ID: 1142038356

View in Genome Browser
Species Human (GRCh38)
Location 16:87876610-87876632
Sequence CTGAAGTTCGTATGGGGGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142038341_1142038356 24 Left 1142038341 16:87876563-87876585 CCTTCTAGCTTCTGTTTGAACAC No data
Right 1142038356 16:87876610-87876632 CTGAAGTTCGTATGGGGGAACGG No data
1142038346_1142038356 -10 Left 1142038346 16:87876597-87876619 CCCCACCCGTTTCCTGAAGTTCG No data
Right 1142038356 16:87876610-87876632 CTGAAGTTCGTATGGGGGAACGG No data
1142038344_1142038356 -8 Left 1142038344 16:87876595-87876617 CCCCCCACCCGTTTCCTGAAGTT No data
Right 1142038356 16:87876610-87876632 CTGAAGTTCGTATGGGGGAACGG No data
1142038345_1142038356 -9 Left 1142038345 16:87876596-87876618 CCCCCACCCGTTTCCTGAAGTTC No data
Right 1142038356 16:87876610-87876632 CTGAAGTTCGTATGGGGGAACGG No data
1142038340_1142038356 30 Left 1142038340 16:87876557-87876579 CCGAATCCTTCTAGCTTCTGTTT No data
Right 1142038356 16:87876610-87876632 CTGAAGTTCGTATGGGGGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142038356 Original CRISPR CTGAAGTTCGTATGGGGGAA CGG Intergenic
No off target data available for this crispr