ID: 1142033589

View in Genome Browser
Species Human (GRCh38)
Location 16:87850499-87850521
Sequence CACCCGGCGGATGCACGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 31}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142033589_1142033595 15 Left 1142033589 16:87850499-87850521 CCAGAGCGTGCATCCGCCGGGTG 0: 1
1: 0
2: 0
3: 0
4: 31
Right 1142033595 16:87850537-87850559 AGCTCCACAGCTCCAGGACTGGG 0: 1
1: 0
2: 0
3: 21
4: 235
1142033589_1142033593 9 Left 1142033589 16:87850499-87850521 CCAGAGCGTGCATCCGCCGGGTG 0: 1
1: 0
2: 0
3: 0
4: 31
Right 1142033593 16:87850531-87850553 AGCGAAAGCTCCACAGCTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 112
1142033589_1142033594 14 Left 1142033589 16:87850499-87850521 CCAGAGCGTGCATCCGCCGGGTG 0: 1
1: 0
2: 0
3: 0
4: 31
Right 1142033594 16:87850536-87850558 AAGCTCCACAGCTCCAGGACTGG 0: 1
1: 0
2: 2
3: 27
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142033589 Original CRISPR CACCCGGCGGATGCACGCTC TGG (reversed) Intronic