ID: 1142038352

View in Genome Browser
Species Human (GRCh38)
Location 16:87876603-87876625
Sequence CCGTTTCCTGAAGTTCGTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142038340_1142038352 23 Left 1142038340 16:87876557-87876579 CCGAATCCTTCTAGCTTCTGTTT No data
Right 1142038352 16:87876603-87876625 CCGTTTCCTGAAGTTCGTATGGG No data
1142038339_1142038352 29 Left 1142038339 16:87876551-87876573 CCTTCACCGAATCCTTCTAGCTT No data
Right 1142038352 16:87876603-87876625 CCGTTTCCTGAAGTTCGTATGGG No data
1142038341_1142038352 17 Left 1142038341 16:87876563-87876585 CCTTCTAGCTTCTGTTTGAACAC No data
Right 1142038352 16:87876603-87876625 CCGTTTCCTGAAGTTCGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142038352 Original CRISPR CCGTTTCCTGAAGTTCGTAT GGG Intergenic
No off target data available for this crispr