCCAGGCTGAGG + Intronic
1142292186 16:89198281-89198303 GCACCTGAGGTGCCAGGCTGCGG + Exonic
1142380262 16:89727966-89727988 AGGGCAGCTGTGCCAGGCTGGGG + Intronic
1142485550 17:245696-245718 GTGGCAGAGGGACCAGGTGGAGG + Intronic
1142594590 17:1023317-1023339 GGGGGAGATGTGCCTGGCTGTGG - Intronic
1143100859 17:4503943-4503965 GAGGAGGGGGTGCCAGGCTGGGG + Intronic
1143101516 17:4507078-4507100 GTGCCAGCGGGGCCGGGCTGTGG + Intronic
1143400226 17:6638606-6638628 GTGGGAAAGGAGGCAGGCTGTGG - Intronic
1143474965 17:7197163-7197185 CTGCCAGAGATGCCAGGGTGGGG + Intronic
1143631578 17:8143206-8143228 GTGGCAGAGGGGCGGGGCTGGGG + Intronic
1143772047 17:9175116-9175138 GTGGAAAGGGTGCCAGGCTCAGG + Intronic
1144062887 17:11599044-11599066 TAGGCAGAGGGGCGAGGCTGTGG + Intronic
1144068508 17:11645817-11645839 ATAGCAGAGGTGGAAGGCTGGGG - Intronic
1144668611 17:17118715-17118737 GTGGCACAGAGGCCAGGCAGAGG + Intronic
1144787687 17:17840844-17840866 ATGGCAGAGGGGCCAGGCTGTGG + Intergenic
1145023513 17:19450473-19450495 GTGGCAGGCGTGGGAGGCTGAGG + Intergenic
1145270548 17:21402465-21402487 CTGGCAGCAGTGCCAGGCCGTGG + Intronic
1145308758 17:21689861-21689883 CTGGCAGCAGTGCCAGGCCGTGG + Intergenic
1145769827 17:27485087-27485109 GGGGCAGTGTTGCCAGGCTGGGG - Intronic
1145956875 17:28860770-28860792 GTAGCTGTGGTGCCAGGCAGAGG - Exonic
1146012138 17:29204665-29204687 GAGGCTGAGGTGGCAGACTGAGG - Intergenic
1146890263 17:36502116-36502138 GGGGCAGAGGTGCTGGGCTGGGG + Intronic
1147219528 17:38920248-38920270 GTGGCAGAAGTGTCACCCTGTGG + Exonic
1147661534 17:42119568-42119590 TCGGCAGAGGTCTCAGGCTGAGG - Exonic
1147820711 17:43240175-43240197 GGGGCAAAGGAGCGAGGCTGGGG - Intergenic
1147878320 17:43637476-43637498 GTGGCGGAGGTGGTAGGTTGCGG + Intergenic
1147947158 17:44086665-44086687 GGGGCACAGTGGCCAGGCTGAGG + Exonic
1148108262 17:45130832-45130854 GTGGCAAAGGGGAGAGGCTGGGG - Intronic
1148157265 17:45431438-45431460 GTGGCGGAGGAGCCCTGCTGGGG - Intronic
1149627690 17:58091268-58091290 GTGGCAGTGGTGCCACACAGTGG + Exonic
1150399584 17:64846640-64846662 GAGGCTGAGGTGGGAGGCTGTGG + Intergenic
1150486515 17:65547406-65547428 GTCTCAGAGGTGCATGGCTGTGG + Intronic
1151212453 17:72554792-72554814 GAGGCAGGGGTGACAGGATGGGG - Intergenic
1151293528 17:73166782-73166804 GTGGTGGAGGTGGGAGGCTGGGG - Intronic
1152030037 17:77836533-77836555 GTGGCGGGGGTGGCAGGGTGGGG - Intergenic
1152374940 17:79914174-79914196 GTGGCAGGGGTGGCAGGCATTGG - Intergenic
1152748798 17:82053085-82053107 GTGGCACAGGAGCCTGGGTGGGG + Intronic
1203170588 17_GL000205v2_random:145068-145090 AGGGGAGACGTGCCAGGCTGTGG - Intergenic
1152971583 18:167144-167166 GAGGCTGAGGTGGGAGGCTGAGG + Intronic
1153783595 18:8515261-8515283 GTGGGAGAGGTGGCAGTGTGTGG - Intergenic
1153982251 18:10320413-10320435 GTGGCAGTGGGGCAAGGGTGAGG + Intergenic
1154499999 18:14991429-14991451 GAGGCAGAGGTACTAGGATGGGG - Intergenic
1155164665 18:23222703-23222725 AAGGATGAGGTGCCAGGCTGAGG - Intronic
1156352765 18:36315347-36315369 GTGGCCAAGGAGGCAGGCTGAGG - Intronic
1156400750 18:36737478-36737500 GTGGGACACGTGCCAGGTTGTGG + Intronic
1156473069 18:37389544-37389566 GTGGGAGGGGTGCTGGGCTGTGG + Intronic
1156473211 18:37390342-37390364 ATGGCCGAAGTGACAGGCTGGGG - Intronic
1156595451 18:38543072-38543094 GTAGCAGAGGTGCTATGGTGTGG + Intergenic
1156668433 18:39437184-39437206 GTGGCAGGAGTGGAAGGCTGTGG - Intergenic
1157493719 18:48140860-48140882 GTGGCAGAGGTGGCAGGAAGAGG - Intronic
1157621647 18:49020558-49020580 AGAGCAGAGGTGCCAGGATGGGG - Intergenic
1157700169 18:49757311-49757333 CTGGCGGATGGGCCAGGCTGAGG + Intergenic
1158231439 18:55260238-55260260 GTGGGAAAAGAGCCAGGCTGGGG + Intronic
1158306170 18:56108192-56108214 TGTGCAGAGGTTCCAGGCTGGGG + Intergenic
1158675652 18:59515726-59515748 GCAGCAGAGGAGACAGGCTGAGG + Intronic
1158918177 18:62158287-62158309 GTGGCAGAGGGGCCAGGAGAGGG + Intronic
1160124591 18:76159340-76159362 GTGGTAGAGGTGCCAATCAGAGG - Intergenic
1160815982 19:1036021-1036043 CAGGCAGAGGTGACAGGCCGCGG + Intronic
1160822145 19:1063683-1063705 GTGGGAGCGGTGCCTGGGTGGGG + Intronic
1160986361 19:1840776-1840798 GTGTCTGTGGCGCCAGGCTGAGG - Intronic
1161002722 19:1919026-1919048 GTGGCTCAGCTGCCAGGTTGTGG + Intronic
1161219221 19:3110397-3110419 GTGGCCGCGCTGCCAGGGTGGGG + Intronic
1162059323 19:8085410-8085432 TAGGCAGAGGTGCCGGGCAGGGG + Exonic
1162299963 19:9838855-9838877 GGGGCAGAGGACCCAGCCTGGGG + Intronic
1162477151 19:10907521-10907543 GAGGCTGAGGTGGGAGGCTGAGG - Intronic
1162797443 19:13094263-13094285 GTGGGGAAGATGCCAGGCTGGGG - Intronic
1163200919 19:15768455-15768477 GTGGCAGCAGAGCCTGGCTGTGG - Intergenic
1163384555 19:16991526-16991548 GTCTGAGAGATGCCAGGCTGTGG + Intronic
1164207916 19:23073262-23073284 GGGGGAGAGGTGGTAGGCTGTGG + Intergenic
1164533352 19:29064743-29064765 GTGGTAGAGGCTGCAGGCTGTGG - Intergenic
1164548107 19:29185803-29185825 CTGGCTGAGGTGACAGGCTGTGG - Intergenic
1164561803 19:29297613-29297635 GTGGCAGTGGAGACAGCCTGAGG - Intergenic
1165230204 19:34381963-34381985 GTAGAGGAGGCGCCAGGCTGGGG + Intronic
1165770428 19:38376708-38376730 GAGTCAGAGGGGCAAGGCTGGGG - Intronic
1165967364 19:39594004-39594026 CTGGGAGAGGTACTAGGCTGTGG - Intergenic
1165968163 19:39602314-39602336 GTGGGGGAGTTACCAGGCTGTGG - Intergenic
1165979038 19:39704273-39704295 GTGGGGGAGGTACCAGGCTGTGG - Intergenic
1166091779 19:40513921-40513943 CCAGCAGAGGGGCCAGGCTGAGG - Intronic
1167106958 19:47436028-47436050 GAGGAAGAGGTACCAGGATGAGG - Intronic
1167455279 19:49594552-49594574 GAGGCGGAGGGGCCAGGCTGGGG - Exonic
1167502647 19:49856440-49856462 CTGACAGATGTGCCTGGCTGTGG - Intronic
925012397 2:495879-495901 ATGGCAGAGGTGGCAGGAGGTGG + Intergenic
925580076 2:5401398-5401420 GGGGCAGAGAGGCCGGGCTGTGG + Intergenic
925947305 2:8877795-8877817 GTGACAGGGGTTCCAGGCAGAGG + Intronic
926046283 2:9711868-9711890 GAGCCCCAGGTGCCAGGCTGGGG - Intergenic
926323036 2:11762271-11762293 GTGGCAGTGCTGGGAGGCTGGGG - Intronic
926735642 2:16071310-16071332 GAGGCAGAGGAGCTAGGATGGGG + Intergenic
926738141 2:16090009-16090031 TAGGCAGAAGAGCCAGGCTGTGG + Intergenic
926738160 2:16090105-16090127 TAGGCAGAAGAGCCAGGCTGTGG + Intergenic
926738179 2:16090201-16090223 TAGGCAGAAGAGCCAGGCTGTGG + Intergenic
926738198 2:16090297-16090319 TAGGCAGAAGAGCCAGGCTGTGG + Intergenic
926738218 2:16090393-16090415 TAGGCAGAAGAGCCAGGCTGTGG + Intergenic
926754415 2:16223878-16223900 CTTGCAGAGGTGCCAGGCAAGGG + Intergenic
927214401 2:20659097-20659119 TTGGCAGAAGTGCCACACTGAGG + Intergenic
927495221 2:23547305-23547327 GGGGCAGAGGGGAGAGGCTGTGG + Intronic
927978507 2:27358337-27358359 GAGGCTGAGGTGGCAGGTTGAGG - Intergenic
929941043 2:46334209-46334231 GTGGCTGAGGTGCCAGGTGGTGG - Intronic
929942801 2:46347699-46347721 GTTGCAGAGGTGCTAGGGAGGGG - Intronic
930981760 2:57534357-57534379 GGGGAAGAGGTGGCATGCTGAGG - Intergenic
932654130 2:73593743-73593765 GTGGCAGAGGTGGGAGGCTGGGG - Intronic
932873679 2:75428984-75429006 GTGGAAGAGGAGGCTGGCTGGGG + Intergenic
933077967 2:77953961-77953983 GGGGCAGAGGGGCCACCCTGAGG - Intergenic
934516959 2:94994262-94994284 GATGCACAGGCGCCAGGCTGAGG + Intergenic
934704979 2:96470913-96470935 GTGCCAGCGGTGCCAGCCTGAGG + Intergenic
934713744 2:96531498-96531520 GAGGCAGTGGTGCAAGTCTGTGG - Intergenic
935147701 2:100407340-100407362 GTGGCTTCTGTGCCAGGCTGAGG - Intronic
935574429 2:104694132-104694154 GAGGCAGAGGTGGGAGGCAGAGG - Intergenic
935814100 2:106830318-106830340 GAGGCAGAGGGGCCAGGCTGGGG + Intronic
936452065 2:112641276-112641298 ATGGCATAGGAGCCAGGCAGAGG - Intergenic
936484358 2:112913882-112913904 GTGGCTGAGGTGCGAGGGTGGGG + Intronic
937216893 2:120318651-120318673 GTTCCAGAGGGGCAAGGCTGTGG - Intergenic
937457429 2:122054699-122054721 GTGGGAGAGGTGCCAGAGTGAGG - Intergenic
937867643 2:126766045-126766067 CTTGCTGAGCTGCCAGGCTGTGG + Intergenic
938061315 2:128257001-128257023 GAGGCTGAGGTGGGAGGCTGAGG + Intronic
938069382 2:128300424-128300446 GTGGCCCAGGTGCAGGGCTGGGG - Intronic
938112913 2:128581121-128581143 GGGGCATGGCTGCCAGGCTGGGG + Intergenic
938273739 2:129997890-129997912 GGTGCAGAGGTGACAGGCAGGGG - Intergenic
938493270 2:131776865-131776887 GAGGCAGAGGTACTAGGATGGGG + Intergenic
938499212 2:131821788-131821810 GAGGCAGAGGTACTAGGATGGGG - Intergenic
941398889 2:165006379-165006401 GTGCCAGAGGTGGCAGTCTTAGG - Intergenic
942053708 2:172163288-172163310 GTGGCAGAGGGGTCGGGCTTAGG - Intergenic
943226736 2:185187789-185187811 GTGGCAGAGGATGCAGGATGAGG - Intergenic
944052365 2:195485043-195485065 GTCTCAGAGGTGGCAGACTGGGG + Intergenic
944096704 2:195976075-195976097 GTGGCCGAGCTGCAAGGCTGAGG - Intronic
944245168 2:197523343-197523365 GTGGCTAAGGTGAGAGGCTGAGG + Intronic
946568812 2:220998363-220998385 GTGGGAGATGGGCCAGGCTCTGG + Intergenic
946612504 2:221474529-221474551 GCTTCAGAGGAGCCAGGCTGTGG - Intronic
947382858 2:229562205-229562227 GTGGCAGAGGTGGTGGGATGTGG - Intronic
947517281 2:230816931-230816953 GTGGGGCAGGTGCCAAGCTGCGG - Intronic
947754423 2:232551086-232551108 GAGGCAGCGCTGCCAGACTGCGG - Intronic
947972832 2:234338343-234338365 GTGGCAGAGCAGCCAGGCTGTGG + Intergenic
948059591 2:235033090-235033112 GCGGCAGAGCTGCCCTGCTGGGG - Intronic
948168140 2:235878878-235878900 GTGACAGAGGTGCCTGCCAGAGG + Intronic
948277557 2:236721134-236721156 GTGGAAGCGCTGCCAGGCTGGGG - Intergenic
948825141 2:240570368-240570390 GTGTCAGGGTTGGCAGGCTGTGG + Intronic
948931401 2:241134798-241134820 GTGGCAGGGGTGTCAGGTGGGGG - Intronic
949056369 2:241930089-241930111 AGGGAAGAGGTTCCAGGCTGTGG + Intergenic
949071990 2:242030958-242030980 GTGGGTGTGGGGCCAGGCTGGGG - Intergenic
1168842248 20:916925-916947 GAGGCAGAGGGGTGAGGCTGGGG + Intergenic
1169118458 20:3082134-3082156 GAGGCAGAGGGGACAGGCCGAGG - Intergenic
1170106042 20:12754937-12754959 GGGGCAGAGATGCGAGGTTGGGG - Intergenic
1172212933 20:33213681-33213703 GTGGAAGGGGAGCCAGGCAGAGG - Intergenic
1172619498 20:36309611-36309633 GAGGGAGAGGGGCCATGCTGGGG + Intronic
1172942474 20:38663983-38664005 GTGGCAGTGCCCCCAGGCTGGGG - Intergenic
1173549182 20:43920650-43920672 GGGGCAGCAGTGCCAGGCTTGGG - Intronic
1174049373 20:47757153-47757175 GGGGCCGAGGTGCCACCCTGGGG + Intronic
1174984208 20:55431753-55431775 ATGACAGAGGTGCTGGGCTGGGG + Intergenic
1175323388 20:58105521-58105543 GTTTCAGAGGAGCCATGCTGGGG - Intergenic
1175346519 20:58281272-58281294 GAGGCAGAGGTTGCAGCCTGGGG + Intergenic
1175813040 20:61868964-61868986 GTGGCAAACGTGGCAGGCTGTGG + Intronic
1176198308 20:63848016-63848038 GGGGCTCAGGTGCCAGGGTGAGG + Intergenic
1176326573 21:5506898-5506920 AAGGGAGAGGTGCCAGGTTGTGG - Intergenic
1176331133 21:5549307-5549329 AGGAGAGAGGTGCCAGGCTGTGG + Intergenic
1176396624 21:6271644-6271666 AGGAGAGAGGTGCCAGGCTGTGG - Intergenic
1176401184 21:6314053-6314075 AAGGGAGAGGTGCCAGGTTGTGG + Intergenic
1176435973 21:6675051-6675073 AAGGGAGAGGTGCCAGGTTGTGG - Intergenic
1176440533 21:6717460-6717482 AGGAGAGAGGTGCCAGGCTGTGG + Intergenic
1176460235 21:7002121-7002143 AAGGGAGAGGTGCCAGGTTGTGG - Intergenic
1176464795 21:7044529-7044551 AGGAGAGAGGTGCCAGGCTGTGG + Intergenic
1176483796 21:7383899-7383921 AAGGGAGAGGTGCCAGGTTGTGG - Intergenic
1176488356 21:7426308-7426330 AGGAGAGAGGTGCCAGGCTGTGG + Intergenic
1177948262 21:27500563-27500585 CTGGCAGTGGTGGCAGGGTGGGG + Intergenic
1178493277 21:33067764-33067786 GTAGCTGAGGTGCCAGATTGGGG - Intergenic
1178902840 21:36611438-36611460 GTGGCAGATGGGAGAGGCTGTGG - Intergenic
1179487333 21:41718830-41718852 GTGGCAGTGCTGTGAGGCTGGGG - Intergenic
1179899394 21:44381170-44381192 GAGGCAATGGGGCCAGGCTGCGG + Intronic
1179951864 21:44712752-44712774 GTGTCAGAGGTCCCAGAGTGGGG - Intergenic
1180198027 21:46208945-46208967 GGGGCAGCGGTTCCAGGCAGAGG + Intronic
1180294661 22:10873501-10873523 GAGGCAGAGGTACTAGGATGGGG + Intergenic
1180497467 22:15902915-15902937 GAGGCAGAGGTACTAGGATGGGG + Intergenic
1180921159 22:19522380-19522402 CTGGCAGAGGAGCCAGGACGAGG + Intergenic
1181031466 22:20150402-20150424 GGGGCAGGGGTACCAGGCGGTGG + Intronic
1181056404 22:20262394-20262416 GTGGGTGATGGGCCAGGCTGGGG + Intronic
1181061341 22:20283511-20283533 CTGGAGGAGCTGCCAGGCTGGGG + Intergenic
1181574795 22:23787017-23787039 GCGGCTGAGGAGCCCGGCTGAGG + Exonic
1181672998 22:24434558-24434580 GTGGCAGAGGGGCCAGGAGGTGG - Intronic
1182015089 22:27032607-27032629 GTGGCCGAGGTGCCAGCCACCGG + Intergenic
1182063672 22:27415745-27415767 CTGGGGGAGATGCCAGGCTGTGG + Intergenic
1182946996 22:34333372-34333394 CTGGCCGAGGTGCCTGGCTTGGG - Intergenic
1183104474 22:35606429-35606451 GTGACAGGTGCGCCAGGCTGTGG - Intergenic
1183258784 22:36780837-36780859 GTGGGAGAGGACCCAGGATGAGG - Intergenic
1183541344 22:38431060-38431082 GAGGCAGAGGGGACAGGGTGTGG + Intronic
1183979452 22:41531107-41531129 CTGGCCGTGGTGCCTGGCTGGGG - Intronic
1184309801 22:43633877-43633899 GTGGCAGAGGGGTCAGGCGGTGG - Intronic
1184331338 22:43829760-43829782 GTGGCAGGGGTGGGGGGCTGGGG - Intronic
1184691998 22:46121665-46121687 GGGACAGAGGAGCCAGGCTGGGG + Intergenic
1184740491 22:46426111-46426133 GAGGCAGAGCAGCAAGGCTGGGG + Intronic
950547708 3:13648451-13648473 CAGGCAGAGCGGCCAGGCTGGGG - Intergenic
950864368 3:16176827-16176849 GTGGCTGAGCAGCCAGGCTGAGG - Intronic
951296028 3:20935950-20935972 TTGGCAAAGGAGTCAGGCTGAGG - Intergenic
952410738 3:33047719-33047741 GTGACAGATGAGCAAGGCTGAGG + Intronic
952553360 3:34503968-34503990 GTTGCTGAGGGGCAAGGCTGAGG - Intergenic
952883939 3:38001587-38001609 ATGGCAGGTGTGCCAGCCTGAGG + Exonic
952884166 3:38002610-38002632 GATGTAGTGGTGCCAGGCTGGGG + Intronic
953547854 3:43877509-43877531 GTGGCTGTGGTGCAAAGCTGTGG - Intergenic
954111920 3:48438618-48438640 GTGGCAGAGGTGAGAGGAGGAGG - Intronic
954646627 3:52135634-52135656 GTCCCAGGGGTGCCAGGCTGTGG + Intronic
954797224 3:53167794-53167816 GTGGCTGTGGAGCCTGGCTGAGG + Intronic
955636668 3:61037392-61037414 GTGGTATATGTGCCAGGCTTTGG - Intronic
956790617 3:72677367-72677389 GTGGCATTGGTGCCAGGGTCTGG - Intergenic
957080923 3:75634821-75634843 AGGGGAGAGGTGCCAGGCTGTGG + Intergenic
959162340 3:102737536-102737558 CTGGCTGAGGTGCCTGGCTCAGG + Intergenic
960075541 3:113480784-113480806 GAGGCTGAGGTGAGAGGCTGAGG + Intronic
961043992 3:123696348-123696370 GTAGCAGAGCTGACAGGGTGGGG + Intronic
961331107 3:126139003-126139025 GTGGCAGAGGTGGGAGGTGGGGG - Intronic
962343425 3:134603433-134603455 GTGGCAGAGGTGGGACACTGAGG + Exonic
964339888 3:155697421-155697443 GTGGCAGAGATGGCACTCTGAGG + Intronic
967380626 3:188853566-188853588 GTAGGAGAGGTGACAGGCTAGGG + Intronic
967557591 3:190876974-190876996 GGGGCAGAGGGGCCACCCTGAGG - Intronic
967956948 3:194884728-194884750 GTGGCAGTGTTGGCAGGATGGGG - Intergenic
967991730 3:195136466-195136488 GGGGCAGAGGGGACAGGCAGGGG + Intronic
968377118 4:53151-53173 GTGGCAAGAGTGACAGGCTGGGG - Intergenic
968522011 4:1038297-1038319 ATGGCTGAGCTGCCAGGGTGGGG + Intergenic
968593330 4:1470554-1470576 GGGGCAGCAGTGCCAGGCAGTGG - Intergenic
968739245 4:2319092-2319114 GTGGCGCAGGTGCCGGGCCGTGG - Intronic
968902062 4:3436515-3436537 GTGGGAGAGGTGCCAGGCCTGGG + Intronic
968940995 4:3637556-3637578 GAGGCGGAGATGCCAGGCCGCGG + Intergenic
969219761 4:5752048-5752070 GGGGCAGAGATGGGAGGCTGGGG + Intronic
969701944 4:8772591-8772613 GTGGCAGGGGAGACAGACTGAGG - Intergenic
970858201 4:20672671-20672693 GTGTCAGCCTTGCCAGGCTGAGG - Intergenic
971196572 4:24475823-24475845 GTGACAGAGCTGCCAGGGAGAGG - Intergenic
971217222 4:24672747-24672769 GAGGCAGAACTGTCAGGCTGGGG + Intergenic
972313934 4:37908001-37908023 GTAGCAGAAGTGTTAGGCTGGGG + Intronic
972964030 4:44487195-44487217 CTGGCTGAGGTGCCAGCTTGGGG + Intergenic
974000547 4:56506887-56506909 ATGGGGGCGGTGCCAGGCTGAGG - Intronic
974178577 4:58357467-58357489 CTGGCAGAGGTGGAAGACTGTGG + Intergenic
977199424 4:94098598-94098620 GTGAGAGAATTGCCAGGCTGTGG - Intergenic
980730159 4:136812952-136812974 TGGGCAGTGGCGCCAGGCTGCGG - Intergenic
981032918 4:140143908-140143930 GAGGCAGAGGTGCCGCGATGAGG - Intronic
981082040 4:140645319-140645341 GTGGCAGCAGTGGCTGGCTGGGG - Intronic
983282555 4:165699373-165699395 GTGGGAGAGGGGTGAGGCTGTGG + Intergenic
983551104 4:169018216-169018238 GTGGCAATGGTGCTTGGCTGCGG - Intergenic
983970473 4:173865079-173865101 ATGACAAAGGTGCCAGGCTGGGG + Intergenic
984012755 4:174390144-174390166 GAGGCTGAGGTGGGAGGCTGAGG + Intergenic
984201531 4:176727097-176727119 GTGGTAGAGGAGGCTGGCTGTGG - Intronic
984316573 4:178138273-178138295 CTGGCTGAGGTGCCCGGCTTGGG + Intergenic
984555739 4:181211893-181211915 GAGGCTGAGGTGGGAGGCTGAGG + Intergenic
984846878 4:184115676-184115698 GAGGCAGAGAGGCCAGGGTGGGG + Intronic
984927382 4:184818711-184818733 GTGGCTGGGGTGCCAATCTGTGG + Intronic
985449968 4:190056316-190056338 AGGGGAGAGGTGCCAGGCTGTGG - Intergenic
985508101 5:296293-296315 GTGGGTGTGGGGCCAGGCTGGGG - Intronic
985666677 5:1184674-1184696 GTGGCTGAGCTGCTAGTCTGAGG + Intergenic
985739935 5:1609376-1609398 GTGGGTGTGGGGCCAGGCTGGGG + Intergenic
985862263 5:2480797-2480819 GTGTCAGTGGTGCCTCGCTGAGG - Intergenic
986720317 5:10556516-10556538 CTTGCAGAGGGGCAAGGCTGAGG - Intergenic
987087423 5:14483632-14483654 TGGGCACAGGTGCCAGGCTGGGG + Intronic
987856202 5:23423435-23423457 GTGGCTGAGGTGCCCGGGTTTGG + Intergenic
988136192 5:27174650-27174672 GAGGCAGAGGTTGCAGGCAGAGG - Intergenic
990602086 5:57369271-57369293 GGGGGAGAGGTGGAAGGCTGGGG + Intergenic
991044101 5:62204996-62205018 GGTGCAGATGTGTCAGGCTGGGG + Intergenic
991522827 5:67519424-67519446 ATGGCATAGGTGCCAGCCTGTGG + Intergenic
991558309 5:67921363-67921385 GTGCAGAAGGTGCCAGGCTGTGG + Intergenic
992381862 5:76245337-76245359 GTGGAAGGGGTTCCAGGATGGGG + Intronic
992400281 5:76404523-76404545 GTGGCAGAGGTACCAGGTTTGGG + Intronic
993042892 5:82835623-82835645 GAGGCAGAGTGGCCAGGATGAGG + Intergenic
994145844 5:96393867-96393889 GAGACTGAGGTGCTAGGCTGGGG + Intronic
994235898 5:97361694-97361716 CTGGCAGGGGTGGAAGGCTGGGG + Intergenic
995772323 5:115684938-115684960 GTCTCAGAGGTGGCAGGCAGTGG - Intergenic
995854077 5:116574608-116574630 GGGGCAGGGGTGCAAGGCTCTGG + Exonic
997298232 5:132783236-132783258 ATGGCAGTGCTGCCAGGTTGAGG + Intronic
998806496 5:145922157-145922179 GTGGCAGGAGTGTCAGGCTTTGG - Intergenic
999130861 5:149282150-149282172 CTGGCACAGCTGTCAGGCTGCGG + Intronic
999138343 5:149339090-149339112 ATGGCAGAGTTGAGAGGCTGTGG - Intronic
999317064 5:150591046-150591068 GAGGCAAAGGTGCCAGGCCTGGG + Intergenic
999384481 5:151144666-151144688 GGGGCTGAAGTGCCATGCTGGGG + Intronic
1000821981 5:165996141-165996163 GAGAAAGAGGTGCCAGGCTGAGG + Intergenic
1001241636 5:170075879-170075901 ATGGGCGGGGTGCCAGGCTGAGG + Intronic
1001268480 5:170292725-170292747 GAGACAGAGGTGCTAGGTTGTGG - Intronic
1001525086 5:172423190-172423212 AGGTCAGAGGTGCCTGGCTGGGG + Intronic
1001964544 5:175900977-175900999 GTTGCTGAGCTGGCAGGCTGTGG + Intergenic
1002071506 5:176681168-176681190 GTGGCAGGAAGGCCAGGCTGAGG + Intergenic
1002431625 5:179207481-179207503 GTGGCTGAGGGGGCAGGGTGGGG - Intronic
1002664114 5:180810280-180810302 GTGGCGGTGGTGACGGGCTGGGG - Intronic
1002711534 5:181198003-181198025 GTGTCAGAGCTCCCAGGATGGGG + Intronic
1003242777 6:4358935-4358957 CTGGGAAAGGTGGCAGGCTGCGG + Intergenic
1003891168 6:10565073-10565095 GTGAAAGAGGTCCCAGGCAGAGG + Intronic
1003978958 6:11371227-11371249 GTAGCAAATGTGCCAGTCTGTGG - Intronic
1004127663 6:12889154-12889176 GAGGCTGAGGTGGGAGGCTGAGG + Intronic
1004425752 6:15505864-15505886 GTGGTAGAGATGTCAGGCGGAGG + Intronic
1004634501 6:17453998-17454020 GAGGCTGAGGTGGGAGGCTGAGG - Intronic
1004634505 6:17454011-17454033 GAGGCTGAGGTGGGAGGCTGAGG - Intronic
1004866290 6:19856562-19856584 GTGGCAGTGGTGCCAGGAGGAGG + Intergenic
1004891544 6:20105659-20105681 GAGGCTGAGGTGGGAGGCTGAGG + Intronic
1005615369 6:27567451-27567473 ATTGCAGAGGTGCCAGCCTCAGG + Intergenic
1005987168 6:30882584-30882606 GTGGGAGGGATGCAAGGCTGGGG - Intronic
1006077880 6:31545995-31546017 GTGGCAGAGGGCTGAGGCTGAGG - Intronic
1006641284 6:35491029-35491051 GGGGCAGGGGAGACAGGCTGGGG + Intronic
1006948365 6:37800778-37800800 GTGGGAGGGGTGAGAGGCTGTGG - Intergenic
1007060955 6:38940587-38940609 ATGGCAGAGGGGCAAGGATGTGG + Intronic
1007260626 6:40560439-40560461 GGGGCAGAGGTGGCAGGCAAGGG + Intronic
1007425351 6:41742912-41742934 GAGGCAGAGGTGGCTGGCTACGG - Intronic
1007545487 6:42690442-42690464 GGAGCAGAGGTGCCTGGCTCAGG + Intronic
1007905169 6:45452812-45452834 GTGGGTGTGGTGCCAGGCTAGGG + Intronic
1009712843 6:67347170-67347192 CTGGCCGAGGTGCCTGGCTTTGG + Intergenic
1011355766 6:86472037-86472059 TTGGCAGTGGTGCCAGGAAGAGG + Intergenic
1011483602 6:87819477-87819499 GTGGCAGACGTGGCAAGCTATGG + Intergenic
1012145659 6:95678223-95678245 GTGGCAGAGGTACCAGAGTCAGG + Intergenic
1012634048 6:101513224-101513246 GTGTGAGAGGTTCCAGGCTATGG + Intronic
1012679721 6:102164831-102164853 GAGGCAGAGGTGGCAGGGAGCGG - Intergenic
1013009217 6:106105057-106105079 CTGGCAGAGGGGCCCGGATGGGG - Exonic
1013658128 6:112266525-112266547 CTGGCGGAGGAGCCAGCCTGTGG - Intergenic
1015898003 6:138035394-138035416 GTGGCACAGCTGTCAGGCTCTGG - Intergenic
1016361776 6:143275197-143275219 GAGGAAGAGGTGTGAGGCTGAGG + Intronic
1016384272 6:143515542-143515564 AGGGGAGAGCTGCCAGGCTGTGG + Intergenic
1016612637 6:146009787-146009809 GTGGAAAAGGAGCCATGCTGAGG - Intergenic
1016692496 6:146954441-146954463 GGGGCAGAGTTGCTAGGATGAGG - Intergenic
1018065026 6:160118729-160118751 ATGGGAGAGGGGCCAGGCAGTGG + Intergenic
1018222432 6:161594280-161594302 GAGGAAGAGGAGACAGGCTGAGG - Intronic
1018919577 6:168161858-168161880 GAAGCAAAGTTGCCAGGCTGAGG - Intergenic
1018952209 6:168386567-168386589 CTGGAAGCGCTGCCAGGCTGTGG - Intergenic
1019576751 7:1741311-1741333 TTGGCAGCGAGGCCAGGCTGGGG + Intronic
1020126962 7:5538450-5538472 TTGGCAGAGGCACCAGGCTAAGG + Intronic
1020127597 7:5541674-5541696 GTGGCAGAGATTTCTGGCTGAGG - Intronic
1020210263 7:6153802-6153824 GCGGCGGGGCTGCCAGGCTGAGG - Exonic
1020210992 7:6158239-6158261 CTGGCAGAGGTGAGTGGCTGCGG + Intronic
1022115806 7:27259578-27259600 GAGGCTGAGGTGGGAGGCTGAGG - Intergenic
1022892482 7:34715403-34715425 TTGGTAGAGGTGCCAAGGTGAGG - Intronic
1022988673 7:35685843-35685865 GTGGCAGGTGTGGAAGGCTGAGG + Intronic
1023083157 7:36544587-36544609 GTGGCACAGGGGCCACACTGGGG + Intronic
1023113076 7:36833877-36833899 GTGGCAGTGCAGCCAGGCTTTGG - Intergenic
1023712071 7:43005759-43005781 GTGGCAGAGGGGACATGCTGAGG - Intergenic
1024083777 7:45877000-45877022 GTGGAAGTGGTGGCAGGATGAGG + Intergenic
1026300545 7:69094067-69094089 TTGGCACAGGTACCAGTCTGTGG - Intergenic
1026479553 7:70765997-70766019 GTGGCAGGGGTGACAGGGTGTGG - Intronic
1026990682 7:74583638-74583660 GGGGCACAGGTCCCAGGCGGTGG - Intronic
1027186151 7:75971968-75971990 GTGGCAGATGTGAGAGGCAGGGG + Intronic
1029701180 7:102248058-102248080 GAGGCAGAGGTTGCAGTCTGCGG + Intronic
1029984789 7:104913370-104913392 GAGGCTGAGGTGGGAGGCTGAGG + Intergenic
1030029071 7:105352280-105352302 GTGGCAGAAGTGGCAGTGTGAGG + Intronic
1032335126 7:131018043-131018065 GTGGCAGAGGTGGCAGAGAGAGG - Intergenic
1032570988 7:132996731-132996753 GAGGCAGCGGTGCGATGCTGAGG + Intronic
1033347853 7:140539580-140539602 GTGGGAGAGCTGCCGGGCTTTGG - Intronic
1033403898 7:141053709-141053731 GTGTCAGCTGTGGCAGGCTGCGG + Intergenic
1034180801 7:149136267-149136289 GTTGCAGAGCGGCCAGGCAGAGG + Intronic
1034474075 7:151272842-151272864 GTACCAGAGGGGCCAAGCTGAGG - Intronic
1034677359 7:152901547-152901569 GTGTCAGGGGTGACATGCTGGGG + Intergenic
1034902448 7:154915832-154915854 GTGTCAGGTGTGCTAGGCTGAGG - Intergenic
1034939391 7:155220568-155220590 GTGGAGGAGGGGCCAGGCTGGGG - Intergenic
1035292486 7:157848735-157848757 CTGCCAGAGGTGGCAGCCTGCGG - Intronic
1035472525 7:159119515-159119537 GAGGCAGCGGTGCGAGGCAGAGG + Intronic
1037150055 8:15626180-15626202 GTGGCAGAGGCTCCAGGCCTGGG - Intronic
1037977015 8:23220963-23220985 GTGGCAGGTAAGCCAGGCTGTGG + Intronic
1038068137 8:23984555-23984577 ATGGCAGCAGTGCCCGGCTGAGG - Intergenic
1038666316 8:29540945-29540967 GTGGCAGACGTCCCAGGCAGGGG - Intergenic
1038701444 8:29853100-29853122 TTTGTTGAGGTGCCAGGCTGTGG - Intergenic
1038912644 8:31983745-31983767 GTATCAGAGGTGCTAGGTTGAGG + Intronic
1039560051 8:38505378-38505400 CTGGGAGAGGAGCCAGGCTTGGG + Intergenic
1040810292 8:51445020-51445042 GAGGCTGAGGTGGGAGGCTGAGG - Intronic
1042561611 8:70076055-70076077 GAGGCTGAGGTGGGAGGCTGAGG + Intergenic
1042724017 8:71852686-71852708 GTGACAGAGTTTCCACGCTGTGG - Intronic
1042861474 8:73318353-73318375 GTGGCACAAGTTCCAGGCTGGGG - Intronic
1043142069 8:76603001-76603023 GTTCCAGAAGTACCAGGCTGTGG - Intergenic
1045055224 8:98362843-98362865 GTTGCTGAGGTGCCCAGCTGTGG - Intergenic
1045244762 8:100433459-100433481 GAGGCTGAGGTGAGAGGCTGAGG - Intergenic
1045317308 8:101054236-101054258 GTGGCTTAGCTGGCAGGCTGTGG - Intergenic
1045892062 8:107169145-107169167 GGGGCAGAGGAGGAAGGCTGAGG - Intergenic
1046747798 8:117894729-117894751 GTGGCAGAGGTGGCTGTCTTGGG - Intronic
1048218132 8:132515524-132515546 TAGGCAAAGGTGCCAGGCTTGGG + Intergenic
1048219391 8:132527485-132527507 GGGACAGAGGTGCCTGCCTGGGG - Intergenic
1048342286 8:133549483-133549505 CGGCCACAGGTGCCAGGCTGTGG - Intronic
1048999188 8:139813881-139813903 GGGGCAGAGGTGACAGCGTGGGG + Intronic
1049288733 8:141790658-141790680 CAGGCTGAGGGGCCAGGCTGAGG + Intergenic
1049296846 8:141845310-141845332 CAGGCGGAGGTGCCAGCCTGTGG + Intergenic
1049368249 8:142251243-142251265 GTGGCATGGGGGGCAGGCTGCGG - Intronic
1049407609 8:142458623-142458645 TGGGCAGAGGTGACAGGGTGAGG - Intronic
1049528263 8:143140513-143140535 GAGGCAGAGAGGCCAGGATGGGG + Intergenic
1049880203 8:145056832-145056854 GTGGCAGCGTTGACAGGGTGAGG - Intergenic
1050149228 9:2602433-2602455 GAGGCTGAGGTGGGAGGCTGTGG - Intergenic
1052295143 9:26889615-26889637 GAGGCCGAGGTGGGAGGCTGAGG + Intronic
1052569221 9:30199273-30199295 CTGGCCGAGGTGCCTGGCTTGGG + Intergenic
1052856267 9:33408440-33408462 GAGGCAGAGGGGCTATGCTGTGG - Intergenic
1053412034 9:37922141-37922163 GTGGAGGAGGTGTCAGGCAGAGG + Intronic
1053647561 9:40132047-40132069 GAGGCAGAGGTACTAGGATGGGG + Intergenic
1053758170 9:41331796-41331818 GAGGCAGAGGTACTAGGATGGGG - Intergenic
1054537018 9:66244123-66244145 GAGGCAGAGGTACTAGGATGGGG - Intergenic
1055505910 9:76949044-76949066 GAGGCTGAGGTGGGAGGCTGAGG - Intergenic
1056644390 9:88398196-88398218 GTGGCACAGGTGGGAGGCTGAGG - Intronic
1057307847 9:93922375-93922397 GTGGCAGGGGTGACAGGAGGAGG + Intergenic
1057562493 9:96139497-96139519 CTTTCAGAGGTGCCAGGCAGAGG - Intergenic
1057575688 9:96240583-96240605 GTGGCTGAGCTCCCAGGCTCCGG + Intronic
1058175502 9:101731747-101731769 TTGGCTGAGGTGTCAGGTTGAGG + Intronic
1059111366 9:111560870-111560892 GTGGCAGAGGTGGCAGTGAGTGG + Intronic
1059278134 9:113112201-113112223 GTGAGAGAGGTGAGAGGCTGAGG + Intergenic
1060187968 9:121575385-121575407 GTGGCGGAGGAGCCAGCCTGAGG - Intronic
1060299893 9:122369049-122369071 GTGGCAGAAGTGCCAGGGCTTGG - Intergenic
1060516754 9:124270716-124270738 GTGGCAGAGGTTGCTGGGTGCGG + Intronic
1061028727 9:128067172-128067194 GTGGGTGAGGGGCGAGGCTGAGG - Exonic
1061127619 9:128686839-128686861 GTGGCAGTGGTGCTTGCCTGTGG + Intronic
1061514128 9:131078888-131078910 GGGCGAGAGGAGCCAGGCTGGGG - Intronic
1062010203 9:134263083-134263105 GTGGTGGAGTGGCCAGGCTGGGG + Intergenic
1062126055 9:134863741-134863763 TAGGGAGAGGTGGCAGGCTGTGG - Intergenic
1062254574 9:135614910-135614932 GAGGCAGGGGTGCAGGGCTGAGG + Intergenic
1062292433 9:135802790-135802812 GCAGCAGACGTGCCAAGCTGGGG - Intergenic
1062319363 9:135982902-135982924 GTGGGTGAGGGGGCAGGCTGCGG - Intergenic
1062390422 9:136331540-136331562 GGGGAAGAGGTGCTGGGCTGGGG + Intronic
1062538846 9:137032638-137032660 ATGGCAGAGGTGGCAGAGTGGGG - Exonic
1062565974 9:137164146-137164168 GAGACAGAGGGGCCAGGCGGAGG - Intronic
1062645617 9:137546688-137546710 GTGGCAGAGCTGGGAAGCTGGGG + Intronic
1203430968 Un_GL000195v1:91019-91041 AGGAGAGAGGTGCCAGGCTGTGG - Intergenic
1203435543 Un_GL000195v1:133608-133630 AGGGGAGACGTGCCAGGCTGTGG + Intergenic
1203572119 Un_KI270744v1:141095-141117 GTGGCAAGAGTGACAGGCTGGGG + Intergenic
1186532984 X:10316170-10316192 GAGGAAGAGTTGCCTGGCTGGGG + Intergenic
1186739851 X:12505781-12505803 GTGACAGAAGTGCCATACTGTGG + Intronic
1187334876 X:18373286-18373308 GTGAGTGAGATGCCAGGCTGGGG - Intergenic
1187468553 X:19547741-19547763 GGGTCAGAGGCCCCAGGCTGGGG + Intronic
1190116690 X:47629973-47629995 GAGGCAGAGGGGACAGGGTGGGG - Intronic
1190152486 X:47959506-47959528 CAGGCAGAGATGCCAGGCTGAGG - Intronic
1190303213 X:49068031-49068053 GTGGGAGTGGCGCCTGGCTGGGG - Exonic
1190445885 X:50523707-50523729 ATGGAAGAGGTGTCAGGCAGGGG - Intergenic
1193017332 X:76750099-76750121 GTGGCAGGTGGGCCAGGCTGTGG - Intergenic
1196022756 X:111007432-111007454 GTGGCAGTGGAGCCAAGCTGAGG + Intronic
1199574705 X:149302352-149302374 GTAGCAGAGGTGGCAGAATGTGG + Intergenic
1200135570 X:153873036-153873058 GTGACAGAGTACCCAGGCTGGGG + Intronic
1200304491 X:155010085-155010107 ATGGCAAAGGTCTCAGGCTGGGG - Intronic
1201771322 Y:17619776-17619798 GGGGGAGAGGTGCCAGGCTGTGG - Intergenic
1201830233 Y:18286210-18286232 GGGGGAGAGGTGCCAGGCTGTGG + Intergenic
1201935589 Y:19407457-19407479 GTGGTACAGGTGACAGCCTGGGG + Intergenic