ID: 1142033587

View in Genome Browser
Species Human (GRCh38)
Location 16:87850496-87850518
Sequence TCACCAGAGCGTGCATCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 73}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142033581_1142033587 30 Left 1142033581 16:87850443-87850465 CCTACAGCCATGTGGGACCAGGC 0: 1
1: 0
2: 0
3: 18
4: 239
Right 1142033587 16:87850496-87850518 TCACCAGAGCGTGCATCCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 73
1142033585_1142033587 5 Left 1142033585 16:87850468-87850490 CCTCTCTGCAGCCATCGGTGACT 0: 1
1: 0
2: 1
3: 19
4: 136
Right 1142033587 16:87850496-87850518 TCACCAGAGCGTGCATCCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 73
1142033583_1142033587 13 Left 1142033583 16:87850460-87850482 CCAGGCAGCCTCTCTGCAGCCAT 0: 1
1: 0
2: 5
3: 50
4: 455
Right 1142033587 16:87850496-87850518 TCACCAGAGCGTGCATCCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 73
1142033582_1142033587 23 Left 1142033582 16:87850450-87850472 CCATGTGGGACCAGGCAGCCTCT 0: 1
1: 0
2: 3
3: 24
4: 240
Right 1142033587 16:87850496-87850518 TCACCAGAGCGTGCATCCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 73
1142033586_1142033587 -6 Left 1142033586 16:87850479-87850501 CCATCGGTGACTGCGAGTCACCA 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1142033587 16:87850496-87850518 TCACCAGAGCGTGCATCCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142033587 Original CRISPR TCACCAGAGCGTGCATCCGC CGG Intronic
901098522 1:6701700-6701722 CCCCCAGAGCGTCCAGCCGCTGG + Intronic
907660151 1:56384285-56384307 TGCCCAGAGCGTGCCTCCGTGGG + Intergenic
908451810 1:64263399-64263421 TCACCAGAGCGTGCCTGGACTGG + Intronic
908584823 1:65556195-65556217 TCACCAGAGATTGAATCTGCTGG + Intronic
910156430 1:84224897-84224919 TCACCACAGCCTGCACCCACAGG - Intronic
916043743 1:160982599-160982621 TTACCAGTGCGTGCAGCCCCCGG - Intergenic
916970821 1:170013127-170013149 TCCCCAGAGCCTGCATCTGTTGG + Intronic
918491599 1:185087264-185087286 TCACCAGACACTGCATCTGCTGG - Intronic
1072230599 10:93411280-93411302 TCACCAGACACTGAATCCGCCGG - Intronic
1074421016 10:113309092-113309114 TACCCAGAGCTTGCATCAGCAGG + Intergenic
1076646249 10:131957095-131957117 TGACCAGAGCTTGCTTCCGTGGG + Intronic
1090474702 11:127009430-127009452 TCACCAGACAGTGGATCTGCAGG - Intergenic
1096152943 12:49325866-49325888 TCACCAGAGCCTGTAGCCTCTGG - Exonic
1100554868 12:95683497-95683519 TCACCGGAGACTGCATCAGCAGG - Exonic
1104379487 12:128294636-128294658 TCACCAGATAGTGAATCTGCTGG - Intronic
1106309765 13:28543849-28543871 TCACCAGAGCCTGCCTATGCTGG + Intergenic
1119863349 14:77953168-77953190 TCACCAGACAGTGAATCTGCTGG + Intergenic
1121022378 14:90588176-90588198 GCACCAGAGGTTGCATCAGCAGG - Intronic
1123971497 15:25511903-25511925 TCACCAGAGACTGAATCTGCTGG + Intergenic
1130199124 15:81808849-81808871 CCACCAGAACTTGCATCCTCAGG - Intergenic
1137446893 16:48537414-48537436 TCACCAGAGAGAGCACCCGGAGG - Intergenic
1141051450 16:80768492-80768514 TCACCAGACCCTGAATCCACTGG - Intronic
1142033587 16:87850496-87850518 TCACCAGAGCGTGCATCCGCCGG + Intronic
1142189574 16:88711744-88711766 ACACCAGAGGGAGGATCCGCAGG - Intronic
1153316929 18:3731993-3732015 TCACCCAAGCGTGCATCCCTGGG + Intronic
1153664015 18:7351991-7352013 TCACCAGAGACTGAATCCGCTGG + Intergenic
1153871346 18:9323144-9323166 TCACCAGATCGTGCAGACTCTGG - Intergenic
1154241633 18:12658184-12658206 CCTCCAGAGCGTGCATCCCCCGG - Exonic
1159221792 18:65474284-65474306 TCACCAGATAGTGAATCTGCTGG - Intergenic
1160319857 18:77880068-77880090 GCACCAGAACCTGGATCCGCGGG + Intergenic
925527581 2:4819924-4819946 TCACCAGACACTGAATCCGCAGG + Intergenic
933000718 2:76919145-76919167 TCACCAGAGCCTTCATGTGCAGG + Intronic
938500806 2:131830559-131830581 ACACCAGAGGGTGCAGCCCCAGG - Intergenic
940069517 2:149669902-149669924 TCACCAGACCCTGAATCTGCTGG + Intergenic
941688842 2:168477061-168477083 TCACCAGACACTGCATCTGCTGG - Intronic
945276586 2:207993680-207993702 TCACCAGAGAGTGAAACCGACGG + Intronic
948871021 2:240798130-240798152 CCACCAGCGCCTGCATCCACAGG - Intronic
1169890207 20:10444348-10444370 TCACCAGACAGTGAATCTGCTGG - Intronic
1171099985 20:22373913-22373935 TCAGCAGAGCTTGCAGCTGCTGG + Intergenic
1178767603 21:35469001-35469023 GCACCAGTGTGTGCATCGGCAGG + Intronic
1182151295 22:28028995-28029017 TCACCACAGCCTGCATCACCTGG + Intronic
1183017794 22:35004186-35004208 TCACCAGACAGTGAATCTGCTGG - Intergenic
951577832 3:24131756-24131778 TCACCAGACAGTGAATCTGCTGG + Intronic
953454691 3:43032363-43032385 CCCCCACAGCGTCCATCCGCCGG + Exonic
953828027 3:46271012-46271034 TCACCAGAGCAGGCATCTGTGGG - Intergenic
964624700 3:158747994-158748016 TCACCAGAACCTGAATCTGCTGG + Intronic
968589116 4:1448959-1448981 TCACCAGACCCTGCAACCCCAGG - Intergenic
969197209 4:5572554-5572576 TCACCAGACACTGCATCTGCAGG + Intronic
973627292 4:52785489-52785511 TCACCAGACCCTGAATCTGCTGG + Intergenic
976053700 4:81037928-81037950 TCACCAGAGTTTGATTCCGCGGG - Intronic
978625212 4:110677450-110677472 TCACCAGACCTGGCATCTGCTGG + Intergenic
981869235 4:149466831-149466853 TCACCAGAGACTGAATCTGCTGG - Intergenic
982099618 4:151955153-151955175 TCACCAGACAGTGAATCTGCTGG + Intergenic
986000021 5:3623064-3623086 TCACCAGAGCCTGCTCCCGTGGG - Intergenic
990634921 5:57713956-57713978 TCACCAGACAGTGCATCTGCTGG + Intergenic
990689455 5:58347267-58347289 TCACCAGAACCTGCATCATCTGG + Intergenic
993921743 5:93813686-93813708 TCACTAGAGCCTGGATCTGCTGG + Intronic
1000749605 5:165077689-165077711 TCCCCAGAGTGTGCAACCTCTGG + Intergenic
1003527771 6:6912194-6912216 TCACCAGACACTGCATCTGCCGG + Intergenic
1007014746 6:38453949-38453971 ACACCAGGTCGTGCATCAGCAGG + Intronic
1007524371 6:42478994-42479016 TCACCAGACCATGAATCTGCAGG + Intergenic
1012784544 6:103606773-103606795 TCACCAGAGCGTTCAACTCCTGG + Intergenic
1014539412 6:122655496-122655518 TCACCAGAGACTGAATCTGCTGG + Intronic
1015519911 6:134119782-134119804 TCACTAGAACCTGCATCTGCTGG - Intergenic
1019216353 6:170446516-170446538 TCACCAGAGTTTGCATCAGGTGG - Intergenic
1019400667 7:851271-851293 TCACCAAAGCCTGCATCGGTGGG - Intronic
1023416088 7:39934168-39934190 TCACCAGACACTGCATCTGCTGG + Intergenic
1024391898 7:48823529-48823551 TCACCAGCGCCTGAATCTGCTGG - Intergenic
1024446179 7:49482323-49482345 GAACCAGAGGGTGCATACGCAGG - Intergenic
1047617360 8:126573716-126573738 TCACCAGACAGTGAATCTGCTGG + Intergenic
1047824843 8:128562125-128562147 TCACCAGACAGTGAATCTGCTGG + Intergenic
1052074419 9:24122740-24122762 TCACCAGATAGTGAATCTGCGGG + Intergenic
1054929953 9:70625812-70625834 TTACCAGAGCCTCCATCAGCTGG + Intronic
1057995889 9:99821579-99821601 TCGCCAGGGCGTGCGTCTGCGGG - Intergenic
1185469657 X:374790-374812 TCAACAGAGCGTGCGGCAGCGGG - Intronic
1197262620 X:124334057-124334079 ACACCAGGGTGTGCATCCTCCGG - Intronic
1197724954 X:129770014-129770036 TCACCAGTGCTTGCATCCAGAGG + Intergenic