ID: 1142033583

View in Genome Browser
Species Human (GRCh38)
Location 16:87850460-87850482
Sequence ATGGCTGCAGAGAGGCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 511
Summary {0: 1, 1: 0, 2: 5, 3: 50, 4: 455}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142033583_1142033587 13 Left 1142033583 16:87850460-87850482 CCAGGCAGCCTCTCTGCAGCCAT 0: 1
1: 0
2: 5
3: 50
4: 455
Right 1142033587 16:87850496-87850518 TCACCAGAGCGTGCATCCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 73
1142033583_1142033588 14 Left 1142033583 16:87850460-87850482 CCAGGCAGCCTCTCTGCAGCCAT 0: 1
1: 0
2: 5
3: 50
4: 455
Right 1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142033583 Original CRISPR ATGGCTGCAGAGAGGCTGCC TGG (reversed) Intronic
900486556 1:2925395-2925417 CTGGGTGGAGAGAGCCTGCCGGG - Intergenic
900648953 1:3721803-3721825 ATGGCTGTGGAGTGGGTGCCAGG + Intronic
900737420 1:4307921-4307943 GTGGCTGCAGAGATGCAGGCTGG + Intergenic
900756665 1:4440159-4440181 GAGGCTGGAGAGAGGCTTCCAGG - Intergenic
900790373 1:4675925-4675947 GTTGCTGCAGAGAAGCTGCGTGG + Intronic
900951945 1:5863169-5863191 AAGGCTGCAGAGAGGCGGGGAGG + Exonic
901416547 1:9120504-9120526 AGGCCTGGTGAGAGGCTGCCTGG + Intronic
901635851 1:10669801-10669823 ACGGCTGGGGAGGGGCTGCCAGG - Intronic
901643113 1:10703046-10703068 AGGGATGCAGAGAGGAGGCCTGG + Intronic
901648523 1:10729264-10729286 ACGGCTGCAGGGGGGCTTCCTGG + Intronic
901667041 1:10831907-10831929 AGTGGTGCAGGGAGGCTGCCTGG - Intergenic
901703775 1:11059240-11059262 GTGGCTGCAGAGAGGCAGGTTGG + Exonic
902552040 1:17224941-17224963 AAGACTCCAGAGAGGCAGCCTGG + Intronic
903354764 1:22739886-22739908 CGGGCTGCAGAAGGGCTGCCCGG + Intronic
903626046 1:24730804-24730826 CTGGCTGCAGAGACTCAGCCCGG + Intergenic
903642106 1:24867312-24867334 ATGTCTGCACAGAGGCTGAGCGG + Intergenic
904051746 1:27643965-27643987 AAGGGGACAGAGAGGCTGCCAGG - Intergenic
904253939 1:29242800-29242822 AAGGCTGCAGAGAAGGGGCCTGG - Intronic
904539649 1:31224255-31224277 TTGGCTCCAGAGAAACTGCCTGG - Intronic
904850394 1:33454907-33454929 ATGCCTGCAGCCATGCTGCCAGG - Intergenic
904935781 1:34128617-34128639 ACAGCTGCACAGAGCCTGCCAGG - Intronic
905106139 1:35564650-35564672 GGGGCTGCAGAGATGCAGCCTGG - Intronic
905296111 1:36955390-36955412 ATGGATACACAGAGGCTGACAGG + Intronic
905480624 1:38259469-38259491 ATGGCTGAACAGAAGCTGCTTGG + Intergenic
906212492 1:44019889-44019911 AGGGCTGCAGGGAGGCTGTGTGG + Intronic
907429177 1:54401711-54401733 AGGGCTGCAGAGAGGTGGGCAGG + Intronic
907872168 1:58453477-58453499 ATTGCTACAGATAGGCTGACAGG - Intronic
907904616 1:58773093-58773115 ATGGCTGGAGAGTGGCAGCATGG + Intergenic
908425744 1:64005471-64005493 TTTGGTGAAGAGAGGCTGCCAGG + Intronic
909370441 1:74877539-74877561 AAGGCTGCAGAAAGGCTGGGGGG + Intergenic
909899050 1:81109800-81109822 ATGGCTGACTAGAGGCAGCCAGG - Intergenic
910110093 1:83673694-83673716 GAGGCTACAGAGAAGCTGCCTGG - Intergenic
910801807 1:91154503-91154525 ATGGGTGCAGAGATGCTTCCAGG + Intergenic
911173443 1:94795035-94795057 ATGGCTGCATAATGGCTCCCAGG - Intergenic
911232629 1:95377076-95377098 ACAGCAGCAGAGAGGATGCCAGG + Intergenic
913271902 1:117102316-117102338 CTGGCTGCAGGGTGGCTGCAGGG - Exonic
913497618 1:119442933-119442955 ATTCCTGAAGAGAGCCTGCCAGG + Intergenic
913500819 1:119471150-119471172 ATGCCTGAAGAGAGCCTGCCAGG + Intergenic
913505313 1:119511558-119511580 ATTCCTGAAGAGAGCCTGCCAGG + Exonic
913511636 1:119567946-119567968 ATTCCTGAAGAGAGCCTGCCAGG + Intergenic
913515865 1:119605269-119605291 ATGCCTGAAGAGAGCCTGCCAGG + Intergenic
914355249 1:146879222-146879244 ATGACTTCAGAGAGGTGGCCAGG - Intergenic
916571796 1:166034409-166034431 AGGGCTGCAGGGAGGAAGCCTGG + Intergenic
917945762 1:179968982-179969004 ATGGCTCCCGGAAGGCTGCCTGG - Intronic
918110181 1:181448865-181448887 GACTCTGCAGAGAGGCTGCCTGG + Intronic
918290746 1:183105497-183105519 ATGGCTCAAGACAGGCTGACTGG - Intronic
919739275 1:200972558-200972580 ATGGCTGGTGTAAGGCTGCCCGG + Intronic
920849714 1:209620368-209620390 ATAGGTCCAGGGAGGCTGCCTGG + Intronic
921272325 1:213483696-213483718 ATGGCTGCAGAGATGCTAACAGG - Intergenic
921921880 1:220678797-220678819 AGGGCTGCAGGGAAGCTGCCAGG - Intergenic
922503336 1:226112103-226112125 TTGGCTGCAGAAAGCCTGCCAGG + Intergenic
923758785 1:236819971-236819993 ATGGCTCCCGGAAGGCTGCCTGG - Intronic
924645642 1:245875014-245875036 ATGGCTGCAGAGCTGCTTGCAGG - Intronic
1062824368 10:557448-557470 GTGGATGCAGACAGGCTCCCAGG + Intronic
1062832388 10:614462-614484 CTGGCTGCAGCCAGGCTGCATGG - Intronic
1063379302 10:5574450-5574472 AGAGGTGCAGAGAGGCTGCGGGG + Intergenic
1063534850 10:6873381-6873403 ATGCCTGCAGAGGGGCTGCCTGG - Intergenic
1064898144 10:20262489-20262511 ATGGCAGCCTGGAGGCTGCCTGG - Intronic
1065122740 10:22544499-22544521 CTGGCTCCAGAGAGGCTTCCAGG - Intronic
1065458663 10:25934029-25934051 CTGGCTGCCGAGGGGCTTCCCGG - Intergenic
1067348665 10:45456349-45456371 ATGGCTGGACAGTGCCTGCCCGG + Exonic
1067565064 10:47330545-47330567 GGGGATGCAGAGAGGCTGCCAGG + Intergenic
1067757145 10:49013764-49013786 GTGGGAGCAGAGAGGCTTCCTGG + Intergenic
1067951289 10:50740170-50740192 ATCCCTGCAGAGAGCCTGACGGG + Intronic
1069757890 10:70785042-70785064 GCGGCTGTAGAGAGGCTGACAGG + Intronic
1069942554 10:71965121-71965143 CGGGCAGGAGAGAGGCTGCCTGG + Intronic
1070059314 10:72967187-72967209 ATGGGTCCAGAGATGCTGTCTGG + Intergenic
1070307421 10:75247959-75247981 CTGGGCCCAGAGAGGCTGCCAGG - Intergenic
1070321027 10:75354763-75354785 ATCGCTGCACAGAGAATGCCAGG + Intergenic
1070658830 10:78290336-78290358 GTGGCGGCAGAGAGGGTGCTGGG + Intergenic
1070761251 10:79025645-79025667 GAGGCGGCAGAGAGGCTGGCAGG - Intergenic
1074406174 10:113181915-113181937 AGGGGTGCAGAGAGGCTGAAAGG - Intergenic
1075437757 10:122458192-122458214 AGGGCTGCAGAGAGGATGTTGGG + Intergenic
1075598601 10:123750353-123750375 GTGGCTGGAGAGAGGCCGGCTGG - Intronic
1075698868 10:124455598-124455620 AGGGATGCAGTGAGGCTCCCAGG - Intergenic
1075709666 10:124523888-124523910 AGGGCTGCTGAGAGGATGTCTGG - Intronic
1075815775 10:125264025-125264047 TTGGATGCAGAGAGGGTGCTCGG - Intergenic
1075819785 10:125296905-125296927 AGAGCTGCAGAGAGGTTGCTGGG - Intergenic
1075995966 10:126876550-126876572 GTGACTGCAGAGAGGGGGCCTGG - Intergenic
1076340265 10:129740689-129740711 ATGCCTGCAGAGAGGCTTTCAGG + Intronic
1076632956 10:131862893-131862915 ATGGCTGCTGAGTGACTGACAGG + Intergenic
1076816423 10:132917198-132917220 ATGTCTGCTGAGTGGCTCCCAGG - Intronic
1076889859 10:133278099-133278121 CAGGCTGCCGAGAGGCTCCCAGG + Intergenic
1077185498 11:1233820-1233842 TTTTCTGCAGAGAGGCTCCCAGG - Exonic
1077340636 11:2024850-2024872 AGGGCTGCAGAGGGGCTTGCTGG + Intergenic
1077483406 11:2827096-2827118 TGGGCTGCAGAGAGGAGGCCAGG + Intronic
1077535007 11:3119791-3119813 TTGGCTGCAGAGAGGCGGGTAGG + Intronic
1077719410 11:4612493-4612515 TTGGCTGCAGATAGGTTGCTAGG - Intergenic
1077892343 11:6428404-6428426 ATTGCTGCAGAGTGGATACCAGG - Intergenic
1078840700 11:15073743-15073765 ATGGCGGCGGAGAGGCAGACAGG - Intronic
1078930806 11:15910861-15910883 ATGGCAGGAGTGAGGCAGCCTGG - Intergenic
1081567317 11:44268098-44268120 AAGGCTGCAGACAGGATGCAGGG - Intronic
1081806360 11:45892971-45892993 AGGGCTGCAAAGAGGCAGGCTGG + Intronic
1081836574 11:46160342-46160364 ATGGCTCCTTGGAGGCTGCCAGG + Intergenic
1082081772 11:48017756-48017778 CTGGCTGCAGAGAGCCTGGTGGG + Intronic
1083052277 11:59787985-59788007 ATGGCAGGAGACAGGCTGGCTGG - Intronic
1083157975 11:60837087-60837109 CAGGGTGCAGAGAAGCTGCCTGG - Intergenic
1083656022 11:64230173-64230195 CTGGCTCCAGAGAGGCTCCGGGG + Intronic
1083870222 11:65482909-65482931 ATAGGTTCAGAGAGGCTCCCCGG + Intergenic
1083890682 11:65594297-65594319 AGGGCTGCAAAGAGGCAGCATGG + Intronic
1084214351 11:67639471-67639493 ATGGAGACAGAGAGGCTGTCCGG + Exonic
1084287770 11:68142871-68142893 GTCGCAGGAGAGAGGCTGCCAGG - Intergenic
1084421338 11:69062202-69062224 ATTGCTGCAGGGAGGGTACCAGG + Intronic
1084642000 11:70431743-70431765 GTGGCTGCAGACATGCTGTCCGG + Intronic
1085309284 11:75506697-75506719 GAGCCTGCAGAGGGGCTGCCTGG + Intronic
1085465406 11:76719966-76719988 GTGGCAGCAGAGCGGGTGCCCGG - Intergenic
1085531493 11:77194722-77194744 ATGGCCCCACAGAGGCTGCAAGG - Intronic
1086496827 11:87412600-87412622 ATGGCTGAACAGATGCAGCCAGG + Intergenic
1086917307 11:92545704-92545726 ATGGAAGCAGAGAGACAGCCAGG + Intronic
1088371176 11:109090013-109090035 ATAGCTCCAGAGATGGTGCCAGG + Intergenic
1088798950 11:113288215-113288237 AGGCCTGAAGAGCGGCTGCCTGG - Intergenic
1089384893 11:118060939-118060961 AGGGCTGGAGAGGGGCAGCCTGG - Intergenic
1089765002 11:120756815-120756837 AAGCCTGCAGAGAAGCTGCCAGG - Intronic
1089924069 11:122238860-122238882 ATCCCAGCAGAGAGGCTGCCTGG - Intergenic
1090056709 11:123430507-123430529 AGGGCTGCCGAGTGGCTGGCAGG + Exonic
1090066069 11:123504602-123504624 GTGGATGGAGAGAAGCTGCCTGG - Intergenic
1090080432 11:123608932-123608954 AAGGCTGGAGAGAGGGTGTCTGG - Intronic
1090268653 11:125370703-125370725 ATGGCTGCAGAGAGGGCGGCTGG - Intronic
1091051638 11:132377972-132377994 ATGGCTGCATACAAGCTACCAGG - Intergenic
1202823621 11_KI270721v1_random:80039-80061 AGGGCTGCAGAGGGGCTTGCTGG + Intergenic
1091388330 12:109394-109416 AAGGCTGCAGAGAGGCCGGGGGG - Intronic
1091650573 12:2306078-2306100 AGGACTGCAGTGAGGCTGCCTGG - Intronic
1091763286 12:3101853-3101875 ATGGCTGCAGCAAGGCCGCCAGG - Intronic
1091826910 12:3519683-3519705 AAGGCTGCAGAAAGGCTGGGGGG + Intronic
1092283260 12:7113541-7113563 AAGGCTGCAGAGAAACTCCCTGG - Intergenic
1092529383 12:9331887-9331909 GTGGCTGCAGGGAGGCTGGGGGG + Intergenic
1092891693 12:12975026-12975048 ATGCCTGGAGAAAAGCTGCCAGG + Exonic
1092919116 12:13214919-13214941 GTGGCTGCAGGGAGGCTCTCTGG - Exonic
1096194062 12:49637627-49637649 GGGGGTGCAGAGAGGCTGGCAGG - Exonic
1096612799 12:52814057-52814079 ATGGCTGCAGAGAGCGAGCTGGG + Exonic
1096870794 12:54590868-54590890 ATGGCTGATGAGGGGCTGCGTGG + Intergenic
1098925713 12:76348101-76348123 AGAGCTCCACAGAGGCTGCCTGG + Intronic
1101433204 12:104644147-104644169 ATTGCTGCTCAGAGGCTGCTGGG + Intronic
1101731005 12:107426733-107426755 ATGGCAGCAGAGGGGAGGCCAGG - Intronic
1101858117 12:108461072-108461094 TTGGCTGCAGAGTGGGTGCTGGG - Intergenic
1103009557 12:117447880-117447902 ATGGCTGCAGGCAGGCAGCTGGG - Intronic
1103332123 12:120161632-120161654 ATGGCTGGCGGGAGGCTGACAGG - Intronic
1103358966 12:120342510-120342532 AGGGCTGGAGGGAGGCGGCCAGG + Exonic
1103526888 12:121575164-121575186 GATGCTGGAGAGAGGCTGCCTGG + Intronic
1103587848 12:121969387-121969409 ATGGCCTCAGAATGGCTGCCTGG + Intronic
1103961266 12:124610517-124610539 AAGGTTCCAGAGAGGCTTCCTGG + Intergenic
1104270353 12:127277899-127277921 GTGGCTGCAGGGAGGATGCGGGG + Intergenic
1105419590 13:20240380-20240402 AGGGCTGCCGAGAGGGCGCCAGG + Intergenic
1107424168 13:40276194-40276216 AGTGGTGCAGGGAGGCTGCCCGG - Intergenic
1107803155 13:44129577-44129599 CTTTCTGGAGAGAGGCTGCCAGG - Intergenic
1109582948 13:64365359-64365381 ATGGCTGCATACAAGGTGCCAGG - Intergenic
1109792427 13:67267346-67267368 ATGGCTCCTGGAAGGCTGCCTGG + Intergenic
1111140496 13:84112333-84112355 AAGGCTGCAGAGAGCCTGGGAGG - Intergenic
1112306679 13:98280533-98280555 ATAGCTGCACAGAGCCTGGCCGG + Intronic
1113736810 13:112684999-112685021 ATGTCTGGAGAAAGGCTGCCTGG + Intergenic
1113751218 13:112777727-112777749 AAGGCTGCCGGAAGGCTGCCAGG + Intronic
1114432266 14:22671586-22671608 GTGGGTCCAGAGATGCTGCCTGG - Intergenic
1115117241 14:29895669-29895691 AGGACAGCAGCGAGGCTGCCAGG - Intronic
1115174591 14:30547730-30547752 GTAGCTGCAGACAGGGTGCCGGG - Intergenic
1115241018 14:31251132-31251154 AAGGCTGCAGTGAGCCTGTCAGG - Intergenic
1115418928 14:33169718-33169740 ATGAGTACAGAAAGGCTGCCAGG + Intronic
1116162516 14:41288200-41288222 ATGGCTGACTAGAGGCAGCCAGG + Intergenic
1118490380 14:66253490-66253512 AAGGCTCCAGAGAGACTGCTTGG - Intergenic
1118847146 14:69556048-69556070 AGGGATGCAGAGAGGCTGACTGG - Intergenic
1119169617 14:72524513-72524535 ATGCCAGCACAGTGGCTGCCTGG + Intronic
1119262033 14:73243535-73243557 AGGACTGCAGTGAGGCTGGCCGG + Intronic
1119664528 14:76475167-76475189 AAGGATGCAGAGAGCCAGCCTGG + Intronic
1120870235 14:89330149-89330171 AGGGCTGCAGAGATTCTGACAGG + Intronic
1121109384 14:91302349-91302371 ATGGCTAAAGAGAGGCTCTCAGG - Intronic
1121337259 14:93085016-93085038 GTGTTTGCAGAGAGCCTGCCAGG - Intronic
1121902872 14:97709768-97709790 AGGGGTGGAGAGAGGCTGCCCGG + Intergenic
1122116901 14:99532245-99532267 AGGGCTGCAGACAGGAGGCCAGG + Intronic
1122479743 14:102039304-102039326 TTGGCCGCACAGAGGCTGGCGGG + Intronic
1123769989 15:23519558-23519580 ACAGCTGAAGAGCGGCTGCCTGG - Intergenic
1124097889 15:26666454-26666476 AGGGCTGCAGTGACCCTGCCAGG + Intronic
1125502041 15:40245885-40245907 ATGGCTTGGGAGAGGCGGCCTGG + Intronic
1125728044 15:41878088-41878110 TGGGCTGCAGAGAGCCTCCCAGG + Intronic
1128525585 15:68410222-68410244 AGGGCTGCGGAGAGGCTTCTGGG - Intronic
1128698391 15:69786263-69786285 ATGAATTCAGAGAGGCAGCCAGG - Intergenic
1128740713 15:70082095-70082117 CTGGCTGCTGGGAGGCTGCTGGG - Intronic
1129782371 15:78281276-78281298 GTTGCTGCACTGAGGCTGCCGGG - Exonic
1129793738 15:78360641-78360663 CTGGCTTCACTGAGGCTGCCAGG - Intergenic
1129998036 15:80023656-80023678 ATGGCTCCAGAGAGACTGGCAGG - Intergenic
1130223282 15:82039306-82039328 ATGGTTGCAGAAAGGCTCACAGG + Intergenic
1130547919 15:84869801-84869823 ATGCCCTCAGAGAGCCTGCCTGG - Exonic
1130687926 15:86055392-86055414 ATGGGTTCAGAGAGACTGTCTGG + Intergenic
1131019376 15:89085536-89085558 AGAGCTGCAGAGAAGATGCCCGG + Intergenic
1131226315 15:90627161-90627183 ATGATTGCAGTGATGCTGCCTGG + Intronic
1132382111 15:101373207-101373229 CTGCCTGCAGGGAGGCTGGCTGG + Intronic
1132799460 16:1744511-1744533 AGGGCTGGAGAGAGGGTGGCGGG + Intronic
1132939233 16:2498791-2498813 AAGGCTGGAGGGAGGCTCCCTGG - Intronic
1134022829 16:10933284-10933306 AACTCTGCAGAGAAGCTGCCTGG + Intronic
1135531398 16:23257900-23257922 AGGGCTGCACATAGGCTGCTAGG - Intergenic
1136517773 16:30778158-30778180 AGGACTGCAGAGTGGCCGCCTGG - Intergenic
1137274839 16:46926647-46926669 ATGCCTGTTGAGTGGCTGCCTGG + Intronic
1138446888 16:57070278-57070300 AAGGCTGCAGAGAGGAAGCTGGG - Intronic
1139466063 16:67154861-67154883 CTCACTGCAGCGAGGCTGCCGGG - Exonic
1139978766 16:70836308-70836330 ATGACTTCAGAGAGGTGGCCAGG + Intronic
1141413868 16:83855156-83855178 ATGGCTGCAAAGTGCCTGCGTGG - Intergenic
1141453163 16:84119275-84119297 ATCTCTGCAGAGTGGCTGCTGGG - Intergenic
1141480693 16:84304791-84304813 AGGGCTGCAAAGAGGGGGCCAGG + Intronic
1141826362 16:86483514-86483536 TTAGCTGCAGAGATGATGCCTGG + Intergenic
1142033583 16:87850460-87850482 ATGGCTGCAGAGAGGCTGCCTGG - Intronic
1142696946 17:1639040-1639062 ACGCCAGCAGAGGGGCTGCCCGG - Intronic
1142862511 17:2771389-2771411 GTGGCTGCAGAAGGGTTGCCAGG - Intergenic
1143855566 17:9845423-9845445 ATGCCTGCAGAGAGGCTAGGTGG - Intronic
1144336769 17:14278440-14278462 ATGGGAGCAGGGAGGCTACCTGG + Intergenic
1144672771 17:17142322-17142344 GTGGCTCAGGAGAGGCTGCCGGG + Intronic
1146252924 17:31365671-31365693 AGGGGAGCAGAGGGGCTGCCAGG + Intronic
1146331982 17:31935115-31935137 AGGGCTCCAGAGACACTGCCTGG + Intergenic
1146496869 17:33330360-33330382 AGGACTGCAGGGAGGCTGCTGGG + Intronic
1147364400 17:39951025-39951047 CTGGCTGCAGTGGAGCTGCCTGG - Intergenic
1148338137 17:46855204-46855226 GTGGCTGCAGAGAGGCCGAAGGG + Intronic
1148339926 17:46867363-46867385 ATGGCTGGAGCCAGACTGCCTGG - Intronic
1148381063 17:47198118-47198140 AATGCAGCAGAGAGGCTGCCAGG + Intergenic
1149343072 17:55706910-55706932 ATGGCAGGAGAGATGTTGCCAGG + Intergenic
1151184211 17:72351361-72351383 ATGGCTGCATCGAGGCCGCCTGG + Intergenic
1151912550 17:77093516-77093538 TTGGCTGCAGAGGGGAGGCCTGG + Intronic
1152181067 17:78822176-78822198 AGCTCTGCAGAGAGACTGCCAGG - Intronic
1152327556 17:79650475-79650497 GTGGCTGCAATGAGGCTGGCAGG - Intergenic
1152386052 17:79975430-79975452 AAGGCTGCTGAGAGCCAGCCAGG + Intronic
1152441505 17:80312728-80312750 TTGGCAGGACAGAGGCTGCCTGG + Intronic
1152661324 17:81543649-81543671 CTGGCTGGGCAGAGGCTGCCTGG - Intronic
1203173737 17_GL000205v2_random:175634-175656 AGGGCTGGGGAGAGGTTGCCTGG + Intergenic
1154213542 18:12399313-12399335 GTGACTGCTGAGAGGCTGCCAGG - Intergenic
1155990250 18:32272522-32272544 ATGACTGCAGAAAGGATGCCCGG + Intronic
1156482244 18:37443591-37443613 ATGGCTGGAGAGTGGCTCCAAGG + Intronic
1156617234 18:38801763-38801785 ATGCATGCTGAGAGGATGCCAGG - Intergenic
1156623734 18:38883884-38883906 AAGGTTGCAGAGAGGGTGCGTGG + Intergenic
1158044157 18:53135122-53135144 AAGGGTGCAGAGAGGGTGTCTGG - Intronic
1160019802 18:75171610-75171632 AGTGCTGCAGAGAGGCTGAGAGG + Intergenic
1160256401 18:77251358-77251380 ATCTGTGCAGAGAGGCTTCCTGG + Intronic
1160470210 18:79124947-79124969 ATGGCTTCAGAAAGACAGCCAGG + Intronic
1161570927 19:5030569-5030591 CGGCCTGCAGAGAGGCAGCCAGG + Intronic
1161626652 19:5330830-5330852 CAGGGTGCAGAGAGGCTGCCAGG - Intronic
1161678578 19:5667370-5667392 ATGGCCGAAGAGAGGATGACCGG + Exonic
1163370691 19:16899696-16899718 CTGGGTGCTGAGAGGCTGGCAGG - Intronic
1163404249 19:17112614-17112636 ATGGCTGCAGGGGAACTGCCCGG + Intronic
1163726020 19:18923540-18923562 TTGGCTGCAGGGTGGCTGTCAGG + Intronic
1164603578 19:29579872-29579894 GTGCCTGCTGTGAGGCTGCCAGG + Intergenic
1164701753 19:30289633-30289655 TTGGCTCCAGAGTGGGTGCCTGG + Intronic
1165137822 19:33681482-33681504 ATGTCCTCAGGGAGGCTGCCAGG - Intronic
1165291510 19:34889817-34889839 CAGTCTGCAGACAGGCTGCCTGG - Intergenic
1165702467 19:37948992-37949014 ATGGCATCAGAGAGGGAGCCAGG + Intronic
1165823434 19:38691991-38692013 CTGGCTGCAGGGAGGGGGCCGGG + Intronic
1166997024 19:46724476-46724498 ATGGCAGAGCAGAGGCTGCCAGG + Intronic
1168644451 19:58051157-58051179 AGGGCAGCAGAGGGGCTGCGTGG - Intronic
925058477 2:873250-873272 AGGGCTGCTGAGATGCTGCAGGG - Intergenic
925093625 2:1175910-1175932 ATCGTTGAAGGGAGGCTGCCTGG + Intronic
925918819 2:8625633-8625655 ATGGCTGGAATGAGGCTCCCAGG + Intergenic
926147237 2:10404279-10404301 ATGGCTGGAGAAGGGCTGGCGGG - Intronic
926332483 2:11837004-11837026 GTATCTGCAGAGAGGCTGCCTGG + Intergenic
926337764 2:11877056-11877078 ATGGGTCCAGAGAGGATGTCTGG - Intergenic
927626209 2:24721687-24721709 ATGGCTGAACAGCTGCTGCCAGG - Intronic
929564075 2:42974024-42974046 GTGGCTACAGAGAGGCTGCTAGG + Intergenic
929657740 2:43750970-43750992 TGGGCTGGAGACAGGCTGCCTGG + Intronic
932447688 2:71790868-71790890 CTGCAGGCAGAGAGGCTGCCAGG - Intergenic
932579498 2:72984273-72984295 ATGGCTGCAGTGAGCATCCCAGG + Intronic
932793000 2:74672203-74672225 GTGGGGGCAGAGAGGCTGCTGGG - Intronic
933722993 2:85410076-85410098 ATGGCAGCTGTGAAGCTGCCCGG - Intronic
933791615 2:85888325-85888347 CTGGCTGCAGAGAGGGTGCAGGG + Intronic
933835017 2:86238954-86238976 ATGCCTGCAGAAAGGCTACGTGG + Intronic
934078585 2:88448711-88448733 ATGGCTCCACAGTGGCTGCTGGG - Exonic
934770358 2:96903756-96903778 TTGCATGCAGAGAGGCTCCCTGG + Intronic
935268183 2:101412163-101412185 ATGGCTACAGGGAGGGTGCCAGG - Intronic
936737856 2:115468386-115468408 GTGGCTCCTGAAAGGCTGCCAGG - Intronic
937236323 2:120433664-120433686 GAGGCTGCAGAGAGGCTGCGTGG + Intergenic
937239150 2:120449258-120449280 ATGGCTGCAGTCTGGCTGCAGGG - Intergenic
937660999 2:124429702-124429724 ATTGGTGCAGAGAGGATGCACGG - Intronic
937743266 2:125380742-125380764 ATGCCTGCAAAGAAGTTGCCTGG + Intergenic
937864085 2:126735049-126735071 AAGGCTGGAGAAAGGCTGCAGGG - Intergenic
937867059 2:126760337-126760359 ATGGCTGCAGAGCAGGTACCAGG - Intergenic
937989448 2:127654197-127654219 ATGGCTCCCGAGAGGCTGCCAGG + Intronic
938114121 2:128591764-128591786 GTGGCTGCAGAGATGCTGGTGGG + Intergenic
938125727 2:128669954-128669976 GTGGCTGCAGGGAGGCAGCCGGG + Intergenic
938255700 2:129858408-129858430 AAGGCAGGAGAGAGCCTGCCAGG + Intergenic
938980216 2:136519268-136519290 GTGACTGATGAGAGGCTGCCTGG + Intergenic
939304393 2:140391953-140391975 ATGGCTGGAGTGAGACTGTCTGG + Intronic
939952961 2:148497622-148497644 AAGGCTGCAGTGAGCATGCCAGG + Intronic
940582760 2:155601584-155601606 GTGGCTGCTGTGAGGGTGCCAGG - Intergenic
941718528 2:168788572-168788594 ATCCCTGCAGAGGGGCAGCCTGG + Intronic
941749410 2:169119319-169119341 ATGTTTGAAGAGAGGCTGCTGGG + Intergenic
942195115 2:173509413-173509435 TAGGCTGCAAAGATGCTGCCTGG - Intergenic
942348724 2:175030740-175030762 ATGTCAGCAGAGAGGCTGCCTGG - Intergenic
942469213 2:176242443-176242465 ATGGCTCCTGGAAGGCTGCCTGG - Intergenic
942862860 2:180636578-180636600 ATGGGTCCAGAGATGCTGTCTGG - Intergenic
944078712 2:195760307-195760329 ATGAGTCCAGAGATGCTGCCTGG - Intronic
944605445 2:201347887-201347909 AAAGCTGGGGAGAGGCTGCCGGG - Intronic
945059440 2:205895997-205896019 AAGGATGCTGAGAGTCTGCCTGG - Intergenic
945323398 2:208454044-208454066 CTGACTGCAGGGAGGCTGCCTGG + Intronic
947304903 2:228734730-228734752 ATGGCTGCAGAAAGCATGCATGG - Intergenic
947971602 2:234329462-234329484 ATGGCTGCTGCGCGGCTTCCTGG - Intergenic
948000163 2:234560935-234560957 ATGGCCCCAGGGAGGCTGCAGGG + Intergenic
948109011 2:235439604-235439626 GTGGCTGCAGAGGGGCCACCTGG + Intergenic
948482220 2:238257395-238257417 AGGCCTGCAGAAGGGCTGCCTGG - Intronic
948537093 2:238654418-238654440 CTGCCTGCAGGGAGGCTGCCTGG + Intergenic
1170909246 20:20547608-20547630 ATGGCTTCAGAGATGTGGCCTGG - Intronic
1171284140 20:23923859-23923881 AGGGCTGGATAGGGGCTGCCAGG - Intergenic
1171337259 20:24395513-24395535 CTGTCTCCAGAGAGGCTGCCAGG - Intergenic
1171852704 20:30319776-30319798 AGGGCTGCACACAGGATGCCAGG - Intergenic
1173021834 20:39273751-39273773 AGGGCTGCAGTGAGTCCGCCTGG + Intergenic
1173433398 20:43011447-43011469 ATGGCTGCAGAAGGGCTGGTGGG - Intronic
1174065243 20:47860023-47860045 GTGGCTGCAGAGAGGCAGGATGG - Intergenic
1174242280 20:49146636-49146658 AAGGCTGCAGTGAGCCTGCATGG + Intronic
1174482069 20:50838354-50838376 GTGGCTCCAGAGTGCCTGCCGGG + Intronic
1175016956 20:55801903-55801925 AGGGATGCAAAGATGCTGCCAGG + Intergenic
1175245821 20:57581389-57581411 GTGGCAGCAGAGAGGTGGCCAGG - Intergenic
1175699663 20:61127831-61127853 GAGGCTGCAGTGATGCTGCCAGG + Intergenic
1175940774 20:62536591-62536613 AGGGCTGGAGCCAGGCTGCCTGG - Intergenic
1176021587 20:62965035-62965057 ATGGCTGCAGAGGGGCAGCAGGG - Intronic
1176102664 20:63371673-63371695 GTGCCTGCGGTGAGGCTGCCTGG + Intronic
1176121161 20:63455176-63455198 TGGGCTGCAGAGAAGCTGCTCGG - Intronic
1176295683 21:5070905-5070927 ATGGATGGAGGGAGGCTCCCAGG + Intergenic
1176327976 21:5518942-5518964 AGGGCTGGGGAGAGGTTGCCTGG - Intergenic
1176329728 21:5537280-5537302 AGGGCTGGGGAGAGGTTGCCTGG + Intergenic
1176398029 21:6283671-6283693 AGGGCTGGGGAGAGGTTGCCTGG - Intergenic
1176399781 21:6302009-6302031 AGGGCTGGGGAGAGGTTGCCTGG + Intergenic
1176437376 21:6687095-6687117 AGGGCTGGGGAGAGGTTGCCTGG - Intergenic
1176439128 21:6705433-6705455 AGGGCTGGGGAGAGGTTGCCTGG + Intergenic
1176461638 21:7014165-7014187 AGGGCTGGGGAGAGGTTGCCTGG - Intergenic
1176463390 21:7032502-7032524 AGGGCTGGGGAGAGGTTGCCTGG + Intergenic
1176485199 21:7395943-7395965 AGGGCTGGGGAGAGGTTGCCTGG - Intergenic
1176486951 21:7414281-7414303 AGGGCTGGGGAGAGGTTGCCTGG + Intergenic
1176882738 21:14216539-14216561 AGGGCTTCCCAGAGGCTGCCTGG + Intronic
1177212909 21:18091986-18092008 ATGTGTCCAGAGATGCTGCCTGG - Intronic
1179015876 21:37594196-37594218 AATGCTGAAGGGAGGCTGCCAGG - Intergenic
1179290581 21:40014583-40014605 AAGGCTGCAGTGAGGCTGATGGG - Intronic
1179534027 21:42039836-42039858 CTGGCTGCAGGGCGGCTGCTGGG + Intergenic
1179861364 21:44191219-44191241 ATGGATGGAGGGAGGCTCCCAGG - Intergenic
1179974030 21:44853588-44853610 AGGCCTGCAGAGATGCTGCTGGG + Intronic
1179990186 21:44944066-44944088 GTGGCTTCAGCGTGGCTGCCAGG - Intronic
1180695482 22:17749124-17749146 ATGCCTTCCCAGAGGCTGCCAGG + Intronic
1181106390 22:20578349-20578371 AGGGCTGCAGAGCAGCTGCCTGG - Intronic
1181945343 22:26512559-26512581 ATGGCTGCAGAGCGGCCGGCTGG + Intergenic
1182129910 22:27843435-27843457 ATGGTCACAGGGAGGCTGCCTGG + Intergenic
1182299630 22:29330347-29330369 AAGGCTGCAGGGCGGGTGCCGGG + Intronic
1182518504 22:30872110-30872132 AAGGATGCTGAGAGGCTGCTGGG + Intronic
1183213467 22:36465033-36465055 TTGCCTGCAGAGAGGCGGCAGGG - Intergenic
1183405589 22:37629148-37629170 CTGGCAGCAGAGAGCCTGCAGGG - Intronic
1183407343 22:37636857-37636879 AAATCTGCACAGAGGCTGCCAGG + Intronic
1183746345 22:39694163-39694185 ATGGGGGCAGAGAGGTGGCCGGG + Intergenic
1183829548 22:40410489-40410511 CTGGCTGCAGTGAGGCGGCGGGG + Exonic
1184175077 22:42784473-42784495 ATGGCTGCAGAGAAGCAGCATGG - Intergenic
1184208875 22:43023571-43023593 CTGCCTCCAGAGGGGCTGCCTGG - Intergenic
1184554189 22:45224488-45224510 ATGGCAGGAGGGAGACTGCCCGG + Intronic
1184565096 22:45287153-45287175 ATGGCTGCAGAGGCGGTGCAGGG - Exonic
1184617248 22:45646331-45646353 TTGGCTGCAGAGGGGCAGCCGGG + Intergenic
1184777089 22:46628654-46628676 AGGGCTGCAGTGAGGGGGCCAGG + Intronic
1185005191 22:48271723-48271745 GTGGAGGCTGAGAGGCTGCCAGG + Intergenic
1185213144 22:49583261-49583283 ATGGCTGCAGACAGAAGGCCGGG - Intronic
1185376397 22:50484446-50484468 GTGGCTGCTGAGAGGCTGCAGGG + Exonic
950178737 3:10896010-10896032 ATGCCTGCAGAGAGACTGAGAGG + Intronic
950805796 3:15601983-15602005 AGGGCTGCGCAAAGGCTGCCGGG + Intronic
953039331 3:39241003-39241025 AAATCTGCAGAGAGGCTGGCAGG - Intergenic
953161801 3:40427535-40427557 ATGGCTGCTTAGAGTCAGCCTGG + Exonic
954196966 3:49002689-49002711 AGGGGTGCAGAGAGGCTGCCTGG - Intronic
954708044 3:52491530-52491552 CAGGCTGCAGACAGGCTGCCTGG + Intronic
954947502 3:54439472-54439494 AGGTCTGCAAAGAGGCTGACAGG - Intronic
956192642 3:66622061-66622083 AGGGATGGAGAGAGGCTGCCAGG - Intergenic
956374450 3:68599403-68599425 ACAGCTGCTGAGAGTCTGCCGGG - Intergenic
956793005 3:72694439-72694461 AGGGCTGCAGAGAGGGGCCCAGG + Intergenic
957685815 3:83502403-83502425 ATGGCCACAGAAAGGCAGCCTGG - Intergenic
958462525 3:94417957-94417979 ATGGCTGACTAGAGGCAGCCAGG + Intergenic
959881338 3:111447895-111447917 ATGGCTGAATAGATGCAGCCAGG + Intronic
960583693 3:119301666-119301688 CTCGCTGCAGAGAGGTTTCCTGG + Intronic
961116676 3:124335681-124335703 AGAGCTGCAGAGAAGCTGCTCGG + Intronic
961116778 3:124336532-124336554 AGAGCTGCAGAGGGGCTGCAAGG + Intronic
961445059 3:126976526-126976548 GGGGCTGCAGAGAGGCTTCCTGG + Intergenic
962793829 3:138834423-138834445 TGGGCGGCAGAGACGCTGCCGGG - Intronic
965007710 3:163046099-163046121 ATGCTTGCAGAGCGGATGCCTGG + Intergenic
965604059 3:170482384-170482406 ATGGCTTCAGAGAGTATGCAGGG + Intronic
967885421 3:194330355-194330377 TTGGCTGCAGAGAGGTTGGGGGG + Intergenic
968069184 3:195775346-195775368 ATGGCTGCAGAAAGTCGTCCCGG - Intronic
968091466 3:195900836-195900858 AGGGCTGGGCAGAGGCTGCCCGG + Intronic
968579877 4:1384924-1384946 GGGGCTGTGGAGAGGCTGCCTGG + Intronic
968699159 4:2046696-2046718 GAAGCTGCAGGGAGGCTGCCTGG + Intergenic
969141410 4:5077481-5077503 ATTGCTGCAGAGAAGCTGCCTGG - Intronic
969225590 4:5796053-5796075 ATGGCTGAAGAGAGAGTGGCTGG - Intronic
969605844 4:8201886-8201908 GTGGATGGAGAGAGGCTGCTGGG + Intronic
969831133 4:9798011-9798033 ATGGATGGATAGAGGCTGCTGGG + Intronic
976325894 4:83771314-83771336 ACGGCTGCTAAGGGGCTGCCTGG - Intergenic
980119119 4:128709541-128709563 GTGGGTGCAGAGAGACTGCTAGG - Intergenic
980497344 4:133603790-133603812 AAGGGGGCAGATAGGCTGCCTGG + Intergenic
981700995 4:147607447-147607469 ATGGCAGCAGAGATGCTGTTTGG - Intergenic
982122554 4:152156880-152156902 ATGGCTGCCAGGAGGATGCCAGG + Intergenic
982133075 4:152247713-152247735 CGGGCGGGAGAGAGGCTGCCAGG - Intergenic
982737268 4:159019572-159019594 ATGGCACTGGAGAGGCTGCCTGG + Intronic
984616629 4:181905785-181905807 ATGGCTAGAGAGAGTCTACCAGG + Intergenic
984819511 4:183868090-183868112 ATGGCTTCAGAAAGGCTTTCAGG - Intronic
985069956 4:186158230-186158252 ATGGCTCCCGGAAGGCTGCCTGG - Intronic
985624512 5:978072-978094 AGGGCTGCAGGCATGCTGCCAGG - Intergenic
985658719 5:1145068-1145090 AGGGCTGGAGAGAGCCTGCGTGG + Intergenic
986289757 5:6390355-6390377 AGGGCTGCAGAGCAGCTTCCTGG - Intergenic
987074406 5:14367195-14367217 ATCCTTGCAGTGAGGCTGCCTGG - Intronic
988934886 5:36071814-36071836 ATGGCAGCTGGGTGGCTGCCTGG - Intergenic
988986485 5:36624327-36624349 ATGGCTGTTGAGAGGCTGCGAGG + Intronic
989616433 5:43341185-43341207 AAGGCAGCAGTGAGGCTGGCGGG + Intergenic
990252056 5:53926241-53926263 AGGGCTGCAGAGATGCGGGCAGG + Intronic
994150907 5:96446527-96446549 ATTGCTTCAGAGAGGATGCAGGG + Intergenic
994742707 5:103641844-103641866 AGGGATGCAGAGAGGAAGCCTGG + Intergenic
995267194 5:110176308-110176330 ATGGCAGCAGAGAAACTGGCAGG - Intergenic
997624750 5:135324209-135324231 AAGGCTGCTCTGAGGCTGCCGGG + Intronic
998029643 5:138854670-138854692 ATGTCTACAGAGAGGCTTACTGG - Intronic
998363900 5:141616102-141616124 GTGGCTGAAGCCAGGCTGCCTGG - Intronic
999256582 5:150213036-150213058 CAGCCTGCAGAGAGGCTGACAGG - Intronic
999291411 5:150428757-150428779 ATGGCTGTAGTGCGGCTGACGGG + Intergenic
999622296 5:153485638-153485660 ATGCCTTCAGAGAGGCCACCTGG - Intergenic
1001407622 5:171487053-171487075 ATGACTGCATGGAGGCTGCCTGG + Intergenic
1001826089 5:174746165-174746187 TTGGCTGGAGAGAGAATGCCGGG - Intergenic
1002169202 5:177366084-177366106 ATGGCTGCAGAGTGGATGCATGG + Intronic
1002457036 5:179351164-179351186 CTGGCTGCAGGGAGCCTGCAGGG - Intergenic
1002534709 5:179869871-179869893 ATGGCTGCAGAGCCCCTTCCAGG + Intronic
1002890585 6:1328063-1328085 GTGGATGCAGAGAGCCTGCAGGG - Intergenic
1003009435 6:2412825-2412847 ATGGCTGCAGAGCATCTTCCAGG - Intergenic
1005825132 6:29627857-29627879 AGGGCTGCTAAGAGGGTGCCGGG + Intronic
1005861897 6:29908304-29908326 AGGGCTGGAGAGAGGGAGCCCGG + Intergenic
1006174577 6:32114244-32114266 ATGACTGGACAGGGGCTGCCTGG - Intronic
1006267658 6:32938651-32938673 AGGGGTGCAGAGGGGCTACCAGG - Intronic
1006297575 6:33176801-33176823 AGGGGTGCAGAGAGGGTGACAGG - Intronic
1006326958 6:33361492-33361514 ATGGGTTCAGAGAGACTCCCTGG + Intergenic
1007440643 6:41856637-41856659 ATTTCTGAAGAGAGGATGCCAGG + Intronic
1008579229 6:52890684-52890706 ATGGCTGGAGAGAGGCAGTGGGG - Intronic
1010024904 6:71204019-71204041 ATGGCTGGAGAGATCCTGACTGG + Intergenic
1011032515 6:82939205-82939227 AAGGCTGCCCAGAGCCTGCCAGG + Intronic
1013393915 6:109714408-109714430 ATGGCTGACTAGAGGCAGCCAGG - Intronic
1015624406 6:135165505-135165527 ATGGCTGCAGAGTTCCTCCCAGG + Intergenic
1015903337 6:138090273-138090295 ATGGGTGCAGAGAGGCTGGGTGG - Exonic
1017719527 6:157235211-157235233 ATGCCTCCAGGGAGGGTGCCTGG - Intergenic
1017909300 6:158779354-158779376 GTGGCTCCAGAGAGGGTCCCGGG + Intronic
1018907778 6:168085355-168085377 ATGGCCACAGTGAGGCCGCCTGG + Intergenic
1019083528 6:169453020-169453042 CTGGCTTCAGAGTGGCTGCAAGG + Intergenic
1019413070 7:914993-915015 CCGGCTGCAGGGAGGCTGCTGGG - Intronic
1019424354 7:966880-966902 ATGGCTGCTGAGTGCCTGGCAGG - Exonic
1019982238 7:4630106-4630128 GTGGGTGCAGAGAGGAGGCCTGG + Intergenic
1020155209 7:5717707-5717729 ATTGCTGCAGAGTGACTGCCAGG + Intronic
1021021026 7:15599225-15599247 CTGGCTGCAGTGAGGCAGGCTGG + Intergenic
1025212097 7:57025667-57025689 ATTGCTGAAGAGAGGATCCCAGG - Intergenic
1025659857 7:63551161-63551183 ATTGCTGAAGAGAGGATCCCAGG + Intergenic
1028395518 7:90364839-90364861 AAGGCGGCAGTGAGGCTGGCGGG - Intronic
1029104926 7:98167424-98167446 ATGGATGCAGGGAGGCCGCAGGG + Intronic
1029371804 7:100155200-100155222 ATGGGAGCAGCGAGGGTGCCGGG - Intronic
1029538962 7:101172002-101172024 ATGGCAGGAAAGAGGCTGGCTGG + Exonic
1031595534 7:123645761-123645783 ATAGCTGGAAAGAGGCTCCCAGG - Intergenic
1032116522 7:129122271-129122293 ATGGCAGCATTGAGGCTTCCTGG - Intergenic
1032580142 7:133096545-133096567 AAGGCTGCAGAGAAGGTCCCAGG + Intergenic
1032591958 7:133199980-133200002 ATTGCTGCAGGGTGGCTGGCTGG - Intergenic
1033242552 7:139692353-139692375 CTGGCTACAGAGAGGGTGTCAGG + Intronic
1034098924 7:148435482-148435504 AGGGAGGCAGAGAGGGTGCCTGG - Intergenic
1034216061 7:149406645-149406667 AAGGCTGCAGTGAGCCAGCCTGG + Intergenic
1034489947 7:151387704-151387726 AAGGCTGCAGAGGGCCTGGCAGG + Intronic
1035117045 7:156533485-156533507 ATGGGTGGAAAGAGGATGCCAGG - Intergenic
1035760055 8:2062310-2062332 CTGACTGCAGACAGGCTGCAGGG + Intronic
1036936410 8:13006448-13006470 ATGACAGCAATGAGGCTGCCTGG - Intronic
1037950345 8:23015381-23015403 GTGTCTGCAGCGAGGATGCCAGG + Intronic
1038543958 8:28411828-28411850 CGCGCTGCAGAGGGGCTGCCGGG - Intronic
1039840122 8:41286999-41287021 ATCGCAGCTAAGAGGCTGCCAGG + Intronic
1039988620 8:42468721-42468743 CAGGCTCCAGGGAGGCTGCCGGG + Intronic
1041668307 8:60467378-60467400 ATGGCTGCACCGCAGCTGCCAGG + Intergenic
1042668161 8:71230534-71230556 CTGGCTTCAGAGAGGGTGACAGG - Intronic
1044811798 8:96070833-96070855 AAGGCTGCAGTGAGGCTGGGGGG + Intergenic
1045015680 8:97999771-97999793 ATGGCTGCAGACAGAGTGCATGG - Intronic
1046139922 8:110078142-110078164 ACTGATGCAGAGAGGCTTCCTGG + Intergenic
1046393007 8:113601742-113601764 TTGGCTGCAGAGTGGCCGCTGGG + Intronic
1046423840 8:114019888-114019910 ATGGCAGGAGAGAAGCTGCTGGG + Intergenic
1047562100 8:125997969-125997991 AAGGCTACAGAGAGGCTGTGCGG - Intergenic
1047924869 8:129672818-129672840 ATGGCTTCAGCTAGGCTTCCAGG - Intergenic
1048054254 8:130848350-130848372 CAGGCTGCAGAGAAGCAGCCAGG - Intronic
1048468480 8:134686687-134686709 AGGGCTGCAGAGAGGACGGCAGG + Intronic
1048784436 8:138035398-138035420 AGTGGTGCAGGGAGGCTGCCAGG - Intergenic
1049187391 8:141264410-141264432 CGGGAGGCAGAGAGGCTGCCGGG + Intronic
1049201333 8:141341977-141341999 ATGGCTGCAGGAAGGCTGAGGGG + Intergenic
1049595654 8:143482132-143482154 TAGGCTGGAGAGAGGCTGCATGG - Intronic
1049757734 8:144318245-144318267 AAGGCTGGTGAGGGGCTGCCAGG - Exonic
1050737903 9:8785536-8785558 ATGGAGGCAGAGGGGCTGGCAGG - Intronic
1050813340 9:9778043-9778065 ATGGCTGAAGAGACGCAGCTAGG + Intronic
1051532774 9:18123730-18123752 ATGGCTACAGGGACGCTTCCTGG - Intergenic
1052861512 9:33440671-33440693 CTGGAGGCAGGGAGGCTGCCAGG + Intergenic
1054768298 9:69061040-69061062 TTGACTGCAGAGAAGGTGCCAGG + Intronic
1055447675 9:76399034-76399056 ATGGCTCCCGGAAGGCTGCCTGG - Intergenic
1056536174 9:87529717-87529739 TTGACTGCATTGAGGCTGCCTGG + Intronic
1056696291 9:88856806-88856828 ATGGCTGCAGTTAGGCTGTCAGG + Intergenic
1057787950 9:98102180-98102202 ATGCTTGCAGACAGGATGCCTGG - Intronic
1058038766 9:100281893-100281915 CTGGCTACAGAGAGGCTTCTTGG + Intronic
1059904308 9:118964748-118964770 ATGGCTGGAGAGAGGTTACAAGG - Intergenic
1060058262 9:120434660-120434682 GGGGCTGCACAGAGGCAGCCAGG + Intronic
1061145943 9:128798522-128798544 GTGGCGGTAGAGAGGCTACCTGG + Intronic
1061292325 9:129658072-129658094 AAGGATACAGAGAAGCTGCCAGG + Intergenic
1061892086 9:133627689-133627711 GTAGCTGGAGGGAGGCTGCCTGG + Intergenic
1061945512 9:133906476-133906498 AAGGCTGCAGAGAGCCAGCCAGG + Intronic
1062002295 9:134222424-134222446 GTGGCAGCACAGAGGCTGGCAGG - Intergenic
1062143209 9:134971644-134971666 TGGGCTGCAGGGAAGCTGCCAGG - Intergenic
1062352119 9:136144320-136144342 AGGTCTGGAGAGAGGCTGGCAGG + Intergenic
1062355576 9:136160482-136160504 GTGGCTGCACTGGGGCTGCCTGG + Intergenic
1203432367 Un_GL000195v1:103046-103068 AGGGCTGGGGAGAGGTTGCCTGG - Intergenic
1203434132 Un_GL000195v1:121516-121538 AGGGCTGGAGAGAGGTTGCCTGG + Intergenic
1185524552 X:766868-766890 GAGGCTGCAGTGAGGCAGCCAGG + Intergenic
1187133917 X:16528663-16528685 AAGGCTACAGAGAAGATGCCAGG + Intergenic
1187515451 X:19965616-19965638 ATGAAAGCAGAGAGCCTGCCAGG - Exonic
1189380901 X:40501405-40501427 ATGACAGCACAGAGGCTGCTGGG - Intergenic
1190010610 X:46781330-46781352 ATGGCTGGAAGGTGGCTGCCAGG + Intergenic
1192175073 X:68880312-68880334 AGGGCAGCAGAGAGGCAGACTGG - Intergenic
1192177717 X:68896177-68896199 ATGGGAGCAGAGAGGATGCCAGG + Intergenic
1192236645 X:69300457-69300479 ATGGCTGCAGATGGGCTCACTGG - Intergenic
1192754385 X:74031503-74031525 ATGGCTCCCGGAAGGCTGCCTGG - Intergenic
1192996916 X:76521440-76521462 ATGGCTGACGAGAGGCAACCAGG - Intergenic
1193047790 X:77070680-77070702 GAGGATGCAGAGAGGCTGGCAGG + Intergenic
1193487280 X:82102373-82102395 GTGGGTGCAGAGTTGCTGCCTGG + Intergenic
1194669184 X:96708909-96708931 AGAGCAGCAGAGAGGCTTCCGGG + Intronic
1195316082 X:103679759-103679781 ATGGCTACAGAATGGCTGCTGGG - Intronic
1196049390 X:111289094-111289116 ATGCCTGCTGATGGGCTGCCTGG + Intergenic
1197168028 X:123400377-123400399 ATTGCTCCAGAGAGGCTGGAAGG + Intronic
1198524315 X:137485128-137485150 ATGGCTGCTTAAAGGCTGCTAGG + Intergenic
1199871475 X:151902296-151902318 AGGGGTGGAGAGAGGCTGGCAGG + Intergenic
1200000379 X:153056829-153056851 CTGGCTGCAGAGGCGCCGCCCGG + Intronic
1200003312 X:153072815-153072837 CTGGCTGCAGAGGCGCGGCCAGG + Intronic
1200004411 X:153077194-153077216 CTGGCTGCAGAGGCGCGGCCAGG - Intergenic