ID: 1142033586

View in Genome Browser
Species Human (GRCh38)
Location 16:87850479-87850501
Sequence TGGTGACTCGCAGTCACCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 38}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142033586_1142033588 -5 Left 1142033586 16:87850479-87850501 CCATCGGTGACTGCGAGTCACCA 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 51
1142033586_1142033587 -6 Left 1142033586 16:87850479-87850501 CCATCGGTGACTGCGAGTCACCA 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1142033587 16:87850496-87850518 TCACCAGAGCGTGCATCCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 73
1142033586_1142033593 29 Left 1142033586 16:87850479-87850501 CCATCGGTGACTGCGAGTCACCA 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1142033593 16:87850531-87850553 AGCGAAAGCTCCACAGCTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142033586 Original CRISPR TGGTGACTCGCAGTCACCGA TGG (reversed) Intronic
900708315 1:4094388-4094410 TGGTGTCTCTCAGCCACCGCAGG + Intergenic
916058015 1:161081295-161081317 TGGTGAGGGGCAGTCACTGAAGG + Intronic
1063560545 10:7122270-7122292 TGGTGGCCTGCAGTCACAGAGGG + Intergenic
1075782053 10:125023473-125023495 TGCTGGCTCGCAGCCACCGCCGG + Intronic
1088408501 11:109507368-109507390 TGGTGCCACCCAGTCACCAAAGG + Intergenic
1092276947 12:7068565-7068587 AGGTGACTCCCAGTCACCCATGG - Intronic
1104666380 12:130650094-130650116 TGGGGACTCGCAGGCAACCAAGG + Intronic
1119567428 14:75640678-75640700 TGCTGACTGGCTGTCACTGATGG + Intronic
1131304983 15:91234424-91234446 TGGTGGCACTCAGTCACCAAAGG + Intronic
1133776999 16:8904400-8904422 TGGTGACCCGGAGTCCCAGAAGG + Intronic
1142033586 16:87850479-87850501 TGGTGACTCGCAGTCACCGATGG - Intronic
1150292916 17:63992077-63992099 TGGTGACCAGCAGTCCCAGATGG - Intergenic
1154232280 18:12567999-12568021 TGGTGGCACTCAGTCACCAAAGG - Intronic
1157015549 18:43708291-43708313 TGGAGACTCACAGTCACGCAAGG + Intergenic
1160711718 19:554889-554911 TGGTGACTCCCAGAAACCGCAGG - Intergenic
1161686175 19:5703778-5703800 TGGTGACACGCAGGTACTGAGGG + Intronic
1165399216 19:35586939-35586961 TGGAGACCTGCAGTCACTGAGGG - Intergenic
1166267951 19:41696598-41696620 TGGTGACAGGCAGTGACCCAGGG + Intronic
1166295489 19:41887475-41887497 TGGGGACTCCCAGTCCCTGAGGG + Intronic
926843515 2:17108013-17108035 TGGTGACAGGCAGTCAAGGAAGG + Intergenic
1169670823 20:8099874-8099896 TGGCAACTTGCAGTCACCAATGG + Intergenic
1173414576 20:42844555-42844577 TGGTTACTCACAGTGACAGAAGG + Intronic
950383618 3:12638399-12638421 TGTTGACTGGCAGTCAGCTAAGG + Intronic
953774116 3:45800992-45801014 TGGTGACTGGGAGCCACTGAGGG - Intergenic
972614096 4:40681545-40681567 TGGAGTCTCGCTGTCACCCAGGG - Intergenic
981043005 4:140240422-140240444 AGGTGACGCGAGGTCACCGAGGG + Intergenic
987493023 5:18605343-18605365 ATGTGACTCACAGTCACCAAAGG - Intergenic
996916485 5:128718437-128718459 TGGTGACTCCTAGTCACCAAAGG + Intronic
1000930427 5:167244738-167244760 TGGTGTCTCTCAGTCTCCCAAGG + Intergenic
1006826133 6:36937680-36937702 TGGAGACTGGCAGGCACAGAGGG - Intergenic
1007423408 6:41733264-41733286 TGGTGACTCACAGTCAGAGGTGG - Intronic
1008449300 6:51631755-51631777 TGGAGACTTGTAGTCACTGAGGG - Intronic
1015610562 6:135013275-135013297 TGGTGACTGGCAGAGACCCACGG - Intronic
1018620484 6:165725554-165725576 TGCTGACTGGCAGGAACCGATGG - Intronic
1018968553 6:168508478-168508500 TGGTGATCCGCAGCCACAGAGGG + Intronic
1019999070 7:4744673-4744695 CGGGGACTCGCAGTCACAGGAGG - Intronic
1034509216 7:151520375-151520397 TGGTGACTAAGCGTCACCGACGG + Intergenic
1038478780 8:27887171-27887193 AGGTGCCTCGCAGTCATTGAAGG - Intronic
1057827170 9:98380203-98380225 TGGTGACTCGCAGAGGCTGAGGG + Intronic
1189171877 X:38917037-38917059 TGGTGACTCTCATTTACCAAAGG - Intergenic
1194777894 X:97988183-97988205 AGCTGACTCACAGTCACTGATGG + Intergenic