ID: 1142033593

View in Genome Browser
Species Human (GRCh38)
Location 16:87850531-87850553
Sequence AGCGAAAGCTCCACAGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142033590_1142033593 -4 Left 1142033590 16:87850512-87850534 CCGCCGGGTGCCTGCACTCAGCG 0: 1
1: 0
2: 1
3: 7
4: 134
Right 1142033593 16:87850531-87850553 AGCGAAAGCTCCACAGCTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 112
1142033591_1142033593 -7 Left 1142033591 16:87850515-87850537 CCGGGTGCCTGCACTCAGCGAAA 0: 1
1: 0
2: 0
3: 6
4: 143
Right 1142033593 16:87850531-87850553 AGCGAAAGCTCCACAGCTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 112
1142033589_1142033593 9 Left 1142033589 16:87850499-87850521 CCAGAGCGTGCATCCGCCGGGTG 0: 1
1: 0
2: 0
3: 0
4: 31
Right 1142033593 16:87850531-87850553 AGCGAAAGCTCCACAGCTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 112
1142033586_1142033593 29 Left 1142033586 16:87850479-87850501 CCATCGGTGACTGCGAGTCACCA 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1142033593 16:87850531-87850553 AGCGAAAGCTCCACAGCTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142033593 Original CRISPR AGCGAAAGCTCCACAGCTCC AGG Intronic