ID: 1142038340

View in Genome Browser
Species Human (GRCh38)
Location 16:87876557-87876579
Sequence AAACAGAAGCTAGAAGGATT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142038340_1142038353 24 Left 1142038340 16:87876557-87876579 CCGAATCCTTCTAGCTTCTGTTT No data
Right 1142038353 16:87876604-87876626 CGTTTCCTGAAGTTCGTATGGGG No data
1142038340_1142038356 30 Left 1142038340 16:87876557-87876579 CCGAATCCTTCTAGCTTCTGTTT No data
Right 1142038356 16:87876610-87876632 CTGAAGTTCGTATGGGGGAACGG No data
1142038340_1142038354 25 Left 1142038340 16:87876557-87876579 CCGAATCCTTCTAGCTTCTGTTT No data
Right 1142038354 16:87876605-87876627 GTTTCCTGAAGTTCGTATGGGGG No data
1142038340_1142038350 22 Left 1142038340 16:87876557-87876579 CCGAATCCTTCTAGCTTCTGTTT No data
Right 1142038350 16:87876602-87876624 CCCGTTTCCTGAAGTTCGTATGG No data
1142038340_1142038352 23 Left 1142038340 16:87876557-87876579 CCGAATCCTTCTAGCTTCTGTTT No data
Right 1142038352 16:87876603-87876625 CCGTTTCCTGAAGTTCGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142038340 Original CRISPR AAACAGAAGCTAGAAGGATT CGG (reversed) Intergenic
No off target data available for this crispr