ID: 1142036113

View in Genome Browser
Species Human (GRCh38)
Location 16:87862965-87862987
Sequence TCTCGCGGGACTCTGGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 3, 1: 0, 2: 0, 3: 7, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142036113_1142036121 6 Left 1142036113 16:87862965-87862987 CCCGCAGCCAGAGTCCCGCGAGA 0: 3
1: 0
2: 0
3: 7
4: 89
Right 1142036121 16:87862994-87863016 GACGGCCTGCCCCTGCGTGACGG 0: 3
1: 0
2: 0
3: 4
4: 80
1142036113_1142036126 16 Left 1142036113 16:87862965-87862987 CCCGCAGCCAGAGTCCCGCGAGA 0: 3
1: 0
2: 0
3: 7
4: 89
Right 1142036126 16:87863004-87863026 CCCTGCGTGACGGCACGCCTGGG 0: 3
1: 0
2: 0
3: 4
4: 38
1142036113_1142036124 15 Left 1142036113 16:87862965-87862987 CCCGCAGCCAGAGTCCCGCGAGA 0: 3
1: 0
2: 0
3: 7
4: 89
Right 1142036124 16:87863003-87863025 CCCCTGCGTGACGGCACGCCTGG 0: 3
1: 0
2: 0
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142036113 Original CRISPR TCTCGCGGGACTCTGGCTGC GGG (reversed) Intronic