ID: 1142038771

View in Genome Browser
Species Human (GRCh38)
Location 16:87879139-87879161
Sequence CTCCATCTTGGAAAATATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142038764_1142038771 28 Left 1142038764 16:87879088-87879110 CCAGGTCAAATTTCCCTGTGAGG No data
Right 1142038771 16:87879139-87879161 CTCCATCTTGGAAAATATCCAGG No data
1142038768_1142038771 14 Left 1142038768 16:87879102-87879124 CCTGTGAGGATGGAAGTTTGTAG No data
Right 1142038771 16:87879139-87879161 CTCCATCTTGGAAAATATCCAGG No data
1142038767_1142038771 15 Left 1142038767 16:87879101-87879123 CCCTGTGAGGATGGAAGTTTGTA No data
Right 1142038771 16:87879139-87879161 CTCCATCTTGGAAAATATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142038771 Original CRISPR CTCCATCTTGGAAAATATCC AGG Intergenic
No off target data available for this crispr