ID: 1142033590

View in Genome Browser
Species Human (GRCh38)
Location 16:87850512-87850534
Sequence CGCTGAGTGCAGGCACCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 134}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142033590_1142033598 19 Left 1142033590 16:87850512-87850534 CCGCCGGGTGCCTGCACTCAGCG 0: 1
1: 0
2: 1
3: 7
4: 134
Right 1142033598 16:87850554-87850576 ACTGGGATCATCTCTACCTGAGG 0: 1
1: 0
2: 1
3: 12
4: 130
1142033590_1142033595 2 Left 1142033590 16:87850512-87850534 CCGCCGGGTGCCTGCACTCAGCG 0: 1
1: 0
2: 1
3: 7
4: 134
Right 1142033595 16:87850537-87850559 AGCTCCACAGCTCCAGGACTGGG 0: 1
1: 0
2: 0
3: 21
4: 235
1142033590_1142033593 -4 Left 1142033590 16:87850512-87850534 CCGCCGGGTGCCTGCACTCAGCG 0: 1
1: 0
2: 1
3: 7
4: 134
Right 1142033593 16:87850531-87850553 AGCGAAAGCTCCACAGCTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 112
1142033590_1142033600 26 Left 1142033590 16:87850512-87850534 CCGCCGGGTGCCTGCACTCAGCG 0: 1
1: 0
2: 1
3: 7
4: 134
Right 1142033600 16:87850561-87850583 TCATCTCTACCTGAGGCTCTGGG 0: 1
1: 0
2: 1
3: 19
4: 190
1142033590_1142033594 1 Left 1142033590 16:87850512-87850534 CCGCCGGGTGCCTGCACTCAGCG 0: 1
1: 0
2: 1
3: 7
4: 134
Right 1142033594 16:87850536-87850558 AAGCTCCACAGCTCCAGGACTGG 0: 1
1: 0
2: 2
3: 27
4: 246
1142033590_1142033599 25 Left 1142033590 16:87850512-87850534 CCGCCGGGTGCCTGCACTCAGCG 0: 1
1: 0
2: 1
3: 7
4: 134
Right 1142033599 16:87850560-87850582 ATCATCTCTACCTGAGGCTCTGG 0: 1
1: 0
2: 1
3: 13
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142033590 Original CRISPR CGCTGAGTGCAGGCACCCGG CGG (reversed) Intronic