ID: 1142038339

View in Genome Browser
Species Human (GRCh38)
Location 16:87876551-87876573
Sequence AAGCTAGAAGGATTCGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142038339_1142038342 -7 Left 1142038339 16:87876551-87876573 CCTTCACCGAATCCTTCTAGCTT No data
Right 1142038342 16:87876567-87876589 CTAGCTTCTGTTTGAACACTTGG No data
1142038339_1142038350 28 Left 1142038339 16:87876551-87876573 CCTTCACCGAATCCTTCTAGCTT No data
Right 1142038350 16:87876602-87876624 CCCGTTTCCTGAAGTTCGTATGG No data
1142038339_1142038343 -6 Left 1142038339 16:87876551-87876573 CCTTCACCGAATCCTTCTAGCTT No data
Right 1142038343 16:87876568-87876590 TAGCTTCTGTTTGAACACTTGGG No data
1142038339_1142038353 30 Left 1142038339 16:87876551-87876573 CCTTCACCGAATCCTTCTAGCTT No data
Right 1142038353 16:87876604-87876626 CGTTTCCTGAAGTTCGTATGGGG No data
1142038339_1142038352 29 Left 1142038339 16:87876551-87876573 CCTTCACCGAATCCTTCTAGCTT No data
Right 1142038352 16:87876603-87876625 CCGTTTCCTGAAGTTCGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142038339 Original CRISPR AAGCTAGAAGGATTCGGTGA AGG (reversed) Intergenic
No off target data available for this crispr