ID: 1142033593

View in Genome Browser
Species Human (GRCh38)
Location 16:87850531-87850553
Sequence AGCGAAAGCTCCACAGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142033591_1142033593 -7 Left 1142033591 16:87850515-87850537 CCGGGTGCCTGCACTCAGCGAAA 0: 1
1: 0
2: 0
3: 6
4: 143
Right 1142033593 16:87850531-87850553 AGCGAAAGCTCCACAGCTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 112
1142033589_1142033593 9 Left 1142033589 16:87850499-87850521 CCAGAGCGTGCATCCGCCGGGTG 0: 1
1: 0
2: 0
3: 0
4: 31
Right 1142033593 16:87850531-87850553 AGCGAAAGCTCCACAGCTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 112
1142033586_1142033593 29 Left 1142033586 16:87850479-87850501 CCATCGGTGACTGCGAGTCACCA 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1142033593 16:87850531-87850553 AGCGAAAGCTCCACAGCTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 112
1142033590_1142033593 -4 Left 1142033590 16:87850512-87850534 CCGCCGGGTGCCTGCACTCAGCG 0: 1
1: 0
2: 1
3: 7
4: 134
Right 1142033593 16:87850531-87850553 AGCGAAAGCTCCACAGCTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142033593 Original CRISPR AGCGAAAGCTCCACAGCTCC AGG Intronic
901508949 1:9704930-9704952 AGCGAGAGCTGCACATCTCTAGG - Intronic
904068827 1:27776839-27776861 AGAGAAAGCACCACGGCTTCAGG - Intronic
905907315 1:41627665-41627687 AGCGAAAGAGTCACTGCTCCTGG + Intronic
916132294 1:161621819-161621841 AGCCAAGGCTCCAGCGCTCCCGG - Intronic
917741370 1:177964682-177964704 AGGAAAAGCACCACAGCACCAGG + Intronic
920872389 1:209805497-209805519 CGCCAATGCTCCAAAGCTCCTGG + Intronic
921992469 1:221382358-221382380 TGCTAATGCTCCACAGATCCAGG - Intergenic
923985234 1:239374530-239374552 AGTAAAAACTCCACAACTCCGGG + Intergenic
1064562992 10:16611068-16611090 AGCCAAAGGTCCCCAGCGCCCGG + Intronic
1065921560 10:30397901-30397923 AGCCAAAGCTCCAAAGCTGAGGG + Intergenic
1069770239 10:70893858-70893880 TGAGAAAGCTCCACAGCCCCGGG + Intergenic
1071899339 10:90101976-90101998 ATCCATAGCTCCATAGCTCCAGG + Intergenic
1072656651 10:97334590-97334612 AGCGAAGCCCGCACAGCTCCGGG - Exonic
1074766099 10:116701039-116701061 AGAGGAAGTTCCACAGCTTCGGG - Exonic
1075659528 10:124183745-124183767 ATGGAAAGCCCCACAGCACCAGG + Intergenic
1076031550 10:127163360-127163382 AGCGAAATAGCTACAGCTCCCGG - Intronic
1076116905 10:127907250-127907272 AGCGGAGGCTCCGCATCTCCCGG - Exonic
1077203538 11:1327236-1327258 AGCGAAGTCTCCTCAGCTCAAGG - Intergenic
1079621355 11:22559003-22559025 AGAGAAAACTCCACAGCACACGG + Intergenic
1087067819 11:94044046-94044068 AGCAAAAGCTCCACCACTCCTGG - Intronic
1089067935 11:115676175-115676197 GGAGAAAGATCAACAGCTCCAGG - Intergenic
1093090373 12:14913493-14913515 GGGGAAAACTCCACAGCCCCTGG - Intergenic
1095587414 12:43864038-43864060 AGCGCACCCTCCACAGCTGCTGG - Intronic
1102506811 12:113389048-113389070 AGACAAAGCTCACCAGCTCCAGG - Exonic
1102695949 12:114799685-114799707 GGGGAAAGCACCACAGTTCCCGG - Intergenic
1103447721 12:121005002-121005024 AGCGACAGCCCTCCAGCTCCAGG - Exonic
1105423870 13:20276845-20276867 AACCAAAGCTGCACAGCTGCAGG - Intergenic
1108845673 13:54676716-54676738 AGCGCACCCTCCACAGCTGCCGG - Intergenic
1114262461 14:21047924-21047946 AGAGAAGGATCCTCAGCTCCAGG + Intronic
1115284255 14:31700690-31700712 AGCGCACCCTCCACAGCTGCTGG - Intronic
1118896791 14:69952163-69952185 AGTGCAACCTCCACTGCTCCAGG + Exonic
1122128362 14:99591272-99591294 AGAGAGGGCTGCACAGCTCCAGG - Intronic
1125420283 15:39498052-39498074 AGAGAGAGCTTCACAGATCCTGG - Intergenic
1127651409 15:61012017-61012039 AACGGAAGCTCCACAGCCCTGGG - Intronic
1127916450 15:63459230-63459252 AGCGCACCCTCCACAGCTGCTGG - Intergenic
1131679806 15:94709583-94709605 AGAGAAAGTCCCACATCTCCGGG - Intergenic
1133310554 16:4843505-4843527 AGCTCTGGCTCCACAGCTCCAGG + Intronic
1136089406 16:27907585-27907607 AGAGAAAGCTCTGCAGCTCTGGG + Intronic
1136191338 16:28616802-28616824 AGTGCAAGATCCTCAGCTCCGGG + Intronic
1137862067 16:51856648-51856670 TGCTAAAGTTCCACTGCTCCAGG - Intergenic
1138509452 16:57499772-57499794 AGGGTAAGCTCCACAGAGCCAGG + Intergenic
1142033593 16:87850531-87850553 AGCGAAAGCTCCACAGCTCCAGG + Intronic
1142411230 16:89918227-89918249 AGCGACACCCCCACAGCCCCAGG + Exonic
1143451600 17:7039986-7040008 AGCCAAAGCTTGACAGCTCCAGG + Exonic
1145028906 17:19489691-19489713 AGGGAAAGCCCCACAGCTCTTGG + Intergenic
1147232364 17:39028792-39028814 AGCGCAAGCTCCACATCCACAGG - Intergenic
1148754221 17:49964164-49964186 AGGGAAAACTTCAGAGCTCCGGG + Intergenic
1149658982 17:58324668-58324690 CGGGAAAGCTCCCCAGCCCCTGG + Intronic
1151881683 17:76899305-76899327 AGGGAAACCTCCACTGCTGCAGG - Intronic
1152668036 17:81582855-81582877 ACATAAAGCTCCACAGCTGCAGG + Intronic
1152691988 17:81722502-81722524 AGCCACAGCTCCCCAGGTCCAGG + Intergenic
1153715122 18:7839633-7839655 AGCCCAAGCTCCACAGCTTGTGG - Intronic
1154231436 18:12559304-12559326 AGCGCACCCTCCACAGCTGCTGG + Intronic
1154513374 18:15134568-15134590 AGAGAAAGCCCCACTGCACCAGG - Intergenic
1159109806 18:64043116-64043138 AGCGCACCCTCCACAGCTGCTGG - Intergenic
1161856570 19:6769130-6769152 GGATAAAGCTCCAGAGCTCCGGG - Intergenic
1165859504 19:38899956-38899978 GGCGGAAGCTCCAGAACTCCCGG + Intronic
924967377 2:91136-91158 GGCGCACGCTCCACAGCTGCTGG - Intergenic
928120640 2:28581420-28581442 AGCCAAAGCATCACATCTCCAGG - Intronic
934620319 2:95799554-95799576 AGGGAAAGGCCCCCAGCTCCTGG + Intergenic
937236166 2:120433034-120433056 AGCGCTTGCACCACAGCTCCAGG + Intergenic
938513620 2:131979179-131979201 AGAGAAAGCCCCACTGCACCAGG - Intergenic
940178869 2:150909418-150909440 AACCAAATCTCCACAGCACCTGG + Intergenic
943942727 2:194020306-194020328 AGCGCACCCTCCACAGCTACTGG - Intergenic
1171432163 20:25089897-25089919 AGCGAAATCTCCACGGGGCCTGG + Intergenic
1177977817 21:27872733-27872755 AGAGAAAGCCCCACTGCACCAGG + Intergenic
1178555722 21:33588543-33588565 GGCGGCAGCTCCACGGCTCCGGG + Exonic
1179530361 21:42014270-42014292 AGCAACAGGTCCAAAGCTCCGGG - Intergenic
1180043979 21:45294323-45294345 AGAGAAAGCACCACATCTCAGGG + Intergenic
1185135688 22:49070795-49070817 AGCTAAAGACCCACAGCCCCAGG - Intergenic
1185271484 22:49931292-49931314 AGAGAAGGCTCCCCAGCCCCAGG - Intergenic
951809064 3:26679492-26679514 AGTGAAAGGTACAGAGCTCCAGG - Intronic
952741555 3:36739008-36739030 AGCGGAAGCTGCAAGGCTCCTGG - Exonic
953729899 3:45438389-45438411 ACCCAAAGCTGCCCAGCTCCTGG - Intronic
954610440 3:51942136-51942158 AGCGCAAGCGCCACAGCATCAGG - Intergenic
956930560 3:74038436-74038458 AGCAAAAGCCTAACAGCTCCAGG + Intergenic
961529043 3:127528617-127528639 TGCAAAGGCTGCACAGCTCCTGG - Intergenic
964751863 3:160060669-160060691 AGCGCACCCTCCACAGCTGCTGG - Intergenic
965586981 3:170327568-170327590 AGCGCACCCTCCACAGCTGCTGG - Intergenic
965663999 3:171072393-171072415 AGGAAAAGATCCACAGCTCTTGG + Intronic
969303154 4:6309240-6309262 GGCGAACCCTCCACAGCTGCTGG + Intergenic
970971808 4:21992938-21992960 AGCAAAAACTCCCCAGCTCCTGG - Intergenic
971043350 4:22778811-22778833 AGCGCACCCTCCACAGCTGCTGG + Intergenic
972360939 4:38325131-38325153 AGCGCACCCTCCACAGCTACTGG + Intergenic
984044254 4:174778178-174778200 AGAGAAAGCACCACATCCCCAGG - Intronic
989757027 5:44967828-44967850 AGCCAAAGATCCACTGCTTCTGG + Intergenic
989777383 5:45225757-45225779 AGCGCACCCTCCACAGCTGCTGG - Intergenic
991505423 5:67319007-67319029 AGTGCATGCTCCACAGCTGCTGG - Intergenic
992189391 5:74276280-74276302 AGTGAAGGCTGCACAGCTGCTGG + Intergenic
994167013 5:96618648-96618670 AGCGCACCCTCCACAGCTGCTGG - Intronic
997579616 5:135009059-135009081 AGACACAGCTACACAGCTCCAGG - Intronic
1003224463 6:4191505-4191527 AGCGTACTCTCCACAGCTGCTGG + Intergenic
1003714385 6:8630284-8630306 AGCCAAATATCCACAGCTCAGGG - Intergenic
1010072923 6:71765355-71765377 AGGGGAGGTTCCACAGCTCCAGG + Intergenic
1018960073 6:168441573-168441595 GGCGAAGGCTCCACGGCCCCCGG - Intronic
1023987440 7:45104958-45104980 ACAGCAAGCTCCACAGCTCATGG - Intronic
1028769702 7:94603911-94603933 ACCCAAAGCTCCATACCTCCAGG - Intronic
1028989505 7:97034485-97034507 AGCGCACCCTCCACAGCTGCTGG - Intergenic
1029037921 7:97541356-97541378 AGCGCACCCTCCACAGCTTCTGG - Intergenic
1029511134 7:100995916-100995938 CCTGAAAGCTCCACAGCTTCAGG + Exonic
1029512435 7:101004415-101004437 CCTGAAAGCTCCACAGCTTCAGG + Exonic
1030689080 7:112514404-112514426 TGCCATAGCTCCACACCTCCCGG + Intergenic
1031997383 7:128241478-128241500 ATCCAACGCTCCCCAGCTCCCGG - Intronic
1032448516 7:132005030-132005052 AGAGGAAGCTCCAGAGCTTCAGG + Intergenic
1035429500 7:158807992-158808014 AGAGCAGGCCCCACAGCTCCAGG + Intronic
1039929906 8:41976471-41976493 AGAGACAGAACCACAGCTCCAGG - Intronic
1040418653 8:47219137-47219159 ACAGAAAGCCCCGCAGCTCCAGG - Intergenic
1040603616 8:48908774-48908796 AGGAAAATCTCAACAGCTCCAGG - Intergenic
1043924254 8:86018899-86018921 AGTGAAAGCTAAACAGCTGCTGG + Intronic
1044598526 8:93981189-93981211 AGCGAGAGCAGCACAGCTCCGGG + Intergenic
1047035912 8:120938183-120938205 AGAAACAGCTACACAGCTCCAGG - Intergenic
1055862703 9:80772181-80772203 GCAGAAAGATCCACAGCTCCTGG - Intergenic
1060218227 9:121751117-121751139 AGGGAAAGGTCCACAGCAGCCGG - Intronic
1060545623 9:124457473-124457495 AGCGTAAGCTCCGCACCTCCAGG - Exonic
1062723847 9:138059854-138059876 AGCGAAGCCTCCACATGTCCAGG - Intronic
1186861144 X:13673634-13673656 AGGGAAAGCCTCACAGCCCCAGG - Intronic
1190055033 X:47176318-47176340 AGGGAAAGCGCCACAGCTCTCGG - Intronic
1190391534 X:49936376-49936398 AGAGAAAGCTATACTGCTCCTGG - Intronic
1194561504 X:95427651-95427673 AGCTCAAGCTGCACAGCTCATGG + Intergenic
1196758253 X:119177000-119177022 AAAGAAACCTCCACAACTCCTGG + Intergenic
1201499581 Y:14627509-14627531 AGCGCAACCTCCGCTGCTCCTGG + Intronic