ID: 1142033586 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:87850479-87850501 |
Sequence | TGGTGACTCGCAGTCACCGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 41 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 2, 4: 38} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1142033586_1142033593 | 29 | Left | 1142033586 | 16:87850479-87850501 | CCATCGGTGACTGCGAGTCACCA | 0: 1 1: 0 2: 0 3: 2 4: 38 |
||
Right | 1142033593 | 16:87850531-87850553 | AGCGAAAGCTCCACAGCTCCAGG | 0: 1 1: 0 2: 0 3: 8 4: 112 |
||||
1142033586_1142033587 | -6 | Left | 1142033586 | 16:87850479-87850501 | CCATCGGTGACTGCGAGTCACCA | 0: 1 1: 0 2: 0 3: 2 4: 38 |
||
Right | 1142033587 | 16:87850496-87850518 | TCACCAGAGCGTGCATCCGCCGG | 0: 1 1: 0 2: 0 3: 3 4: 73 |
||||
1142033586_1142033588 | -5 | Left | 1142033586 | 16:87850479-87850501 | CCATCGGTGACTGCGAGTCACCA | 0: 1 1: 0 2: 0 3: 2 4: 38 |
||
Right | 1142033588 | 16:87850497-87850519 | CACCAGAGCGTGCATCCGCCGGG | 0: 1 1: 0 2: 0 3: 7 4: 51 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1142033586 | Original CRISPR | TGGTGACTCGCAGTCACCGA TGG (reversed) | Intronic | ||