ID: 1142034740

View in Genome Browser
Species Human (GRCh38)
Location 16:87856014-87856036
Sequence TCCCACTTACAGACAGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 239}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142034740_1142034745 4 Left 1142034740 16:87856014-87856036 CCTTGGCCTGTCTGTAAGTGGGA 0: 1
1: 0
2: 1
3: 26
4: 239
Right 1142034745 16:87856041-87856063 CCAGTGAACATGATCCTCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 122
1142034740_1142034743 3 Left 1142034740 16:87856014-87856036 CCTTGGCCTGTCTGTAAGTGGGA 0: 1
1: 0
2: 1
3: 26
4: 239
Right 1142034743 16:87856040-87856062 CCCAGTGAACATGATCCTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142034740 Original CRISPR TCCCACTTACAGACAGGCCA AGG (reversed) Intronic
900007487 1:72329-72351 TCCCACCTCCCGACAGGCCCTGG + Intergenic
902138608 1:14333040-14333062 TCCCACTCCCTGACAGGCCCTGG + Intergenic
902279249 1:15362401-15362423 ATCCACTTACAGACAGGGAAAGG - Intronic
902365263 1:15968960-15968982 GCCCACTTCCTAACAGGCCACGG - Intronic
905638960 1:39575904-39575926 GCCCACGTACAGGGAGGCCATGG + Exonic
905913290 1:41668500-41668522 TCCCACTTGCAGTCATGCCCAGG + Intronic
908911385 1:69075153-69075175 TGCCACTTTCTGACAGGCCCAGG - Intergenic
909278373 1:73718178-73718200 GCCCAGTTTCTGACAGGCCATGG - Intergenic
911150614 1:94594159-94594181 TCCCAGTTCCTAACAGGCCACGG - Intergenic
912750369 1:112282569-112282591 TCCCAGTTCCTAACAGGCCATGG + Intergenic
913309604 1:117475518-117475540 TCCCACCCACCGACAGGCCCCGG + Intronic
916653347 1:166850584-166850606 GCCCAGTTCCTGACAGGCCATGG - Exonic
917062932 1:171059866-171059888 TCCCACTCCCAGACAGGCCCTGG - Intronic
920377067 1:205514522-205514544 TTCCACTTTCAGGCAGGCCAGGG - Intronic
920580098 1:207098386-207098408 TCCCTTCTACAGCCAGGCCAAGG - Intronic
920899082 1:210088353-210088375 TCCCACTTGCTGACAGGCCGTGG + Intronic
921512980 1:216054796-216054818 GTCCAATTACAGACAGGCCAAGG - Intronic
921680179 1:218022044-218022066 TGCCACTTTCTGACAGGCCCAGG + Intergenic
922176688 1:223202768-223202790 TCACACTTACCCACTGGCCAGGG - Intergenic
923087136 1:230710404-230710426 TCCCAGATAGAGAGAGGCCAGGG + Exonic
924655468 1:245971284-245971306 CCCCACCTCCAGACAGGCCTTGG - Intronic
1065697290 10:28391378-28391400 GCCCAGTTCCTGACAGGCCATGG - Intergenic
1069342371 10:67426643-67426665 TCCCACCTCCCGACAGGCCCCGG - Intronic
1069630678 10:69895329-69895351 GGCCACTTCCAGGCAGGCCATGG + Intronic
1069775107 10:70922285-70922307 TGCCACTTACTGACATGGCATGG + Intergenic
1070097795 10:73355157-73355179 GCCCAGTTCCTGACAGGCCACGG - Intronic
1070790115 10:79184118-79184140 TCCCACAGGAAGACAGGCCACGG - Intronic
1071280943 10:84102625-84102647 TGTCACTTTCTGACAGGCCAAGG - Intergenic
1071733093 10:88268586-88268608 TCCTACAGGCAGACAGGCCAGGG + Intergenic
1071919685 10:90335410-90335432 TCCCACCCTCAGACAGGCCCCGG - Intergenic
1072232692 10:93426330-93426352 TCCCACTGACAGCCAAGGCAGGG + Intronic
1072503453 10:96042324-96042346 TGCAACTGAGAGACAGGCCAGGG + Intergenic
1074274554 10:111988912-111988934 TCCAACTTACAGATAGGTCTGGG + Intergenic
1075050452 10:119179386-119179408 TCACACTTACTGTAAGGCCACGG - Intergenic
1075229704 10:120665011-120665033 TCCCACTTCCTGACAGGCCCTGG - Intergenic
1075855814 10:125629064-125629086 TCCGAACTACAGAGAGGCCATGG - Intronic
1077543064 11:3156769-3156791 TGCCACTTCCACACAGGCCGAGG + Intronic
1077849932 11:6066432-6066454 TCTCACTCACAGCCAGTCCATGG - Intergenic
1079665870 11:23104560-23104582 TCCCAGTTCCTAACAGGCCATGG + Intergenic
1079941149 11:26682356-26682378 TTCCACTTACTGGTAGGCCAGGG - Intronic
1079947860 11:26766038-26766060 TGTCACTTTCAGACAGGCCCAGG + Intergenic
1079976622 11:27099685-27099707 TCTCGCTTACAAACAGCCCATGG - Intronic
1083293450 11:61702603-61702625 TCTCACTTATAGCCAGGCCATGG + Intronic
1085032955 11:73283708-73283730 ACACACTTACAGTCAGGCCCAGG - Intronic
1085721964 11:78920430-78920452 TCCCATTTCCACACAGGTCATGG - Intronic
1087672072 11:101119197-101119219 GCCCACTTCCTAACAGGCCATGG + Intronic
1088564751 11:111157826-111157848 TCCCACTTACAGACTGGGTTTGG - Intergenic
1097906631 12:64926531-64926553 GCCCAGTTACTAACAGGCCATGG - Intergenic
1099543929 12:83951509-83951531 TCCCACTTACAAAAGGGCCAGGG + Intergenic
1105068022 12:133216956-133216978 TCCCATTGTCAGAGAGGCCAGGG + Intergenic
1105645453 13:22313046-22313068 CCCCACTGGCAGACAGGCCCTGG + Intergenic
1108673480 13:52715506-52715528 TCCCACTCCCTGACAGGCCCCGG + Intronic
1109928698 13:69183787-69183809 GCCCAGTTCCTGACAGGCCAAGG + Intergenic
1110878218 13:80537483-80537505 CCCCACCCCCAGACAGGCCACGG + Intergenic
1111386299 13:87533143-87533165 CCTCACTTCCAGACAGGCCCTGG - Intergenic
1113675615 13:112204983-112205005 TCCCACAGACAGACAGGGCGCGG - Intergenic
1114962361 14:27909343-27909365 TCCCACCTACCAACAGGCCCCGG - Intergenic
1115308569 14:31957037-31957059 GCCCAGTTCCAGACAGGCCATGG - Intergenic
1116835970 14:49769044-49769066 GCCCACTTACAGGGAGGCCGAGG + Intronic
1117121689 14:52574550-52574572 CCCCACCTACCGACAGGCCCCGG - Intronic
1121798189 14:96753011-96753033 ACCCAATTCCTGACAGGCCATGG - Intergenic
1122374475 14:101248915-101248937 TCCCGCTTACAGCCACCCCAGGG - Intergenic
1123057312 14:105577500-105577522 CCCCACCCACAGACAGGCCCCGG + Intergenic
1123112475 14:105879858-105879880 AACCACTTACACACAAGCCAGGG - Intergenic
1123114817 14:105889924-105889946 CACCACTTACACACAGGCCAGGG - Intergenic
1123121279 14:105918201-105918223 GACCACTTACACACGGGCCAGGG - Intronic
1123820051 15:24019786-24019808 TACCACTTCCAGTCAGGTCATGG - Intergenic
1124029916 15:26001279-26001301 TCCCACTCTCAGACACTCCATGG - Intergenic
1127473532 15:59311450-59311472 TCCCAGTTCCTAACAGGCCACGG + Intronic
1127751939 15:62054558-62054580 TCCCACCTCCTGACAGGCCCTGG - Intronic
1128253282 15:66178754-66178776 TCTGACTTTCAGACAGGCAAGGG - Intronic
1128376918 15:67083321-67083343 TCCCTCTTATAAACAGGCGATGG - Intronic
1128586032 15:68850919-68850941 TCCACCTTACAGGCAGGGCATGG - Intronic
1128737456 15:70061291-70061313 TCCCTCTGACAGACAGGGAAAGG + Intronic
1128743392 15:70097845-70097867 TACCACACACAGACAGGCGAAGG + Exonic
1128752237 15:70157981-70158003 TCCCTTTTAGAGCCAGGCCATGG + Intergenic
1128964937 15:72049553-72049575 GCCCAGTTTCTGACAGGCCATGG - Intronic
1129489517 15:75909920-75909942 TCCCACTCCCTGACAGGCCCTGG + Intronic
1129752428 15:78075747-78075769 ACCCACTTACAGACAGGACAGGG + Intronic
1131565690 15:93483436-93483458 GCCCAGTTCCAAACAGGCCACGG - Intergenic
1132132448 15:99295130-99295152 TTCCACTTCCAGACATGACAGGG - Intronic
1133162734 16:3922636-3922658 TCCCCCTTCCAGACAGGCAAGGG - Intergenic
1133288801 16:4704381-4704403 ACCCACTCATAGCCAGGCCAAGG - Intronic
1134077697 16:11303652-11303674 TCCCAAGGACAGGCAGGCCACGG + Intronic
1135837491 16:25840042-25840064 TTCCACTGATTGACAGGCCATGG - Intronic
1136553105 16:30992176-30992198 GCCCAGGTACACACAGGCCATGG - Exonic
1141318451 16:82983818-82983840 TCCCCCTTACAGTCAGTCCCAGG - Intronic
1141480011 16:84300211-84300233 GCCCACACACAGTCAGGCCAAGG + Intronic
1142034740 16:87856014-87856036 TCCCACTTACAGACAGGCCAAGG - Intronic
1142062282 16:88038247-88038269 CCCCTCTCACATACAGGCCATGG + Intronic
1146249306 17:31324355-31324377 TCACACATACAGGCAGGGCATGG - Intronic
1146579912 17:34027974-34027996 TCAATCTTACAGACAGCCCAGGG + Intronic
1148134676 17:45284592-45284614 TCTCACATACACACATGCCAGGG + Intronic
1148206207 17:45781811-45781833 TCCCGCTGACGGACAGGTCAGGG - Intergenic
1148355320 17:46971958-46971980 TCACACTTACAGCCAGGCCTGGG + Intronic
1148791720 17:50176969-50176991 TCCCACGTGAGGACAGGCCAGGG + Intergenic
1150575948 17:66430920-66430942 TCCCACTTACTGACTGGCAGAGG + Intronic
1151952664 17:77363825-77363847 CCCCAGTTACAGACACTCCAGGG + Intronic
1153784111 18:8518956-8518978 TGCCACTTCCAGAGTGGCCATGG - Intergenic
1157474038 18:48009963-48009985 GCCCACTTCCTAACAGGCCATGG - Intergenic
1157912853 18:51635442-51635464 TATCACTTTCTGACAGGCCAAGG + Intergenic
1158680250 18:59560436-59560458 TCCCACCCACTGACAGGCCCCGG - Intronic
1159222375 18:65481516-65481538 GCCCAGTTCCAAACAGGCCACGG + Intergenic
1160639243 19:113924-113946 TCCCACCTCCCGACAGGCCCTGG + Intergenic
1161367028 19:3885916-3885938 TCCCACTTAGAGAGAGACCCGGG - Intronic
1161698834 19:5784289-5784311 TCCCACTTAGGGACGGGGCAGGG + Exonic
1164137976 19:22431162-22431184 TTCCACTTTCTGACAGGCCAAGG - Intronic
1164197545 19:22983842-22983864 TCCCACTCCCCGACAGGCCCTGG - Intronic
1164806622 19:31121944-31121966 TCACACTTACAGAAAGCCTAGGG - Intergenic
1166303079 19:41922968-41922990 TCCCACTGACAGCCAGGTGAAGG + Intronic
1167825726 19:51971416-51971438 TCCCACTTACAGGGAGCCAAAGG + Intronic
925729895 2:6911845-6911867 GCCCCCTCACAGTCAGGCCAGGG - Intergenic
926834208 2:16999434-16999456 TTCCACTTACAGAGAGGAGAGGG - Intergenic
927338571 2:21953483-21953505 TCCCACAGACAGCCAGACCATGG - Intergenic
927469414 2:23361571-23361593 GCCCACTCACATGCAGGCCAGGG + Intergenic
927847803 2:26480380-26480402 TCCGTCTCACAGACAGGCCGTGG + Intronic
929794860 2:45051341-45051363 TCCCACCTCCCGACAGGCCCTGG + Intergenic
930110121 2:47671780-47671802 TGCCACTTTCTGACAGGCCTAGG - Intergenic
931774774 2:65531154-65531176 GCCCAGTTTCTGACAGGCCATGG + Intergenic
931949032 2:67340701-67340723 TGCCTCTTACAGACAGAACATGG - Intergenic
933253750 2:80057580-80057602 TCCCACTCACAGGCAGTCCTCGG + Intronic
936463181 2:112726296-112726318 TCCCACCCCCAGAAAGGCCAGGG - Intronic
939410866 2:141823126-141823148 TCTCTCTTACAGATAGGGCATGG + Intronic
941096455 2:161243959-161243981 TTCCACTTGCAGACATGCTAGGG + Intergenic
941754370 2:169168807-169168829 TTCAACTTTCAGACAGGTCAAGG - Intronic
943147149 2:184060281-184060303 TCCCACCCACCGACAGGCCCTGG + Intergenic
943152008 2:184125634-184125656 CCCCACTCCCAGACAGGCCCTGG + Intergenic
943156641 2:184187759-184187781 GCCCAGTTCCAAACAGGCCATGG + Intergenic
943388691 2:187234080-187234102 TCCCAGTTCCATAGAGGCCAGGG - Intergenic
943809736 2:192169840-192169862 TCTCTCTTACTGAAAGGCCAAGG + Intronic
943899135 2:193409397-193409419 TCCCACCTCCAAACAGGCCCTGG - Intergenic
945903772 2:215568036-215568058 CCCCACTTCCCGACAGGCCCCGG - Intergenic
946781787 2:223198913-223198935 TCCCACTCCCTGACAGGCCCAGG - Intergenic
948394934 2:237638454-237638476 TCCCAGTTCCTAACAGGCCATGG + Intronic
1168747353 20:254914-254936 TCCCAGTTCCTAACAGGCCATGG + Intergenic
1169019126 20:2315573-2315595 TGCCACTTACAGGCACTCCAAGG + Intronic
1169290765 20:4349622-4349644 TCCCACTTTCAGAAAGGTGAGGG - Intergenic
1169822993 20:9734568-9734590 ACACACATACACACAGGCCACGG + Intronic
1170453345 20:16508673-16508695 ACCCACTTCCTAACAGGCCATGG + Intronic
1171163275 20:22947854-22947876 TCCAGCTTACAGACAGCCTATGG + Intergenic
1171387222 20:24778610-24778632 TCCCACACACTGCCAGGCCAGGG + Intergenic
1172328770 20:34059132-34059154 TCCCACATTCAGACAGGGGAAGG - Intronic
1173904400 20:46615414-46615436 TCCATCTTACAGGGAGGCCAGGG + Intronic
1176243499 20:64085841-64085863 ACCCTCTTACTGAGAGGCCAGGG - Intronic
1177756031 21:25348715-25348737 CCCCACCTCCAGACAGGCCCCGG - Intergenic
1178157776 21:29874569-29874591 TCCCAGTTCCTAACAGGCCAAGG + Intronic
1178190807 21:30278153-30278175 TCCCACCCACCGACAGGCCCAGG - Intergenic
1179184107 21:39070720-39070742 CCCCACCTCCAGACAGGCCCTGG - Intergenic
1179915508 21:44475461-44475483 TCCCACATGCTGGCAGGCCACGG + Intergenic
1181881539 22:25984337-25984359 TCACACTTCCAGAGAGGCCCTGG - Intronic
1182820137 22:33208725-33208747 CCCCACCACCAGACAGGCCATGG + Intronic
1182987005 22:34729178-34729200 TCCCACCCCCAGACAGGCCCTGG - Intergenic
1183982629 22:41550774-41550796 TCCCTTTTACAGAGAGGCCGTGG - Intergenic
1185130597 22:49036408-49036430 TCCCACTATCAGGGAGGCCAAGG + Intergenic
949631636 3:5934541-5934563 TCCCACCCCCCGACAGGCCACGG + Intergenic
950257858 3:11520735-11520757 TGCCAGTTACTGACAAGCCAAGG - Intronic
950473907 3:13203965-13203987 GCTCACTTGGAGACAGGCCAGGG - Intergenic
953006273 3:38982208-38982230 TCCCAGTTCCAAACAGGCCAGGG - Intergenic
953139171 3:40211488-40211510 TCCAACTCACAGACAAGCCAGGG - Intronic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
954731390 3:52665519-52665541 GCCCAGTTCCAAACAGGCCATGG - Intronic
955459621 3:59167396-59167418 TCCCACCTACAGACATGCAGAGG - Intergenic
955510429 3:59675250-59675272 TCACACTTACATACAACCCAGGG + Intergenic
956891912 3:73622253-73622275 TGCAGCTGACAGACAGGCCAGGG + Intronic
957587064 3:82146239-82146261 TCCAGCTTGCAGACAGCCCATGG + Intergenic
957962792 3:87280486-87280508 CCCCACTCCCAGACAGGCCCCGG - Intergenic
961468651 3:127097470-127097492 TCCCAGTTCCAGCCACGCCAGGG - Intergenic
962136580 3:132741298-132741320 CCCCACCCACAGACAGGCCTGGG + Intergenic
963585265 3:147178584-147178606 TCCCACTAACACAGTGGCCAGGG - Intergenic
965134841 3:164750598-164750620 TCCCACCTCCTGACAGGCCCTGG + Intergenic
965642687 3:170847252-170847274 TCCCACTCTCTGACAGGCCCTGG + Intronic
966070396 3:175870494-175870516 CCCCACTTCCAGACAGGCCCTGG + Intergenic
966780401 3:183579591-183579613 ACCCACATAGAGAGAGGCCAAGG - Intergenic
966877594 3:184332082-184332104 TCCCAGTAAGAGCCAGGCCATGG + Exonic
967518463 3:190399789-190399811 GCCCAGTTACTAACAGGCCACGG - Intronic
969325124 4:6439559-6439581 TACCACTCACAGCCAGGCCCTGG + Intronic
971769367 4:30876909-30876931 ACCCACTCCCAGACAGGCCCCGG + Intronic
972058618 4:34837703-34837725 TCCCACCCACCGACAGGCCCCGG + Intergenic
972406573 4:38752053-38752075 TCCCACTTCAACACAGGCCACGG + Intergenic
974316483 4:60288293-60288315 TCCCACCTTCTGACAGGCCCCGG - Intergenic
975693651 4:76990455-76990477 GCCCAGTTCCGGACAGGCCACGG - Intronic
979024078 4:115545435-115545457 TTCCACTTTCTGACAGGCCCAGG - Intergenic
980151114 4:129049893-129049915 TGCCACCCACAGACAGGCCCTGG + Intronic
980194548 4:129571711-129571733 TCACAATCACAGACAGCCCAAGG - Intergenic
980973259 4:139586667-139586689 TCCCCATTCCAGACAAGCCAGGG + Intronic
981527682 4:145722689-145722711 GCCCACTTCCTAACAGGCCATGG - Intronic
982007463 4:151077079-151077101 TCCCACCCACTGACAGGCCCCGG + Intergenic
982109746 4:152043195-152043217 TCCCATTTACAGAAAGTACAGGG + Intergenic
983895669 4:173078974-173078996 TCCCACTTCCCGACAGGCCCTGG + Intergenic
984031678 4:174612257-174612279 TGCCACTTTCTGACAGGCCCAGG + Intergenic
985643683 5:1075173-1075195 TCCCACTTCCAGCCAGGCCGAGG - Intronic
986613388 5:9592129-9592151 TCCCACCTGCCGACAGGCCCCGG - Intergenic
987017976 5:13839349-13839371 CTCCACTTACAGACAGGTGATGG - Exonic
987936638 5:24475164-24475186 TGCCACTTTCTGACAGGCCCAGG - Intergenic
989627426 5:43443789-43443811 GCCCAGTTACTAACAGGCCATGG - Intergenic
990748594 5:58986445-58986467 GCCCAGTTCCTGACAGGCCACGG - Intronic
991423653 5:66467344-66467366 TGCCACTTTCTGACAGGCCCAGG - Intergenic
994756333 5:103797933-103797955 TGTCACTTTCTGACAGGCCAAGG + Intergenic
996352119 5:122555875-122555897 TCCCACTTACAGGCATACCTTGG - Intergenic
997400449 5:133597946-133597968 AACCACCTACAGACAAGCCAGGG + Intronic
998882118 5:146655055-146655077 AACCACCTGCAGACAGGCCAAGG - Intronic
1002746594 6:62330-62352 TCCCACCTCCCGACAGGCCCTGG + Intergenic
1004127762 6:12890018-12890040 ACCCACTTCCTAACAGGCCATGG - Intronic
1004501076 6:16210748-16210770 GCCCAGTTCCTGACAGGCCATGG + Intergenic
1004633063 6:17439867-17439889 CCCCACTTCCTAACAGGCCATGG + Intronic
1004646115 6:17562415-17562437 TGCCACTTTCTGACAGGCCCAGG - Intergenic
1007896425 6:45365689-45365711 TCCCAGTTTCATTCAGGCCACGG + Intronic
1008334116 6:50279665-50279687 TTCTAGTTAAAGACAGGCCAAGG + Intergenic
1008345685 6:50423608-50423630 TCCCCCTGACAAACAGGCCCTGG + Intergenic
1011486985 6:87852957-87852979 GCCCTCTTACAGGCAGGCCCAGG - Intergenic
1011518473 6:88178387-88178409 TCCAACTTGCAAAGAGGCCATGG - Intergenic
1017329648 6:153181345-153181367 TCCCACTTAGACACAAACCATGG - Intergenic
1017507292 6:155080276-155080298 TCCCACTGACAACCAGTCCAAGG - Intronic
1019263124 7:93446-93468 GCCCAGTTCCTGACAGGCCACGG - Intergenic
1019627766 7:2029629-2029651 TCCCATTTACAAACAGCTCAGGG + Intronic
1019774638 7:2905421-2905443 TCCCACATTCAGACAGACCCGGG + Intergenic
1020151026 7:5681753-5681775 TCCGGCTTACTGACTGGCCATGG + Intronic
1022651418 7:32279946-32279968 TCCCACTTACAAATATGTCATGG - Intronic
1022683197 7:32569897-32569919 GCTGACTTACAGACAGGGCAAGG + Intronic
1022782802 7:33602876-33602898 TCCCACATACAGAGACGGCAAGG - Intronic
1023729137 7:43173722-43173744 GCCCAGTTCCAAACAGGCCAAGG + Intronic
1023879750 7:44311774-44311796 TCCCACCTGCAGACAGGACAAGG + Intronic
1025715635 7:63953135-63953157 TCCCAGTTTCAGACAAGCCCAGG + Intergenic
1031497228 7:122465425-122465447 GCCCAGTTCCAAACAGGCCATGG - Intronic
1031772626 7:125864006-125864028 TCCCACTGATAGACAGGTAAAGG + Intergenic
1031952340 7:127905247-127905269 TCCCACTTACAGGCAAGCAGAGG - Intronic
1032782708 7:135176950-135176972 TCCCACTTTCATAGAGACCAGGG - Intergenic
1034678355 7:152909077-152909099 TCCCACCTTCTGACAGGCCCCGG + Intergenic
1034970723 7:155417757-155417779 TCCCACTCACGGGCAGGGCATGG - Intergenic
1035637442 8:1156999-1157021 TCCAAGTTTCAGGCAGGCCAGGG + Intergenic
1037195875 8:16188665-16188687 TCCCACCTACTGACAGGCCCCGG + Intronic
1037207692 8:16343340-16343362 GCCCAGTTACTAACAGGCCATGG - Intronic
1038598460 8:28912782-28912804 TACCACTTACAGACTAGCCTAGG + Intronic
1038869095 8:31474338-31474360 TCCCAGCTACAGAGATGCCATGG + Intergenic
1040509209 8:48078647-48078669 TCCAGCTTACAGACAGCACATGG - Intergenic
1043347063 8:79310745-79310767 GCCCAGTTACTAACAGGCCATGG + Intergenic
1044110698 8:88269293-88269315 TCACAGTGAAAGACAGGCCATGG - Intronic
1044696209 8:94924659-94924681 GCCCACTTACAGAGTGTCCAGGG - Intronic
1046901850 8:119532114-119532136 TTCCTCTTAATGACAGGCCATGG + Intergenic
1048303489 8:133267688-133267710 TCCCTCTAAAAGACAGGCCAGGG + Intronic
1048594722 8:135854375-135854397 TCCCACTCCCCGACAGGCCCCGG + Intergenic
1049604013 8:143520807-143520829 TCCCACTGACAGGCAGCTCACGG + Intronic
1051486303 9:17612105-17612127 TCCCCCATACAGACAGGTCACGG - Intronic
1051770348 9:20571594-20571616 TCCCACCCCCAGACAGGCCCTGG + Intronic
1052699463 9:31920566-31920588 GCCCACTTCCTAACAGGCCATGG - Intergenic
1054933281 9:70659320-70659342 TCTCACTTTCTGACAGGCCCAGG + Intronic
1055045357 9:71918509-71918531 GCCCAGTTCCTGACAGGCCATGG - Intronic
1055388001 9:75785124-75785146 TCCCACCCACCGACAGGCCCTGG + Intergenic
1055844424 9:80544302-80544324 TCCAATTTACAGAAATGCCAGGG + Intergenic
1056198146 9:84248683-84248705 CCCCACCTACTGACAGGCCCCGG - Intergenic
1057006753 9:91567752-91567774 TCCCACCCACAGAGAGGTCAGGG - Intronic
1057605887 9:96497326-96497348 CCCCACTCCCACACAGGCCAGGG + Intronic
1057840292 9:98480839-98480861 TCCCACTCACAGACTGAGCAGGG + Intronic
1059054590 9:110966112-110966134 CCCCACTCCCAGACAGGCCCTGG - Intronic
1060731588 9:126040259-126040281 TCCCATTTACAGACGGGGAAAGG + Intergenic
1185606134 X:1367986-1368008 TCCCACTGACAGACACCCCCTGG + Intronic
1189175994 X:38957757-38957779 CCCCACTCACAGAGAGGCCATGG + Intergenic
1189270266 X:39746567-39746589 TTCCACCTACAGAGAGGCCATGG - Intergenic
1189864111 X:45306208-45306230 TGCCACTTTCTGACAGGCCCAGG + Intergenic
1192160333 X:68781661-68781683 CCCCACTGACTGACAGGCCCTGG - Intergenic
1193335186 X:80279710-80279732 TCCCACGTCCTGACAGGCCCTGG - Intergenic
1194233692 X:91356335-91356357 TGCCACTTTCTGACAGGCCCAGG - Intergenic
1194910958 X:99644068-99644090 CCCCACTCCCAGACAGGCCCAGG + Intergenic
1196884831 X:120234316-120234338 TGCCACTTTCTGACAGGCCCAGG + Intergenic
1198107957 X:133478945-133478967 TCCCACTTACAGAAAGAGCAAGG + Intergenic
1199887257 X:152032544-152032566 TGCCACTTTCTGACAGGCCCAGG - Intergenic
1199925950 X:152464258-152464280 CCCCACTTACCGACAGGCCCTGG - Intergenic