ID: 1142037164

View in Genome Browser
Species Human (GRCh38)
Location 16:87869452-87869474
Sequence GCTCGCTGGGCCGCGGCTCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142037164_1142037171 14 Left 1142037164 16:87869452-87869474 CCGGGAGCCGCGGCCCAGCGAGC 0: 1
1: 0
2: 1
3: 15
4: 169
Right 1142037171 16:87869489-87869511 CCGCCGCCCGCAGCTGCGTCAGG 0: 2
1: 0
2: 2
3: 14
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142037164 Original CRISPR GCTCGCTGGGCCGCGGCTCC CGG (reversed) Exonic
900236593 1:1594497-1594519 TCCGGCTGGGACGCGGCTCCAGG + Intergenic
900349628 1:2228395-2228417 GCTCGCGGGCCCGGGGCTCGCGG - Intergenic
900597825 1:3490534-3490556 CCTCGCTGGTCCACCGCTCCGGG + Exonic
900619668 1:3580950-3580972 GGTGGCTGGGCTGGGGCTCCTGG + Intronic
901003999 1:6162936-6162958 TCTCCCTGGGCCGCCACTCCTGG - Intronic
901194492 1:7432897-7432919 GCTGGCTGGGCCCTGGCTGCAGG - Intronic
901631694 1:10651169-10651191 GCTGGGTGGGCCCCGGCTACTGG + Intronic
901954554 1:12774948-12774970 GCTCCCTGGGCAGCTCCTCCAGG - Exonic
901989086 1:13097869-13097891 GCTCCCTGGGCAGCTCCTCCAGG + Intergenic
901992727 1:13128898-13128920 GCTCCCTGGGCAGCTCCTCCAGG - Intergenic
902263881 1:15247438-15247460 CCTCGCTGGGCCGCCCCTTCCGG - Intronic
902535941 1:17119393-17119415 GCTCGCTGGTCCGGGGCGGCCGG + Exonic
904053770 1:27656872-27656894 TCTCTCTGGGCCTCAGCTCCAGG + Intergenic
906035349 1:42747274-42747296 GCTCGCTGTGTCGAGGGTCCAGG + Exonic
906191574 1:43902598-43902620 GCTGGCTTGGCCACGGCTCCTGG - Intronic
908605625 1:65793657-65793679 GTTTGCTGGGCTGAGGCTCCAGG + Intronic
912775181 1:112502288-112502310 GCTCCCCGGGCCGCGGCCCTGGG + Intronic
919820507 1:201469135-201469157 GCGCGCTGGGCGGCAGCTCGCGG + Exonic
920914793 1:210251366-210251388 GCTTGCAGGGCCGCGCCCCCCGG - Intergenic
922518225 1:226223812-226223834 GGTCGCTGGGCCGGGGCCCGCGG - Exonic
922586410 1:226737555-226737577 GCGCGCGGAGCCGCGGCTGCCGG - Exonic
924590748 1:245402004-245402026 GCTTGCAGGGCTGGGGCTCCTGG + Intronic
1066126321 10:32346576-32346598 CCCCGCTGGGCCGCGGCGGCCGG + Intronic
1067694358 10:48524222-48524244 GACCGCCGGCCCGCGGCTCCCGG + Intronic
1075119148 10:119651638-119651660 GCCCGCTGGGGCGCGGGTGCGGG - Exonic
1075885421 10:125896011-125896033 TCCCGCTGAGGCGCGGCTCCCGG + Intronic
1077097139 11:803877-803899 GCTGGCTGGGCCCTGGCTCCTGG - Intronic
1077204855 11:1337240-1337262 GGTGGTGGGGCCGCGGCTCCGGG - Intergenic
1077491445 11:2862709-2862731 GCACGCCCGGCCGCGGCTCCCGG - Intergenic
1077543881 11:3160478-3160500 ATTCGCTGGGCTGCGGCTCCAGG - Intronic
1079163251 11:18013221-18013243 GCTGACTGGGAGGCGGCTCCGGG - Intergenic
1080802141 11:35618788-35618810 GGGCGCGGGGCCGCCGCTCCGGG - Exonic
1082814581 11:57499667-57499689 GCCCCCTGGGCCGCTGCTCTTGG - Intronic
1084611118 11:70203621-70203643 GCTCGGTGTGCCCGGGCTCCAGG - Exonic
1089359292 11:117875719-117875741 GCTCGCGGGACCGTGGCTACTGG - Intronic
1092462344 12:8697847-8697869 GCCCGCCGCGCCGCGGCGCCAGG + Intronic
1093433038 12:19105433-19105455 GCTCGCTGAGCTGTGGATCCTGG - Intergenic
1096254994 12:50057513-50057535 GCGCGCGGGGCCCCGGATCCGGG - Intergenic
1101504082 12:105330720-105330742 GCGCCCCGGGCCGCGTCTCCCGG + Exonic
1101970453 12:109309130-109309152 CCTCGCGGGGCCGCCGCTGCCGG + Exonic
1104542717 12:129682338-129682360 GCTCACTGGGCCTCAGTTCCTGG - Intronic
1106665387 13:31846497-31846519 GCGCGCTCGGCCTCCGCTCCTGG - Intergenic
1110573065 13:77026937-77026959 GCGCGGGGGGCCGCGGCTGCGGG - Exonic
1111220972 13:85205254-85205276 GCCCCCTGCTCCGCGGCTCCAGG + Intergenic
1113379023 13:109786360-109786382 GCTCGCTGGGCCGGGAGTCGGGG + Exonic
1113437907 13:110307412-110307434 GCTCTCTGGGCGCCGGCCCCGGG - Exonic
1113943352 13:114029854-114029876 CCTCGCTCAGCCGCAGCTCCAGG + Exonic
1113985691 13:114314263-114314285 GCGCGCCCGGGCGCGGCTCCGGG - Intergenic
1118137575 14:63045900-63045922 GCTGGCGCGGACGCGGCTCCCGG + Intronic
1119003911 14:70907541-70907563 GGGGGCCGGGCCGCGGCTCCGGG + Exonic
1119398933 14:74348987-74349009 GCTGGCAGGTCCGGGGCTCCAGG - Intronic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1120190681 14:81436627-81436649 ACTCGCTTTCCCGCGGCTCCCGG + Intergenic
1122542779 14:102507266-102507288 GCCAGCTGGGCCGCGACGCCGGG - Exonic
1122890120 14:104728318-104728340 GGTTACTGGGCCGTGGCTCCAGG + Intronic
1202872631 14_GL000225v1_random:177906-177928 TCTCGCTGAGGCGTGGCTCCCGG - Intergenic
1128173176 15:65530745-65530767 GCGCGCGGGATCGCGGCTCCGGG + Intronic
1130305328 15:82709427-82709449 CCGCGCTGGGCCGGGGCTCCAGG + Intronic
1130531137 15:84748551-84748573 GCGGGCGGGGCTGCGGCTCCGGG - Intergenic
1132551647 16:556196-556218 GCTGACTGGGCCGCGGCTCCAGG + Intergenic
1132719842 16:1310067-1310089 CCTCGCGGGGCCCCGGCTGCAGG - Intronic
1133188513 16:4116565-4116587 GCGCGCTGGGCTGGGGCTGCGGG + Intergenic
1135206995 16:20492445-20492467 GCAGCCTGGGCCGGGGCTCCAGG - Intergenic
1135211890 16:20531187-20531209 GCAGCCTGGGCCGGGGCTCCAGG + Intergenic
1135324960 16:21520395-21520417 CCTCGCTCGGCTGCGGCTCCCGG - Intergenic
1136336445 16:29613670-29613692 CCTCGCTCGGCTGCGGCTCTCGG - Intergenic
1138105272 16:54284544-54284566 GCCGGGTGGCCCGCGGCTCCGGG + Exonic
1139664838 16:68448240-68448262 GCTCTCAGGACCGCGGGTCCCGG - Intronic
1142037164 16:87869452-87869474 GCTCGCTGGGCCGCGGCTCCCGG - Exonic
1142156473 16:88534733-88534755 GCGGGCCGGGCGGCGGCTCCTGG - Exonic
1142403423 16:89873119-89873141 GCTCGAGGGGCGGCGGCTCCAGG + Intergenic
1142549891 17:732274-732296 GCGGGAAGGGCCGCGGCTCCCGG - Intergenic
1143782659 17:9237553-9237575 GCACCCTGGGCTGGGGCTCCAGG - Intronic
1144952839 17:19003478-19003500 GCTGGTTGGGCCATGGCTCCAGG + Intronic
1145094155 17:20009819-20009841 GCACGCCCGGCCCCGGCTCCTGG + Intronic
1147896568 17:43755386-43755408 GGGCGCGGGGCCGCGGCTTCCGG + Exonic
1147994849 17:44354862-44354884 GCTCGCTCGGCCGAGGGCCCCGG - Exonic
1148122513 17:45221550-45221572 GCGCGCTCGGCGGCGCCTCCGGG - Intronic
1148490906 17:48023678-48023700 TCTGGCTGGGCCCTGGCTCCTGG + Intergenic
1149655547 17:58308063-58308085 GCAGGCTGGGCCGAGGCTCCGGG - Intronic
1150423286 17:65056950-65056972 GCGCGCCCGGCCGCGGCTGCGGG - Intergenic
1151943390 17:77306380-77306402 GCTCCCAGGGCCGCTCCTCCTGG + Intronic
1152263184 17:79278232-79278254 GCTCCCTGGCCCGTGGCTCCAGG + Intronic
1152305990 17:79520404-79520426 GCTCGCTCAGCTGCAGCTCCAGG - Intergenic
1152555093 17:81049082-81049104 GCTCCCTGGGCCGCGTTCCCGGG - Intronic
1152661956 17:81546630-81546652 GCTCGCTGGGCTGGGGGGCCAGG + Intronic
1152748450 17:82051774-82051796 GCTCGCAGCGCCGGGGGTCCCGG - Exonic
1152758725 17:82097744-82097766 TCGGGCTGGGCCTCGGCTCCGGG + Intronic
1152815916 17:82407712-82407734 GCTGGCTGGGCCGCTGCTTTGGG - Intronic
1152897702 17:82922782-82922804 GCTCTGTTGGCCTCGGCTCCTGG + Intronic
1156275840 18:35581891-35581913 GCGCGCAGCGCTGCGGCTCCGGG - Intronic
1157842138 18:50968286-50968308 GCTGGGTGGGCGGCGGCGCCGGG - Intronic
1159999355 18:75002012-75002034 GCTCTCTGGACCCTGGCTCCTGG - Intronic
1160067455 18:75589062-75589084 GCAGGCTGGGCCGAGGTTCCGGG + Intergenic
1160724977 19:613867-613889 GCTCGCCGTGCGGCGGCCCCGGG - Exonic
1161095014 19:2385183-2385205 GCTCGCGGGGGCGGGGCTCGAGG + Intergenic
1161583587 19:5093426-5093448 GCTCCCTGGGCTTCGGCTGCGGG - Intronic
1163437873 19:17306081-17306103 CCTCTCTGAGCCTCGGCTCCCGG - Intronic
1164051186 19:21586729-21586751 GCTGGCTGGGCAGCGGCGCTGGG + Intergenic
1166108950 19:40611285-40611307 GCCCACAGGGCGGCGGCTCCTGG - Exonic
925909713 2:8565813-8565835 GGTCTCTGGGCAGTGGCTCCAGG + Intergenic
926735409 2:16069972-16069994 GCTCCCTCGCCCGCTGCTCCCGG - Intergenic
928205873 2:29283040-29283062 GCTTGCTGGACCATGGCTCCAGG - Intronic
932759446 2:74429905-74429927 GCTCCCTGGGCCGCTCCTCAGGG - Exonic
933356209 2:81211883-81211905 GATGGCTGGGCCTCGGCCCCAGG + Intergenic
934113686 2:88765108-88765130 GCGCGGCGGGCCGCAGCTCCGGG + Intergenic
937252285 2:120532552-120532574 GCTGGCTGGGCCAGAGCTCCTGG + Intergenic
937299149 2:120828217-120828239 GCTTGCTGGGCCAAGGCCCCCGG + Intronic
943185178 2:184598358-184598380 GCTGGCGCGGCCGCGGGTCCCGG + Exonic
946396964 2:219448122-219448144 GCGGGCTGGGCCGGGGGTCCCGG - Exonic
946397155 2:219448870-219448892 GCCCGCCGGCCCGCGGCTCCTGG - Exonic
947549796 2:231037919-231037941 GCAGGCGGCGCCGCGGCTCCCGG - Exonic
948641758 2:239379575-239379597 GCTCTCAGGGCACCGGCTCCTGG + Intronic
948800078 2:240429542-240429564 CCTCCCTGGGCCGCAGCCCCAGG + Intergenic
1169006035 20:2207725-2207747 GCTCGCTGGCACGGAGCTCCCGG + Intergenic
1171427528 20:25058070-25058092 GCACCCTGGGCCGCGGCGTCGGG - Exonic
1173732833 20:45340509-45340531 ACTGGCTGGGCCAGGGCTCCAGG + Intronic
1174172437 20:48625849-48625871 CCACGCTGGGCCGCGGCCTCTGG - Exonic
1175787331 20:61720263-61720285 GCTCTATGGGCCGCACCTCCTGG + Intronic
1176179503 20:63742719-63742741 CCTCCGTGGGCTGCGGCTCCAGG - Exonic
1179185506 21:39082781-39082803 CCTGGCTGGGCTGCCGCTCCAGG + Intergenic
1179411798 21:41168190-41168212 AGTCGCTGAGCCGCGGCTGCCGG + Exonic
1179879041 21:44285923-44285945 CCTCGCTTGGCCTCGGGTCCCGG - Exonic
1179968053 21:44818172-44818194 GCAGGCCGGGCCGCGGCTCTGGG + Intronic
1181155450 22:20917382-20917404 ACGCGCTGGGCCCCGGCTCCCGG - Intergenic
1181386690 22:22550957-22550979 GCTCCCTGGGCAGCAACTCCAGG + Exonic
1183324131 22:37182349-37182371 GCTCGCTGGGCTGCGCGTACAGG + Exonic
1184136554 22:42553582-42553604 GCTCGCTGGCCCGCGCCGCAGGG - Intergenic
1184744397 22:46447953-46447975 GCTGGATGGGCCTTGGCTCCTGG - Intronic
1185055178 22:48575619-48575641 CCACGCTGGGCCGCCGCTGCCGG - Intronic
1185370046 22:50456731-50456753 GCTGGCTGGGCCCGGCCTCCAGG + Intronic
950528862 3:13540785-13540807 GCCTGCTGGGCCGTGGCCCCAGG + Intergenic
951640355 3:24829286-24829308 GCTCGCTGCGCCCCGCCCCCTGG - Intergenic
952851728 3:37734994-37735016 GCACGCTGGGCTGCGGATACGGG - Intronic
952867175 3:37861949-37861971 GCTCTCCCGGGCGCGGCTCCGGG + Intronic
954419486 3:50411081-50411103 GCTCACTGGGCTGTGGCTCCAGG + Intronic
954912798 3:54122727-54122749 GCTCGCCGCGCCGCGCGTCCCGG + Exonic
962249766 3:133828805-133828827 CCTCGCTGGCCGGGGGCTCCTGG + Exonic
967983251 3:195077993-195078015 CCTCCCAGGGCCGAGGCTCCGGG - Intronic
968490647 4:889034-889056 GCTGGCTGGGCCCAGGCCCCAGG + Intronic
968583872 4:1406988-1407010 GCTCGCTGGCCCGCGCGCCCTGG - Intergenic
968586143 4:1416993-1417015 ACTCACTGGGCCGCACCTCCAGG - Intergenic
969671521 4:8592740-8592762 GCTCGCTGGGCTCCCGCCCCCGG - Exonic
983296339 4:165873533-165873555 GCTCGCCGAGCCGCGGCCGCGGG + Exonic
984734753 4:183098961-183098983 CCCCGCGGGGCCGCGGCTCCAGG - Intergenic
985541755 5:490667-490689 CCTCGAGGGGCCGCGGGTCCAGG + Intronic
985995697 5:3595904-3595926 GCTCGCAGGCGCCCGGCTCCCGG - Intergenic
990753113 5:59039417-59039439 GGGCGTGGGGCCGCGGCTCCGGG - Intronic
998018907 5:138753596-138753618 GCTCGCCCGCCCGCGGCTCGCGG - Intronic
998546079 5:143029040-143029062 GCTCCCTGGGCTGTGGCCCCTGG - Intronic
1002928850 6:1620111-1620133 GCGCGCTGAGCCGCAGCGCCTGG + Intergenic
1004561920 6:16760393-16760415 GCTCGCGGGCTCCCGGCTCCGGG + Intronic
1005816036 6:29553640-29553662 GCACGCTGGCCAGCGCCTCCTGG + Intergenic
1006630404 6:35426612-35426634 GCTCTCTGGGCCTGGGTTCCAGG + Exonic
1007594565 6:43043536-43043558 GAAAGCTGGGCCGCGGCTCTGGG + Exonic
1010372876 6:75132001-75132023 GTTCGCTGGGACCCTGCTCCAGG - Exonic
1013232281 6:108169241-108169263 GACCTCTGAGCCGCGGCTCCCGG - Intronic
1014632495 6:123803754-123803776 GCTCGCCGCGCGCCGGCTCCGGG - Intergenic
1019140017 6:169937111-169937133 GCCCGATGGGCCGCGGCACTGGG - Intergenic
1020787992 7:12592927-12592949 GGCCCCTGGGCCCCGGCTCCCGG - Intronic
1025958252 7:66199128-66199150 TCTCCCTGGGTCCCGGCTCCTGG + Intergenic
1033657122 7:143381713-143381735 GCGCGCTGGGCCCCGGGTGCCGG - Exonic
1034188318 7:149195804-149195826 GCGGGCTGGGCCGCGGGACCGGG + Intronic
1034413815 7:150954871-150954893 GCGCGCTGGGCTGAGGCACCTGG - Intronic
1039843456 8:41309376-41309398 GCTGGGTGCGCCCCGGCTCCCGG + Exonic
1040572051 8:48620008-48620030 GCTTTCTCGGCCACGGCTCCTGG - Intergenic
1043873982 8:85464279-85464301 GCTCGCGGCTCCGCGGCGCCGGG + Intronic
1049396315 8:142402864-142402886 TCTCGCGGGGCTGCGGCTCAGGG + Intronic
1049427689 8:142544663-142544685 GCCCGCTGGGCCTCGGCCCGAGG - Exonic
1049515270 8:143051184-143051206 GCTAGCTGGGCCACTGCTCCCGG - Intronic
1049562487 8:143318636-143318658 GAGCGCTGGGCATCGGCTCCAGG + Intronic
1049759861 8:144327037-144327059 GCTCCCAGGGCCGGGGCTGCGGG + Intergenic
1049988556 9:972763-972785 CCCCGCTGGGCCGCGGTTCCTGG - Intergenic
1052885304 9:33641121-33641143 GATTTCTGGGCCGCAGCTCCAGG + Intergenic
1055036929 9:71827489-71827511 GCTTGCTGGGCCCCATCTCCAGG + Intergenic
1057806421 9:98223021-98223043 CCTCTCTGGGCCACGGCACCTGG - Intronic
1060209340 9:121700257-121700279 GCTCCCTGGCCAGCGTCTCCCGG - Intronic
1060968495 9:127724688-127724710 GCCGGCTGGGCTGGGGCTCCCGG + Intronic
1061641538 9:131961308-131961330 GCTGTCTGGGCGGCGGCTCTGGG + Intronic
1061859535 9:133460761-133460783 GCTCACTGCCCCGCGGCCCCAGG - Intronic
1062121057 9:134834229-134834251 GATCGCTGGGTCGGGGCACCTGG - Intronic
1062249905 9:135588776-135588798 TCTCCCTGGGCCACGGGTCCAGG + Intergenic
1062592082 9:137278717-137278739 GCTCGGGGGGCCGCGGCAGCAGG - Exonic
1203731826 Un_GL000216v2:98636-98658 TCTCGCTGAGGCGTGGCTCCCGG + Intergenic
1196907903 X:120456139-120456161 ACTCGCTGGGCCGAGGCTGGAGG - Intronic
1199942365 X:152638472-152638494 GCTCGCTGAGCCCTGGCGCCCGG + Intronic