ID: 1142033585

View in Genome Browser
Species Human (GRCh38)
Location 16:87850468-87850490
Sequence AGTCACCGATGGCTGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142033585_1142033587 5 Left 1142033585 16:87850468-87850490 CCTCTCTGCAGCCATCGGTGACT 0: 1
1: 0
2: 1
3: 19
4: 136
Right 1142033587 16:87850496-87850518 TCACCAGAGCGTGCATCCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 73
1142033585_1142033588 6 Left 1142033585 16:87850468-87850490 CCTCTCTGCAGCCATCGGTGACT 0: 1
1: 0
2: 1
3: 19
4: 136
Right 1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142033585 Original CRISPR AGTCACCGATGGCTGCAGAG AGG (reversed) Intronic
900102051 1:966155-966177 AGTCACCGGTGACTGCAGGGAGG - Intergenic
907291460 1:53415615-53415637 CATCACCGATCGCTGGAGAGAGG - Intergenic
909419061 1:75442726-75442748 GGGAAGCGATGGCTGCAGAGGGG - Intronic
918074406 1:181159514-181159536 AGTCACCCATGGCCACAGAGAGG + Intergenic
920262727 1:204700451-204700473 AGTCAGGGAAGGCTTCAGAGAGG - Intergenic
920972555 1:210755115-210755137 AGTCACCGACAGTGGCAGAGAGG + Intronic
922665324 1:227464222-227464244 AGGCACAGATGGCAGCAGAGAGG + Intergenic
1065533571 10:26697515-26697537 AGTCCCCGTTGGCTGCAGACGGG + Intergenic
1066151177 10:32620668-32620690 AGTCAGCCATGGCTGGACAGTGG - Intronic
1066680529 10:37933324-37933346 AGTCACCAGGGGCTGCAGTGAGG - Intergenic
1070215796 10:74379198-74379220 AGTCAAGGATGGAAGCAGAGAGG + Intronic
1070897551 10:79997638-79997660 AGTCAAAGATGACTCCAGAGGGG - Intergenic
1071501811 10:86209775-86209797 AGTGACTGATGGCTGCAAGGAGG - Intronic
1072038077 10:91582505-91582527 ACTCCCTGATGGCTGCAGTGTGG + Intergenic
1073252719 10:102131344-102131366 TGTCACCCAGGGCTGCAGTGTGG - Intergenic
1073267811 10:102238831-102238853 AGTCACAAATGGCTACAGGGTGG - Intronic
1074572710 10:114638867-114638889 ACTCACCGTTGGCTGCACAGGGG + Intronic
1078016574 11:7620162-7620184 AGTCACTGAAGGTTGCTGAGTGG - Intronic
1079678720 11:23265099-23265121 AGACACCGACGGATCCAGAGGGG + Intergenic
1083289158 11:61680324-61680346 GGTCACCGCTGGCGGCGGAGAGG + Intergenic
1083593186 11:63907061-63907083 GGTCCCCGAGGCCTGCAGAGAGG - Intronic
1083625874 11:64071737-64071759 AGTCACAGATGGCAGGAGACTGG + Intronic
1086361894 11:86068806-86068828 AGTCCCCGCCGGCTGCTGAGCGG - Exonic
1087893169 11:103557978-103558000 AGTCACCAATGGCTTTAGAGTGG - Intergenic
1088688519 11:112305107-112305129 AGTCTCAGATCCCTGCAGAGTGG - Intergenic
1089103260 11:115981937-115981959 ACTCAGCTCTGGCTGCAGAGAGG + Intergenic
1091588327 12:1828409-1828431 AGTCACCGCTGAGTGCTGAGTGG + Intronic
1096231240 12:49897958-49897980 AGTCCCAGAGGGCTACAGAGGGG + Intronic
1098798975 12:74928906-74928928 AGTTACCAAGGGCTGCAGAGTGG + Intergenic
1099458763 12:82897166-82897188 AGTCACCTTTGGCTGCGCAGAGG + Intronic
1099684726 12:85870204-85870226 AGTCAGCAATGGCTGCAATGTGG + Intergenic
1104240348 12:126983427-126983449 GGTCACCTATAGCTACAGAGAGG + Intergenic
1105664715 13:22541112-22541134 AGTCACCCATTGCTTCACAGGGG + Intergenic
1106553046 13:30787998-30788020 AGTCACCTGTGGCTGCAGCCTGG + Intergenic
1112091446 13:96088957-96088979 CTTCACTGATGGCTGCAGAGGGG + Intergenic
1113176700 13:107573016-107573038 AGTCCCGGATGGTTGCAGGGTGG - Intronic
1113273404 13:108700527-108700549 AGCCACTGGTGGCTGCAGACTGG + Intronic
1113958100 13:114110073-114110095 AGTCACAGGTGGCTGCAGCCTGG + Intronic
1114670851 14:24410179-24410201 GGTCATCGATGGCAGCAGTGTGG + Exonic
1117055231 14:51905618-51905640 AGTCAACCATGGCAACAGAGGGG + Intronic
1119563361 14:75608393-75608415 ACTGACCGCTTGCTGCAGAGGGG + Intronic
1122116899 14:99532237-99532259 AGTCAGGGAGGGCTGCAGACAGG + Intronic
1122250925 14:100439134-100439156 AGTCACCAGTGGGTGCAGGGAGG - Intronic
1122550345 14:102545754-102545776 AGCCACAGCTGGGTGCAGAGTGG + Intergenic
1128359941 15:66954925-66954947 AGTCACAGGTGGCTGCACAGAGG - Intergenic
1131051536 15:89351443-89351465 AGGCAGAGATGTCTGCAGAGAGG + Intergenic
1131681342 15:94726738-94726760 ATCCAGCGATGGGTGCAGAGAGG + Intergenic
1132549256 16:547596-547618 AGGCACCGGTGGCTGCAGCTGGG - Exonic
1134185279 16:12080181-12080203 GGTCCCCCTTGGCTGCAGAGGGG + Intronic
1134382012 16:13736351-13736373 AGTCACCTTTGCCTGCATAGGGG - Intergenic
1134393721 16:13843291-13843313 ACTCATCGATGGCTGCAGGGAGG - Intergenic
1134669156 16:16041772-16041794 AGTCACTCATGGGTGAAGAGAGG - Intronic
1138328057 16:56191678-56191700 ACGCACCGACGGCTGAAGAGCGG + Intronic
1139121607 16:64025610-64025632 AGTCTATGATGGCTGCTGAGGGG - Intergenic
1139437164 16:66942986-66943008 AGACACCCATGGCTGGGGAGAGG - Intronic
1139548952 16:67662997-67663019 AGTCACCAGTGGCTGCAGAAGGG - Exonic
1140238213 16:73177987-73178009 ATTCCCTGATGCCTGCAGAGAGG - Intergenic
1141882211 16:86867589-86867611 AGTCACTGAAGGCTGCAGAGAGG - Intergenic
1142033585 16:87850468-87850490 AGTCACCGATGGCTGCAGAGAGG - Intronic
1142328303 16:89432913-89432935 TGTCACCCATGGCTGGAGTGTGG - Intronic
1142417676 16:89951743-89951765 AGGCAGGGATGGCTGAAGAGGGG + Intronic
1144599386 17:16599159-16599181 AAATACCCATGGCTGCAGAGGGG - Intergenic
1144672471 17:17140751-17140773 AGTCACCTCTGGCTGCTGAGTGG + Intronic
1146957913 17:36947648-36947670 AGACAACCAGGGCTGCAGAGGGG - Intergenic
1149597581 17:57873329-57873351 AGTCACCTCAGGCTGGAGAGAGG - Intronic
1152496311 17:80674986-80675008 AGTCACCCCTGGCTTCAGAAGGG + Intronic
1152564685 17:81094996-81095018 AGTCACCGCATGCTGCGGAGAGG + Intronic
1152730983 17:81969819-81969841 AGTCATAGGTGGCCGCAGAGTGG + Intergenic
1152917988 17:83051859-83051881 AATCTCCGATTGGTGCAGAGCGG + Intergenic
1152983905 18:304967-304989 CATCCCAGATGGCTGCAGAGTGG - Intergenic
1156345474 18:36253325-36253347 AGTCACAGAGGGCTTCAGGGAGG + Intronic
1159657736 18:71052694-71052716 GGTCCCAGATGGCTGAAGAGAGG + Intergenic
1159937457 18:74380593-74380615 AGTAAGAGATGGCAGCAGAGGGG + Intergenic
1160329369 18:77977829-77977851 AGCCTCCGATGGCTGCAGTCTGG + Intergenic
1160486660 18:79299492-79299514 AGTCACAGGAGACTGCAGAGAGG - Intronic
1162046898 19:8005825-8005847 AGCCAGCGATGGCCGCGGAGGGG + Intronic
1162955679 19:14096668-14096690 AGGCACTGATGGCCGGAGAGAGG - Intronic
1164750654 19:30652568-30652590 AGGCCCCCATGGATGCAGAGAGG + Intronic
1164821907 19:31257125-31257147 AGCCAGAGATGGCTGCACAGAGG + Intergenic
1165699053 19:37923228-37923250 AGTCACGCATGGCTTCACAGTGG + Intronic
1166687884 19:44807056-44807078 AGTGGGCGATGGCTGCTGAGAGG + Intergenic
1166689647 19:44814678-44814700 CGGGACCTATGGCTGCAGAGTGG + Exonic
1168366323 19:55791113-55791135 AGTCTCCCATAGCTGAAGAGAGG - Intronic
925381827 2:3433498-3433520 TGACACAGAAGGCTGCAGAGAGG + Intronic
926210042 2:10862782-10862804 AGACACTGATGGCTTCAGACTGG + Intergenic
928563643 2:32519035-32519057 AGTCATCAATGGTTGCAAAGTGG - Intronic
929370650 2:41220454-41220476 AGACACTGATGACTGCACAGTGG + Intergenic
930387524 2:50715781-50715803 AATCAGCGAGGGCTTCAGAGAGG - Intronic
931774672 2:65530349-65530371 AGTCACAGATGGATGGGGAGAGG + Intergenic
947860224 2:233353296-233353318 AGTGACCTGGGGCTGCAGAGTGG - Intergenic
1170808905 20:19658229-19658251 AGACGCTGATGGCTGCTGAGGGG + Intronic
1173957688 20:47047173-47047195 ACTCACTGAGGGATGCAGAGGGG - Intronic
1175777453 20:61662301-61662323 AGCCAGCGATGGCTCCAGAAAGG - Intronic
1176244928 20:64092985-64093007 AGTCCCACACGGCTGCAGAGGGG + Intronic
1176869735 21:14075194-14075216 AGTCCCCCATGGCCGCAGAGAGG + Intergenic
1180799828 22:18626552-18626574 AGCCACCCATGGCTCCAGAGAGG + Intergenic
1181221887 22:21368714-21368736 AGCCACCCATGGCTCCAGAGAGG - Intergenic
1181637275 22:24180353-24180375 AGCCACCCGTGGCTCCAGAGAGG - Intergenic
1183478770 22:38051398-38051420 TGTCACAGATGCCTGCAGAGTGG - Intergenic
1183478918 22:38052296-38052318 GGACAGCGGTGGCTGCAGAGCGG + Intergenic
1184496950 22:44847622-44847644 TGTCTCCAAGGGCTGCAGAGAGG - Intronic
1184504290 22:44891611-44891633 ACGCACCCATGGGTGCAGAGAGG - Intronic
1184544294 22:45155922-45155944 GGTCACTGATGGCTGGGGAGAGG + Intergenic
1184867178 22:47208163-47208185 TGTCAGCGATGGCTGCAGACTGG + Intergenic
1185001340 22:48248369-48248391 AGTCACAGAAGACTGGAGAGGGG + Intergenic
1185001376 22:48248560-48248582 AGTCACAGAAGACTACAGAGGGG + Intergenic
950044794 3:9942802-9942824 ACTCATCAATGTCTGCAGAGAGG - Exonic
950127315 3:10517881-10517903 AGGGAGCGATGGCTGCAGATAGG + Intronic
950163898 3:10779511-10779533 AGTCACTGAAGGCTGCATGGGGG - Intergenic
950426293 3:12926481-12926503 AGTCACCGAGGGCTGTCAAGTGG + Intronic
950636450 3:14318613-14318635 AGTCAGGGAGGGCTTCAGAGAGG + Intergenic
951180335 3:19652252-19652274 ATTCACCAATGGGAGCAGAGGGG + Intergenic
951530505 3:23694172-23694194 GGTAACAGATGGCTGCAGAAGGG - Intergenic
955445380 3:59004703-59004725 AGTCAGCTGTGGCTGCATAGAGG + Intronic
960925482 3:122791883-122791905 AGTCACTTTTTGCTGCAGAGTGG + Intronic
961431606 3:126887980-126888002 AGCCACCTTTAGCTGCAGAGAGG - Intronic
965562140 3:170072016-170072038 ATTCACCAATGGCCCCAGAGTGG - Intronic
969147357 4:5135874-5135896 GGTCACTGCTGGCTGCACAGTGG + Intronic
970616432 4:17772424-17772446 AGTCACCGCTTCCTGCACAGTGG - Intronic
972320563 4:37969910-37969932 AGTTACCGGGGGCTGGAGAGAGG - Intronic
972974086 4:44612174-44612196 AGTCTTCAATGGATGCAGAGGGG + Intergenic
979846316 4:125517069-125517091 AGTCAAGAATGGCTGCAGAATGG - Intergenic
986435661 5:7727729-7727751 AATCAAAGACGGCTGCAGAGTGG - Intronic
987964635 5:24855670-24855692 AGTAACCGAAGGCTGAAGAATGG - Intergenic
998154539 5:139777069-139777091 GGCCCCAGATGGCTGCAGAGAGG + Intergenic
999225528 5:150020303-150020325 ATACACTGATGGCTTCAGAGAGG - Intronic
1000724872 5:164757411-164757433 AGTCAACGAAAGCTTCAGAGAGG - Intergenic
1001306866 5:170581234-170581256 AGACACCGAGGCCTGCAGACAGG + Intronic
1001773630 5:174312952-174312974 AGGAAGCGATGGCTGCAGGGTGG - Intergenic
1003836442 6:10076849-10076871 AGTCACCCATGGCCGCTAAGGGG - Intronic
1004057165 6:12151366-12151388 AGTCTCTGATGGCTGCAAAGGGG + Intronic
1004739484 6:18444242-18444264 AGTCACAGATGGGTGGAAAGCGG - Intronic
1005802380 6:29440375-29440397 GTTCACAGATGGCTGCATAGCGG - Exonic
1007251325 6:40497126-40497148 AGTCAGAAATGGCTGCAGAAGGG - Intronic
1007422567 6:41728527-41728549 AGTCCCTGAGGGGTGCAGAGTGG - Intronic
1008430830 6:51414729-51414751 AGTCACATATGGCTGGACAGTGG - Intergenic
1012328874 6:97959337-97959359 AGTCACAGATGACTTCACAGAGG + Intergenic
1018786055 6:167108765-167108787 AGTCCTCGAGGGCTGCAGGGTGG + Intergenic
1023017942 7:35984789-35984811 ACTCCCTGATGGCTACAGAGGGG + Intergenic
1024782328 7:52865466-52865488 AGGCACCGATGGTGGTAGAGAGG - Intergenic
1032951951 7:136924694-136924716 AGTGACCACTGGCAGCAGAGGGG - Intronic
1033429886 7:141279807-141279829 ATCCACCGATGGCTACAGAAAGG - Intronic
1037651648 8:20844500-20844522 ACTCACTGATTACTGCAGAGAGG + Intergenic
1042061420 8:64822280-64822302 AGACACCTAGGGCTGCAGACGGG - Intergenic
1044514756 8:93125132-93125154 AGTCAATGATGTTTGCAGAGTGG + Intergenic
1044607654 8:94061190-94061212 AGTTGCAGATGGCTGGAGAGAGG + Intergenic
1045366245 8:101478783-101478805 AGTCAGGAATGGCTTCAGAGAGG - Intergenic
1045876327 8:106985415-106985437 TGTCAGCAATGGCTGCAGAGTGG + Intergenic
1051334439 9:16053685-16053707 AATCACCAAAGGCTGCAGTGTGG + Intronic
1052021021 9:23525292-23525314 AGTCAGGGAAGGCTCCAGAGAGG - Intergenic
1057182989 9:93039860-93039882 AGGCCCCCATGGCTGCAGGGAGG - Intergenic
1060135629 9:121150512-121150534 AGTCACCCATGGAAGCAGTGTGG - Intronic
1060732521 9:126047689-126047711 AGTCCCCTATGGGTGCGGAGGGG - Intergenic
1061974740 9:134062422-134062444 AGGCACTGGTGGGTGCAGAGTGG - Intronic
1185598518 X:1323412-1323434 TGGCAGGGATGGCTGCAGAGAGG + Intergenic
1189193537 X:39132686-39132708 ACACACTGATGGGTGCAGAGGGG - Intergenic
1197766184 X:130060644-130060666 AGCCAGCGATGGCGGGAGAGTGG - Intergenic