ID: 1142033588

View in Genome Browser
Species Human (GRCh38)
Location 16:87850497-87850519
Sequence CACCAGAGCGTGCATCCGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 51}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142033583_1142033588 14 Left 1142033583 16:87850460-87850482 CCAGGCAGCCTCTCTGCAGCCAT 0: 1
1: 0
2: 5
3: 50
4: 455
Right 1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 51
1142033586_1142033588 -5 Left 1142033586 16:87850479-87850501 CCATCGGTGACTGCGAGTCACCA 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 51
1142033582_1142033588 24 Left 1142033582 16:87850450-87850472 CCATGTGGGACCAGGCAGCCTCT 0: 1
1: 0
2: 3
3: 24
4: 240
Right 1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 51
1142033585_1142033588 6 Left 1142033585 16:87850468-87850490 CCTCTCTGCAGCCATCGGTGACT 0: 1
1: 0
2: 1
3: 19
4: 136
Right 1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142033588 Original CRISPR CACCAGAGCGTGCATCCGCC GGG Intronic