ID: 1142033588

View in Genome Browser
Species Human (GRCh38)
Location 16:87850497-87850519
Sequence CACCAGAGCGTGCATCCGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 51}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142033586_1142033588 -5 Left 1142033586 16:87850479-87850501 CCATCGGTGACTGCGAGTCACCA 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 51
1142033582_1142033588 24 Left 1142033582 16:87850450-87850472 CCATGTGGGACCAGGCAGCCTCT 0: 1
1: 0
2: 3
3: 24
4: 240
Right 1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 51
1142033583_1142033588 14 Left 1142033583 16:87850460-87850482 CCAGGCAGCCTCTCTGCAGCCAT 0: 1
1: 0
2: 5
3: 50
4: 455
Right 1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 51
1142033585_1142033588 6 Left 1142033585 16:87850468-87850490 CCTCTCTGCAGCCATCGGTGACT 0: 1
1: 0
2: 1
3: 19
4: 136
Right 1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142033588 Original CRISPR CACCAGAGCGTGCATCCGCC GGG Intronic
911217008 1:95205902-95205924 CACCAGACAGTGAATCTGCCAGG - Intronic
919987490 1:202686005-202686027 CACCAGAGAGAGGGTCCGCCCGG + Intronic
1063179406 10:3584294-3584316 CACCAGAACTTGCATCCTGCAGG + Intergenic
1063970716 10:11379597-11379619 CACGAAAACGTGCATCCGGCCGG + Intergenic
1066442035 10:35448663-35448685 CAGCAGAGTGGGCATGCGCCTGG + Intronic
1072290089 10:93956845-93956867 CACCACAGCCTCCATCTGCCAGG + Intergenic
1072562438 10:96588108-96588130 CACGAGGGCGTTCATCTGCCAGG + Intergenic
1078088713 11:8250726-8250748 CAGCAGAGGCTGCATCCGACTGG - Intronic
1078897956 11:15614874-15614896 CACCAGAGCCTGCATCCCTGTGG - Intergenic
1095554351 12:43482954-43482976 CACCACTGCCTGCATCAGCCTGG + Intronic
1098080979 12:66785434-66785456 CACCACAGCTTCCATCCCCCAGG - Intronic
1114335342 14:21683651-21683673 CAACAGAGCTTGCATGCCCCTGG + Intergenic
1121022377 14:90588175-90588197 CACCAGAGGTTGCATCAGCAGGG - Intronic
1122144752 14:99682966-99682988 CAGCAGAGCATCCATCCCCCCGG - Intergenic
1122308394 14:100779716-100779738 CACCAGAACGTCCCTCCCCCCGG + Intergenic
1122788677 14:104175427-104175449 CACCAGAGGCTGCATCCCCCAGG + Exonic
1130199123 15:81808848-81808870 CACCAGAACTTGCATCCTCAGGG - Intergenic
1136483153 16:30555318-30555340 CACCAGTGGGTTCATCGGCCCGG - Exonic
1137021440 16:35432247-35432269 CACAAGAGGGTGCTGCCGCCTGG + Intergenic
1140959706 16:79900154-79900176 CAACAGAGCCTGCACCCACCAGG + Intergenic
1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG + Intronic
1142189573 16:88711743-88711765 CACCAGAGGGAGGATCCGCAGGG - Intronic
1142699750 17:1651676-1651698 CACCAGACCGTGCACCTGCCTGG - Exonic
1142849745 17:2698630-2698652 CACAAGAGCCTGCATCCACCTGG + Intronic
1144354281 17:14429266-14429288 AACCAGAGCTTGCACCAGCCTGG + Intergenic
1149287874 17:55185970-55185992 CACCAGAGCATGAAGCAGCCTGG + Intergenic
1150797189 17:68247913-68247935 CCCCTGAGCGTGCGGCCGCCTGG - Exonic
1151495951 17:74458192-74458214 CACCAGACCGTGCATAGGACGGG - Intergenic
1152066374 17:78114863-78114885 CACCACAGCCAGCATCCGCCTGG + Intronic
1154172137 18:12060142-12060164 CACCAGGGCTTGCATCTGCATGG + Intergenic
1155465788 18:26133873-26133895 CAACACAGCGTGCTACCGCCCGG - Exonic
1159746867 18:72247267-72247289 CACCAGAGCCTGCATCTCCCTGG - Intergenic
1159944267 18:74432197-74432219 GACCAGAGAGTGCATCCAGCTGG - Intergenic
1164852992 19:31500255-31500277 CATCAGAGCCTGGATCCGGCTGG - Intergenic
926997558 2:18753144-18753166 CACAAGAGTGTGCATCAGTCAGG + Intergenic
932332350 2:70904911-70904933 CACAATGGCGTGCAGCCGCCGGG + Intronic
932890093 2:75587086-75587108 AACTAGAGCATGCATCCACCTGG + Intergenic
943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG + Exonic
948582941 2:239000267-239000289 CACCAGACACTGCATCTGCCTGG - Intergenic
948871020 2:240798129-240798151 CACCAGCGCCTGCATCCACAGGG - Intronic
1178767604 21:35469002-35469024 CACCAGTGTGTGCATCGGCAGGG + Intronic
1181665341 22:24391661-24391683 CAACAGACCATGCCTCCGCCAGG - Intronic
1185373614 22:50471941-50471963 CAGCTGAGTGTGCATCTGCCTGG - Intronic
949552438 3:5122383-5122405 CACACGAGCGGGCCTCCGCCCGG - Exonic
950441099 3:13010953-13010975 CACTAGAGCTTGCCTCCTCCTGG + Intronic
969718188 4:8878440-8878462 CACCAGAGCATCCATCCTCCAGG - Intergenic
975815101 4:78209310-78209332 CACCAGTGCATGCAACCTCCAGG - Intronic
976629317 4:87220527-87220549 CAGGAGAGCGCGCGTCCGCCGGG - Exonic
986268700 5:6212544-6212566 CACCAGACACTGCATCAGCCAGG + Intergenic
997373821 5:133382963-133382985 GAACAGAGCGTGCAACTGCCTGG + Intronic
1005991799 6:30907882-30907904 CGCCAGAGCGCGCCTCCGCAAGG + Intergenic
1014824527 6:126033729-126033751 CAGCAGACCATGCATCTGCCAGG - Intronic
1018751299 6:166808457-166808479 CACTAGAGCATGAACCCGCCAGG + Intronic
1023510375 7:40946063-40946085 CACCATCGCGTGCATCATCCTGG - Intergenic
1043854117 8:85245431-85245453 CACCAGAGCCTGGAACTGCCAGG - Intronic
1055399910 9:75912247-75912269 AACCAGAACGTGCTTCCTCCAGG - Intronic
1061451920 9:130672025-130672047 CAGCAGGGCGTGCATCTGGCTGG + Intronic
1192177519 X:68895195-68895217 CGCCTGAGCCTGCACCCGCCTGG - Intergenic
1197262619 X:124334056-124334078 CACCAGGGTGTGCATCCTCCGGG - Intronic