ID: 1142033586

View in Genome Browser
Species Human (GRCh38)
Location 16:87850479-87850501
Sequence TGGTGACTCGCAGTCACCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 38}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142033586_1142033593 29 Left 1142033586 16:87850479-87850501 CCATCGGTGACTGCGAGTCACCA 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1142033593 16:87850531-87850553 AGCGAAAGCTCCACAGCTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 112
1142033586_1142033587 -6 Left 1142033586 16:87850479-87850501 CCATCGGTGACTGCGAGTCACCA 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1142033587 16:87850496-87850518 TCACCAGAGCGTGCATCCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 73
1142033586_1142033588 -5 Left 1142033586 16:87850479-87850501 CCATCGGTGACTGCGAGTCACCA 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142033586 Original CRISPR TGGTGACTCGCAGTCACCGA TGG (reversed) Intronic