ID: 1142033582

View in Genome Browser
Species Human (GRCh38)
Location 16:87850450-87850472
Sequence AGAGGCTGCCTGGTCCCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 240}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142033582_1142033587 23 Left 1142033582 16:87850450-87850472 CCATGTGGGACCAGGCAGCCTCT 0: 1
1: 0
2: 3
3: 24
4: 240
Right 1142033587 16:87850496-87850518 TCACCAGAGCGTGCATCCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 73
1142033582_1142033588 24 Left 1142033582 16:87850450-87850472 CCATGTGGGACCAGGCAGCCTCT 0: 1
1: 0
2: 3
3: 24
4: 240
Right 1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 51
1142033582_1142033584 -10 Left 1142033582 16:87850450-87850472 CCATGTGGGACCAGGCAGCCTCT 0: 1
1: 0
2: 3
3: 24
4: 240
Right 1142033584 16:87850463-87850485 GGCAGCCTCTCTGCAGCCATCGG 0: 1
1: 0
2: 0
3: 18
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142033582 Original CRISPR AGAGGCTGCCTGGTCCCACA TGG (reversed) Intronic
900605791 1:3523027-3523049 AGCGGCTGCCTGGATCCCCATGG + Intronic
901238151 1:7678562-7678584 AGAGGCTGCCATTTCCCACCTGG + Intronic
901272238 1:7961535-7961557 TGAGGCGGCTCGGTCCCACATGG - Intronic
901913811 1:12481962-12481984 AAGGGCTGGCTGGTCCCAAATGG - Intronic
903553916 1:24179699-24179721 AGAGCCTGCCTGGTCACATTGGG + Intronic
904092367 1:27954369-27954391 AGAAGCTGCCGGGTCCCAGCGGG + Exonic
904807509 1:33142254-33142276 AGAGGCTGACTGCTCACACCTGG - Intergenic
905905917 1:41618466-41618488 GGAGGCTGCCAGGAGCCACAAGG - Intronic
906580281 1:46930217-46930239 AGCTGCTGCCTGATCCCACCAGG - Exonic
906584938 1:46967776-46967798 AGCTGCTGCCTGATCCCACCAGG - Intergenic
906603445 1:47148673-47148695 AGCTGCTGCCTGATCCCACCAGG + Exonic
910858028 1:91715792-91715814 AGTGGCGGCATGGACCCACAGGG + Intronic
912412347 1:109487759-109487781 GGGGGCAGCCTGGTCCCACTGGG - Exonic
912764640 1:112396982-112397004 AGAGGCTGGGTGCTCCCAGAAGG - Intronic
917099500 1:171431205-171431227 AGATGCTGCCAGGGGCCACATGG - Intergenic
920624682 1:207585520-207585542 AGAAGTTGCCTGGTCCTTCAGGG + Intronic
924717683 1:246592895-246592917 AGAGGCTGCCTTTTCCCAAGGGG - Intronic
924898009 1:248363179-248363201 GGAGGCTGTCTTGGCCCACATGG + Intergenic
1062788216 10:282911-282933 GAAGGCTGCCTGCTCCCACGGGG - Intronic
1062894057 10:1089494-1089516 AGAGGCTGCCTTGTCCCAGCAGG + Intronic
1062936678 10:1395566-1395588 GGAGGCAGCCTGGGCCCTCAGGG - Intronic
1063439665 10:6062287-6062309 AGAGACTGGATGGACCCACAAGG - Exonic
1064323847 10:14330689-14330711 AGTGACTGCCTGGTGCCTCATGG - Exonic
1065791985 10:29268872-29268894 AAAGGCAGCCTGGGGCCACAAGG + Intergenic
1066065408 10:31757987-31758009 AGAGGCCTCCAGTTCCCACAGGG - Intergenic
1066249710 10:33620975-33620997 AGAAGCTCCCTGGAGCCACATGG + Intergenic
1067572474 10:47381525-47381547 AGAGGCTGGCTGGTGGCACTGGG + Intronic
1069895899 10:71679857-71679879 GCAGAGTGCCTGGTCCCACACGG - Intronic
1069956603 10:72055734-72055756 AGAGGCTGACCCATCCCACAGGG + Intergenic
1073843142 10:107521117-107521139 AGAGGGATCCTAGTCCCACAGGG + Intergenic
1074909250 10:117892628-117892650 AGAGGCTCCCCTTTCCCACATGG + Intergenic
1075655246 10:124156823-124156845 AGAGTGTGGCTGGTCACACAGGG - Intergenic
1076387109 10:130065176-130065198 AGGGGCTGCCCTGACCCACAGGG + Intergenic
1076868505 10:133181331-133181353 AGAGGCTGGCAGGTCCCCCCCGG + Intronic
1080418848 11:32092679-32092701 GCAGGCAGCCTGGTCCCAGATGG + Intronic
1080924654 11:36743927-36743949 TGAGGGTGCCTGCTCCCACCTGG + Intergenic
1081618485 11:44604592-44604614 AGAGGCTGGCTGGTTCTCCAGGG - Intronic
1081683460 11:45025039-45025061 AGGGGCTGGCTGGTCCCAGATGG - Intergenic
1081809987 11:45909252-45909274 AGGGGCTGCCTGGGCTCCCATGG - Intergenic
1081816907 11:45950637-45950659 AGAGGCTCTCTGGTCTAACAGGG + Intronic
1083955719 11:65981919-65981941 ACAGGCTGCCTGGGCCCATGGGG + Intergenic
1084004677 11:66316662-66316684 AGAGGCTGGCTGGGCCCAGTTGG + Exonic
1084054651 11:66624670-66624692 AGAGGCTGCCTGGGCTGTCATGG - Exonic
1084320420 11:68370389-68370411 GGAGGCTGCCTGCGCTCACAGGG + Intronic
1084920950 11:72469203-72469225 GCTGGCTGCCTGGTCCCACATGG + Intergenic
1085402041 11:76241239-76241261 AGAGGGAGCCTGGTTGCACATGG - Intergenic
1086367930 11:86126740-86126762 AGAGGCTGCATGGTCTTTCATGG + Intergenic
1088767660 11:112999618-112999640 AGAGGAAACCAGGTCCCACATGG + Intronic
1089929407 11:122294906-122294928 AGAAGCCACCTGGACCCACATGG + Intergenic
1090364921 11:126197835-126197857 AGAAGCTGTCTGCACCCACATGG + Intergenic
1090441381 11:126728119-126728141 AGAGGCTGCAAGGTCACAGATGG + Intronic
1090732401 11:129583112-129583134 AGAAGCTCCCTGCACCCACAGGG + Intergenic
1094553180 12:31471856-31471878 TGAGACTGGCTGGTCCCTCAAGG - Intronic
1096535942 12:52274737-52274759 CGTGGCTCCCTGGTCACACAGGG + Intronic
1097522061 12:60681677-60681699 CCAGGCTGCCTGGTCTCAGATGG - Intergenic
1100290352 12:93207894-93207916 GGAGGGTGCCTTGTCCCAGATGG - Intergenic
1102266732 12:111492210-111492232 AGAGACTGCCTGGTAATACAGGG + Intronic
1102896693 12:116603808-116603830 AGAGGCTGTCTGGGACCATATGG + Intergenic
1103341014 12:120221231-120221253 ACAGGCTCCCAAGTCCCACATGG + Intronic
1104715938 12:131016261-131016283 AGAGGCTGCCAGATCCAGCATGG + Intronic
1105458143 13:20559979-20560001 AGAGGCTGCCTGGACCCTCTAGG + Intergenic
1106658566 13:31774275-31774297 CGAGGCTGGCTAGTCTCACATGG + Intronic
1109163090 13:59001093-59001115 ATAGGCTGCCTGGCCACAAAAGG + Intergenic
1110120709 13:71877211-71877233 AGAGGCTGAATAGTCCCATATGG - Intergenic
1113344730 13:109466336-109466358 AGAGGCTGGCTGGTGTCACCTGG - Intergenic
1113796768 13:113062898-113062920 AGTGGCTGGCAGTTCCCACACGG - Intronic
1114486830 14:23067829-23067851 AGAGGCTCCATGATCCCACTCGG - Intronic
1117564577 14:56979853-56979875 AAATGCTGCCTGGTCCTGCAGGG + Intergenic
1119665293 14:76481054-76481076 AGTGGCTTCCAGGCCCCACAGGG + Intronic
1121422483 14:93825146-93825168 AGGAGCTGCCTGGCTCCACAGGG - Intergenic
1122440809 14:101730700-101730722 AGAGCCTGCCAGGCCCCACCTGG - Intronic
1122693246 14:103541339-103541361 ACTGGCTGCCTGGCCCCTCAGGG + Intergenic
1123888252 15:24748977-24748999 GGAGCCTGCCTGGGCCCCCAAGG - Intergenic
1123935909 15:25194005-25194027 AGAGGCTCCCGGATACCACAGGG + Intergenic
1124630524 15:31334278-31334300 ACAGGCTGCCTGTGGCCACAGGG - Intronic
1125892701 15:43278057-43278079 AGAGGCTGCCTGGTGTCAGCTGG + Intronic
1126669036 15:51099576-51099598 AGAGCCTCCCTGATCACACATGG + Intronic
1128660551 15:69497773-69497795 AGAGGCTGCCTGGGTTCACTTGG - Intergenic
1132657327 16:1046743-1046765 GGTGGCTGCCCGGTCCCACACGG - Intergenic
1132697404 16:1208053-1208075 ACAGGCTGCCTCGTCCCTCCAGG - Exonic
1132841902 16:1982158-1982180 AGAGGCTGACTGCTCCCTGAAGG - Exonic
1132853523 16:2035024-2035046 TGTGGCTCCCTGGCCCCACAGGG - Intronic
1133731456 16:8581943-8581965 AGAGGCTGCCTGAGCCCAGGAGG - Intronic
1134690910 16:16190610-16190632 AGAGGCAGCCTGAGCCCACCTGG + Intronic
1135322573 16:21507175-21507197 CCAGGCAGCCTGGTCCCCCAGGG + Intergenic
1136334049 16:29600312-29600334 CCAGGCAGCCTGGTCCCCCAGGG + Intergenic
1138797306 16:59984932-59984954 AATGTCAGCCTGGTCCCACATGG + Intergenic
1139745900 16:69074069-69074091 AGATGCTGCCTGGTCCCTGCTGG - Intronic
1140205545 16:72929634-72929656 AGAGGATGCCTGGGGCCACGCGG + Intronic
1140931604 16:79633216-79633238 AGAGGCTGCGTGGTGCCATCAGG + Intergenic
1141253415 16:82379594-82379616 AGAGGCTGCCTTCTCCCTCCCGG - Intergenic
1141515858 16:84544574-84544596 AGAGGATGCCTGGGCCCTCGTGG - Intronic
1141607463 16:85162790-85162812 AGAGGCGTCCTTGTCCCTCAAGG - Intergenic
1142033582 16:87850450-87850472 AGAGGCTGCCTGGTCCCACATGG - Intronic
1142034814 16:87856404-87856426 CCAGGCAGCCTGGTCCCCCAGGG + Intronic
1142141055 16:88473050-88473072 GGAGGCTGCCCGGTCCCACGGGG - Intronic
1142473352 17:175757-175779 AGCGGCTGCCTGCTCCCCCTGGG + Intronic
1143923092 17:10346443-10346465 GGAGGCTGCCTGGCTCCAGAGGG + Intronic
1144664048 17:17090202-17090224 AGAGACTCCCTGGAGCCACAAGG + Intronic
1144966255 17:19078548-19078570 GCAGGCTGCCTGGCCCCACCTGG - Intergenic
1144981663 17:19173509-19173531 GCAGGCTGCCTGGCCCCACCTGG + Intergenic
1144986561 17:19204730-19204752 GCAGGCTGCCTGGCCCCACCTGG - Intergenic
1145266427 17:21381666-21381688 GGAGGCTGCAGTGTCCCACAGGG - Intronic
1146671655 17:34742025-34742047 AGAGGGAGCCAGGTCCTACAGGG + Intergenic
1146678383 17:34789578-34789600 TGAGGCTGCCAGGGGCCACAAGG + Intergenic
1147951130 17:44108647-44108669 CCAGGCTGCCTGGGCCCTCATGG + Intronic
1148351689 17:46945975-46945997 AGAGGCTGCCCTTTGCCACAGGG - Intronic
1149319935 17:55472435-55472457 AGAGGCTTCCTTATCACACAAGG + Intergenic
1149658761 17:58323914-58323936 GGAGGCTGCCTGGGCCCCCGGGG + Intronic
1151208752 17:72528063-72528085 AGAGGCTGCCAGGTCTCACTGGG + Intergenic
1152233019 17:79124485-79124507 AGAGGATTTCTGGTACCACAGGG + Intronic
1152608626 17:81305053-81305075 AGATGGTGCCTGGTGACACAAGG - Intergenic
1152694224 17:81735578-81735600 TCCGGGTGCCTGGTCCCACAGGG - Intergenic
1203167014 17_GL000205v2_random:106772-106794 GGAGGATGCCTGGAACCACAGGG - Intergenic
1153087331 18:1303155-1303177 GGAGACTGGCTGGTGCCACAGGG - Intergenic
1154356095 18:13624229-13624251 AGAGGCTGCCTGTTACCATGAGG + Intronic
1155272997 18:24158856-24158878 AAAGGCTGGCTGGTCCCACAGGG - Intronic
1156491580 18:37499510-37499532 AGAGGGTGGCAGGTCCCTCATGG + Intronic
1157494193 18:48143494-48143516 TGAGGCTGCCTAGACCCTCAGGG - Intronic
1158523141 18:58188475-58188497 GGAGGCTGCTTGTTCCCTCAAGG + Intronic
1159959539 18:74544962-74544984 AGAGGCTGGCTGTGCACACACGG + Intronic
1161592441 19:5134922-5134944 AGAGGCTGCTGGGAGCCACAGGG + Intronic
1161783800 19:6310963-6310985 AGACGCTGCCTGGGCTCACCTGG - Intronic
1162193648 19:8966847-8966869 AGTGACTGCCTGGTCCCTCCTGG + Exonic
1162582626 19:11540069-11540091 AGAGGCAGCCCGGTCCCCTAGGG + Intronic
1163536186 19:17877943-17877965 TGAGGCTGCCTCTTCCCCCAGGG + Exonic
1163789436 19:19297820-19297842 TGAGGCTGCCTGCCCCCACGTGG - Intronic
1163826612 19:19527875-19527897 GGTGGGTGCCAGGTCCCACAAGG + Intronic
1164219655 19:23182013-23182035 ATAGGCTGCCTGCTGCCATAAGG - Intergenic
1164663661 19:30005081-30005103 AGATGCTGCCTGGTGCTACCAGG - Intronic
1165177880 19:33943296-33943318 AGAGCCTTCCTGGTCCCTCGAGG - Intergenic
1165867382 19:38947038-38947060 AGGGACTGCCTTGTCCCCCAAGG + Intronic
1167168875 19:47817879-47817901 AGAGGCTGGCAGGGCCAACAAGG - Intronic
1167853015 19:52216179-52216201 AAGAGCTGCCTGGTCCCAGAGGG - Intronic
1168039834 19:53749322-53749344 AAAGGCTGGCTGGGCCAACAAGG + Intergenic
1168573441 19:57488862-57488884 AGAGGCAGCCCCGTCCTACAGGG - Intronic
925748817 2:7068895-7068917 AGAGGCTGCCTGGCACCTCCTGG + Intergenic
926870740 2:17413100-17413122 AGAGATTACATGGTCCCACAAGG + Intergenic
927202746 2:20588701-20588723 AGGGGCTGCAAGCTCCCACATGG - Intronic
927809726 2:26174193-26174215 AGGGGCTGCCGGGCCCCACGGGG - Intronic
927855091 2:26522905-26522927 GGAGGCTGTCTGGCCCCACGAGG + Intronic
927862390 2:26568238-26568260 GGAGGCAGCCTGGTCTCAGAGGG + Intronic
930885811 2:56324585-56324607 AAAGTCTACCTGGTCCCACATGG - Intronic
933724638 2:85419489-85419511 AGAGGCTGCCCTGGCCCAGAAGG - Intronic
934220637 2:90079067-90079089 AGAGGCTTCCAGGTCATACATGG + Intergenic
934728790 2:96642925-96642947 AGAGCCTCCCTGGGTCCACATGG + Intergenic
934735486 2:96687786-96687808 AGAGGCCGATCGGTCCCACAGGG - Intergenic
935373524 2:102372214-102372236 ATAAGCTGCCTGATCCCACATGG + Intronic
935627071 2:105180308-105180330 AGAGGCTGCCTTGTCCCTACGGG + Intergenic
936046899 2:109195380-109195402 AGGGCCTGCCTGGTCCCAGAGGG - Intronic
936073238 2:109384995-109385017 TGAGGCTGGGTGGACCCACAGGG - Intronic
936508580 2:113127810-113127832 AGGGGCTGCCAGGCCCCAGAGGG + Intronic
936977886 2:118237529-118237551 AGCTGCAGCCTGATCCCACAGGG + Intergenic
938264117 2:129914028-129914050 AGGGGGTGCCTGGTCCCATGTGG - Intergenic
943529446 2:189060763-189060785 AGGGGCTTCCTGGTCCTCCAGGG - Exonic
947185865 2:227454734-227454756 GGAGGCTACCTGGTCCAAGAGGG + Intergenic
947475287 2:230441713-230441735 AGAGACTGCCTGGTTGCATATGG + Intronic
947593533 2:231397637-231397659 GGAGGCTGGGTGGTCCCAGACGG - Intronic
948619839 2:239227428-239227450 GGGGGCTGCCCGGTCCCACTTGG - Intronic
948798800 2:240420760-240420782 AGGGGCTTCCTCGGCCCACAGGG + Intergenic
1170396607 20:15932295-15932317 AGAGGCTGCCAGGTCTTGCAGGG + Intronic
1170534356 20:17325177-17325199 GGAGACAGCCTGGACCCACAGGG - Intronic
1170844642 20:19952095-19952117 GGGCTCTGCCTGGTCCCACAGGG + Intronic
1171163431 20:22949595-22949617 AGAGAGGGCCTGGGCCCACAAGG - Intergenic
1172193079 20:33073988-33074010 AGAGGCTGCCCAGGCCAACAAGG - Intergenic
1172273265 20:33666533-33666555 GGAGGCTGCCTGGGTCCTCAAGG + Exonic
1173405396 20:42760005-42760027 AGCTCCAGCCTGGTCCCACAAGG + Intronic
1174227145 20:49010327-49010349 AGAGGCTGCCTGGTGGAACACGG - Exonic
1174651647 20:52130676-52130698 AGAGCCTGCCTGGTGTCACATGG - Intronic
1175467383 20:59198563-59198585 AGAGGCCGTCTAGTTCCACAAGG - Intronic
1176090846 20:63318021-63318043 GGAGGCTGCCTGGTCCCAGGAGG - Intronic
1176404744 21:6352327-6352349 GGAGGATGCCTGGAACCACAGGG + Intergenic
1176432413 21:6636777-6636799 GGAGGATGCCTGGAACCACAGGG - Intergenic
1176718462 21:10374177-10374199 AGAGGCTTCCTGGCCGGACACGG + Intergenic
1178540470 21:33445242-33445264 ACAGGCTGCCTAGACCCTCATGG - Intronic
1178584437 21:33860522-33860544 AGAGGCTGCTTCTTCCCAGATGG - Intronic
1178811990 21:35892851-35892873 AGAGGCTGGCCCTTCCCACAGGG + Intronic
1179217527 21:39380490-39380512 AGTGGCTGCCTGGCCTCCCAAGG + Intronic
1179312492 21:40209082-40209104 AGAGGCTGCCTGTAGCCACGAGG + Intronic
1179495418 21:41768332-41768354 AGTGGCTCCCTGGTCCCCCCAGG - Intergenic
1179801794 21:43814691-43814713 GGAGACAGCCTGGTCCCACTGGG + Intergenic
1180299690 22:11027082-11027104 AGAGGCTTCCTGGCCGGACACGG + Intergenic
1181041517 22:20194779-20194801 CGAGACTTCCTGGCCCCACATGG + Intergenic
1181497453 22:23295531-23295553 AGAGGCTGCCTGCAAGCACAGGG + Intronic
1181592369 22:23893364-23893386 GGAGGCTGGCTGGTGCCACGAGG + Intronic
1181776322 22:25162253-25162275 AGAAGCTGCCTGGGCCCACAGGG + Intronic
1182099945 22:27650750-27650772 GGAGGCTGCCTGGTCCCCCGTGG - Intergenic
1182429441 22:30291274-30291296 AGTGCCTGCCTGGGCCCTCAAGG + Intronic
1183335778 22:37245001-37245023 CCAGGGTGCCTGGTCCCCCAGGG - Intergenic
1184646170 22:45896622-45896644 AGAAGCTGCATGGTCAGACAGGG - Intergenic
1185270498 22:49927401-49927423 AGAGGCTGCCTGCTCTCTAACGG + Exonic
950111457 3:10421331-10421353 AGGGGCTGCCAGCTCCCACAGGG + Intronic
950581096 3:13862609-13862631 AGAGGCTCCCTGGTTCCTCTTGG - Intronic
953023789 3:39133260-39133282 AGAGGCTGCTTTCTCCCTCAGGG + Intronic
954205601 3:49056816-49056838 GCAGGCAGCCTGGTCCCTCAGGG - Intronic
954947345 3:54437683-54437705 TGAGGATGCCTGGGACCACAAGG + Intronic
960501110 3:118439435-118439457 AGATGCTATCTGGTCCCATAAGG + Intergenic
961057594 3:123802347-123802369 AGAGGCTGCCTGGTGGCTCAGGG - Intronic
961422536 3:126817701-126817723 AGAGGCCGCCAGGTCTCAAAGGG - Intronic
961740938 3:129032843-129032865 AGAGGCGGCCTGGCCCTCCACGG - Exonic
962550663 3:136487531-136487553 ATAGGCTCTCTGGCCCCACATGG - Intronic
963525126 3:146407275-146407297 ATAGGCTGCCTGCTACCATAAGG - Intronic
964818268 3:160740789-160740811 AGAGGATGCCTGTTACCTCAAGG - Intergenic
965494545 3:169381977-169381999 AAAGGCTGCCATGTGCCACAAGG + Intronic
968579672 4:1384069-1384091 AAAGGCTGGGTGGTCCCCCAGGG - Intronic
969633380 4:8351348-8351370 AGAGCCGGCCTGGGCACACACGG + Intergenic
985519933 5:369393-369415 AGGGGCAGCTTTGTCCCACAGGG + Intronic
987862524 5:23506391-23506413 AGAGGCACCCAAGTCCCACAGGG - Intergenic
992144881 5:73835817-73835839 AGATGGAGTCTGGTCCCACAGGG - Intronic
993142036 5:84046269-84046291 AGAGCCTGGCTGGACCCACCAGG + Intronic
994042621 5:95275402-95275424 AGGGGCTCCCTGGTCCACCATGG + Intronic
995673792 5:114639106-114639128 AGAGGATACCTGGACACACAGGG + Intergenic
997353674 5:133248692-133248714 GGAGGCTGCCTGGTTCCTCAGGG + Intronic
997984826 5:138493425-138493447 AGAGGCTGCTTGGCCCTAAAAGG - Intergenic
998428370 5:142049103-142049125 AGAGGCTGCCTGGTGACTCCAGG + Intergenic
999195274 5:149777569-149777591 AGTGGCTGCCTTGTCCCTCATGG + Intronic
1001039414 5:168322327-168322349 AAAGCCTGCCTAGTCCCAGAAGG - Intronic
1001419741 5:171577595-171577617 AGAGGCAGCCTGGACCCTCAGGG + Intergenic
1003487979 6:6595906-6595928 GGGGGCTGCCAGGTCCCACAGGG - Intronic
1003983563 6:11412848-11412870 AGAGGCTGTCTGTACTCACAAGG + Intergenic
1006781285 6:36634093-36634115 GCAGGCTTCCTGGTCCCTCACGG - Intergenic
1012938261 6:105390801-105390823 ATAGACTACCTGGTACCACATGG + Intronic
1013084104 6:106840955-106840977 AGAGGCTGCCTCATTCTACAAGG - Intergenic
1019526424 7:1482459-1482481 GGAGGCTGCCCAGGCCCACAAGG + Intronic
1019621536 7:1994738-1994760 TGAGGCTTCCTGGTTCCAGATGG - Intronic
1019622934 7:2001455-2001477 AGAGCCTGCCTGGTCCCCCACGG + Intronic
1019710292 7:2515358-2515380 AGAGGCAGCCTCTTCCCCCAGGG + Intronic
1019731800 7:2632909-2632931 ACAGGCAGCCTGGTCTCCCACGG - Intronic
1021086090 7:16421832-16421854 GGAGGCTTCCTGGTTCCACCTGG + Intergenic
1024604184 7:51011277-51011299 TGAGGATGCCTGGTCTCCCATGG + Intergenic
1025191276 7:56897770-56897792 AGAGGCTCCTTGATCCCACAAGG + Intergenic
1025680670 7:63679164-63679186 AGAGGCTCCTTGATCCCACAAGG - Intergenic
1026387080 7:69860754-69860776 GTAGGATGCCAGGTCCCACAGGG + Intronic
1028338795 7:89692550-89692572 GGAGCCTGGCTGGTCCCAGATGG + Intergenic
1029667172 7:102003215-102003237 AGAGGCCCCTTGATCCCACAAGG + Intronic
1031489031 7:122365086-122365108 ACAGGCTGCCAGATGCCACATGG - Intronic
1034536371 7:151728201-151728223 AGAGACTGCCTTGGCCCTCAGGG + Intronic
1037662504 8:20939824-20939846 AGAGGCAGCATGGTAGCACAAGG + Intergenic
1038778111 8:30549118-30549140 TGAGGGTGGTTGGTCCCACAGGG + Intronic
1039472994 8:37825776-37825798 CGATGCTGCCTGGTCCCTCTGGG - Intronic
1041133029 8:54722879-54722901 ACACGCTGCCTGGTCTGACATGG + Intergenic
1042444108 8:68863573-68863595 AGAGGCTGCTTTTTCCCAGAGGG + Intergenic
1046190496 8:110788961-110788983 AGTGGCTACCTGGTCACCCATGG + Intergenic
1048214849 8:132484698-132484720 AGTGGCTGACTGGTCCCCTAGGG - Intergenic
1048967506 8:139625226-139625248 ACAGCCTGCCTGCTTCCACAGGG + Intronic
1049325568 8:142019763-142019785 ACAGGGTGCTTGGTCCTACAAGG - Intergenic
1049584275 8:143425743-143425765 GGAGGCTGCCTGGGCCCAGAGGG - Intronic
1052017148 9:23482397-23482419 GGAGGCTGCCTGTTCCCTAAGGG + Intergenic
1052337842 9:27337931-27337953 ACAGGCAGCATGGTGCCACAGGG - Intronic
1056476995 9:86962522-86962544 AGAGCCTGCCGAATCCCACATGG + Intergenic
1056843474 9:90017801-90017823 AGAGGCTGGCTGATGCCACCTGG - Intergenic
1057503571 9:95615048-95615070 AGAAGCTGCCTGGCACCAGAAGG + Intergenic
1057798581 9:98175380-98175402 AGGGGGTCCCTGGTCCCTCAAGG - Intronic
1059010726 9:110456108-110456130 AGTGGCTGCATCTTCCCACAGGG + Intronic
1061295807 9:129676103-129676125 GGAGGCTCCCAGGTCCCAGAGGG - Intronic
1061607099 9:131718841-131718863 CTAGGCTGCCTGTTCCCAAATGG + Intronic
1061656981 9:132099804-132099826 GGGAGCTGCCTGGTCCCCCACGG - Intergenic
1062721628 9:138047218-138047240 AGAGGGGGCCTGTTCCCAGACGG + Intronic
1062734548 9:138127989-138128011 AGAGGCTGCGAGTTCCCACCTGG - Intergenic
1203427078 Un_GL000195v1:51130-51152 GGAGGATGCCTGGAACCACAGGG - Intergenic
1203439124 Un_GL000195v1:171935-171957 GGAGGATGCCTGGAACCACAGGG + Intergenic
1189295854 X:39917070-39917092 ACAGGCTTCCTGTTACCACACGG - Intergenic
1190511973 X:51182528-51182550 GGAGGCTGCATGGTCACAGAGGG - Intergenic
1197809308 X:130427396-130427418 AGAGGCAGCATGGTCCCAGAAGG + Intergenic
1198243403 X:134806735-134806757 AGAGGCCACTTGGTCCCAAAGGG - Intronic
1198463424 X:136884189-136884211 AGAGAGTGCCTGCTTCCACAGGG - Intergenic
1199878599 X:151954901-151954923 AGAGGCTGCGGGGACCCTCAGGG + Exonic
1201282702 Y:12355074-12355096 ATAGGCTGCCTGCTGCCATAAGG - Intergenic