ID: 1142033589 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:87850499-87850521 |
Sequence | CACCCGGCGGATGCACGCTC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 32 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 0, 4: 31} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1142033589_1142033595 | 15 | Left | 1142033589 | 16:87850499-87850521 | CCAGAGCGTGCATCCGCCGGGTG | 0: 1 1: 0 2: 0 3: 0 4: 31 |
||
Right | 1142033595 | 16:87850537-87850559 | AGCTCCACAGCTCCAGGACTGGG | 0: 1 1: 0 2: 0 3: 21 4: 235 |
||||
1142033589_1142033593 | 9 | Left | 1142033589 | 16:87850499-87850521 | CCAGAGCGTGCATCCGCCGGGTG | 0: 1 1: 0 2: 0 3: 0 4: 31 |
||
Right | 1142033593 | 16:87850531-87850553 | AGCGAAAGCTCCACAGCTCCAGG | 0: 1 1: 0 2: 0 3: 8 4: 112 |
||||
1142033589_1142033594 | 14 | Left | 1142033589 | 16:87850499-87850521 | CCAGAGCGTGCATCCGCCGGGTG | 0: 1 1: 0 2: 0 3: 0 4: 31 |
||
Right | 1142033594 | 16:87850536-87850558 | AAGCTCCACAGCTCCAGGACTGG | 0: 1 1: 0 2: 2 3: 27 4: 246 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1142033589 | Original CRISPR | CACCCGGCGGATGCACGCTC TGG (reversed) | Intronic | ||