ID: 1142039836

View in Genome Browser
Species Human (GRCh38)
Location 16:87885888-87885910
Sequence GCTCACATTCTGATGGAAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 1, 2: 3, 3: 18, 4: 232}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142039836_1142039842 15 Left 1142039836 16:87885888-87885910 CCTCCTTCCATCAGAATGTGAGC 0: 1
1: 1
2: 3
3: 18
4: 232
Right 1142039842 16:87885926-87885948 CTTCAGACCTTAAACAGTCTAGG 0: 1
1: 2
2: 1
3: 5
4: 153
1142039836_1142039840 -10 Left 1142039836 16:87885888-87885910 CCTCCTTCCATCAGAATGTGAGC 0: 1
1: 1
2: 3
3: 18
4: 232
Right 1142039840 16:87885901-87885923 GAATGTGAGCTCCGAGGCAAAGG 0: 1
1: 2
2: 1
3: 11
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142039836 Original CRISPR GCTCACATTCTGATGGAAGG AGG (reversed) Exonic
903194888 1:21678159-21678181 GTTCACATTTTCATGAAAGGGGG + Intergenic
903975188 1:27145125-27145147 GCTTACATTCTTATGGAAATTGG + Intronic
904801798 1:33098163-33098185 GCTCACCTTCTGCAGGATGGGGG - Exonic
905017916 1:34790250-34790272 GCTCACAGTCTAATGGAGGAGGG + Intronic
906900091 1:49825800-49825822 GCTCACATGTTTATGAAAGGTGG - Intronic
908491003 1:64644050-64644072 GTTCACATTCTTGTGGAAAGTGG - Intronic
910507697 1:87968811-87968833 GCTCACATTCTCATGTAAACAGG + Intergenic
911319283 1:96393109-96393131 GGTCACATTCTGAGGGAGTGGGG - Intergenic
911331988 1:96535338-96535360 GCTCACAGTCAGATGGCAGAGGG + Intergenic
911470139 1:98308332-98308354 GAGCACATTCTGAGGGTAGGAGG - Intergenic
911818821 1:102389651-102389673 GCTCACATTATGATCTAAAGGGG - Intergenic
912281014 1:108313614-108313636 GGTCACATTCTGAGGGAATGAGG + Intergenic
912309846 1:108609304-108609326 GCTTACATGCTAATGGAAGCAGG + Intronic
912470459 1:109903165-109903187 GCTCACAGTCTCATGGGAGGAGG - Intergenic
913677654 1:121156946-121156968 GGTCACATTCTGAGGGACTGAGG - Intergenic
914029488 1:143944575-143944597 GGTCACATTCTGAGGGACTGAGG - Intronic
914159961 1:145123375-145123397 GGTCACATTCTGAGGGACTGAGG + Intergenic
915389463 1:155528476-155528498 GCTCACATGATTATGGAAGCTGG + Intronic
916192212 1:162190903-162190925 GGTCACATTCTGATGGTCTGAGG + Intronic
917617648 1:176762382-176762404 GTTCCCATTTTGATGGAGGGAGG + Intronic
918205611 1:182306393-182306415 TCTCATATTCTGCTGGTAGGTGG - Intergenic
920464960 1:206175456-206175478 GGTCACATTCTGAGGGACTGAGG - Intergenic
920560733 1:206936699-206936721 CCTCACATTCAGATGGAAAAAGG - Intronic
921157603 1:212450396-212450418 GCTGGCCTTCTGATGGATGGTGG + Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
923770174 1:236931345-236931367 GGTCACATTCTGAGGTATGGGGG + Intergenic
924106495 1:240654413-240654435 GCTCACATGCACATGGCAGGTGG - Intergenic
1062936296 10:1392890-1392912 GGTCACATTCTGAGGGACTGGGG - Intronic
1064468105 10:15605769-15605791 GCTCACATTCTGGTGGACTGTGG - Exonic
1066061011 10:31723599-31723621 CCTCACATTCTCATGCAGGGCGG + Intergenic
1068102438 10:52572666-52572688 GATCCCATTCTTATGGAAGCAGG - Intergenic
1069022466 10:63504265-63504287 GCTCACATTCTAATTGGAGGAGG + Intergenic
1069705692 10:70458070-70458092 GCTCACAGTCTAAGAGAAGGTGG - Intergenic
1071403392 10:85301695-85301717 GCTCACATGATTATGGAAGCTGG + Intergenic
1075231419 10:120682442-120682464 GCTCACATTCGAATGGAGGAAGG + Intergenic
1078666370 11:13329106-13329128 GCTCACATTCTAATCAGAGGAGG + Intronic
1081638511 11:44737044-44737066 GCTCACATGCTGAATGAATGAGG + Intronic
1082867723 11:57914862-57914884 CATCACATTCTGAGGGATGGTGG + Intergenic
1083162429 11:60863075-60863097 AGTCACATTCTGAGGGATGGGGG - Intergenic
1084938800 11:72601386-72601408 CCTCACATGCTGGGGGAAGGAGG - Intronic
1085374825 11:76050432-76050454 GCTCAGATTCTTATTGAAAGTGG - Intronic
1085714878 11:78863340-78863362 GCTCACAGTCTGGTGGAACTGGG + Intronic
1088621144 11:111685280-111685302 GTTCACATTCCTATGGCAGGGGG + Intronic
1089111938 11:116064039-116064061 GATCACATTCTGAAGGACTGGGG + Intergenic
1089896460 11:121935148-121935170 GGTCACATTCTGATGTATTGGGG - Intergenic
1091205818 11:133820322-133820344 TCACACACTCTGTTGGAAGGTGG + Intergenic
1092943027 12:13428092-13428114 GATCACATTCTGATGTACTGGGG - Intergenic
1093764556 12:22948078-22948100 TCTCACATTCTGAAGTAAGAGGG + Intergenic
1096628782 12:52912163-52912185 GGGCACATTTTGATGGAAAGAGG + Intronic
1096655608 12:53089575-53089597 GGTCACATTCTGAGGTAAGGGGG - Intergenic
1097590353 12:61566996-61567018 GCTCAGGTCATGATGGAAGGAGG + Intergenic
1098877539 12:75882018-75882040 GCTCATATTTTGATGGGAAGGGG + Intergenic
1099645208 12:85344321-85344343 GCTTACATTCCAATGGAAGAAGG + Intergenic
1100686413 12:96991373-96991395 GCTGACATCCTGAAGGGAGGGGG + Intergenic
1100906841 12:99310734-99310756 GCTCACATGATTATGGAAGCAGG - Intronic
1101239433 12:102823917-102823939 TCTCTCCTTCTGGTGGAAGGTGG - Intergenic
1102414396 12:112748003-112748025 ACTCACATTCTGATGGAGACAGG + Intronic
1102817368 12:115878130-115878152 GCTCACATTCTATTGGAGGAGGG + Intergenic
1103220000 12:119236097-119236119 GCTCACCTTCTAGTGGAAAGAGG + Intergenic
1104469650 12:129019227-129019249 ACTCACAGGCTGCTGGAAGGAGG - Intergenic
1106618394 13:31351694-31351716 GCTTACATTCTGATAGAAAGGGG - Intergenic
1109095444 13:58107997-58108019 GCAAAAATTCTGATGCAAGGGGG - Intergenic
1110126325 13:71947451-71947473 ACTTACATCCTGATGTAAGGGGG + Intergenic
1110589233 13:77235693-77235715 GCTCACATTCTAATGAGGGGAGG + Intronic
1112191850 13:97185908-97185930 GGTAGCATTCTGAAGGAAGGAGG - Intergenic
1116419517 14:44716535-44716557 GCTCATATTCTAGTGGCAGGGGG - Intergenic
1117362503 14:54990751-54990773 GCTTACATTCTGGTGGGTGGTGG + Intronic
1117664838 14:58045683-58045705 GGTCACATTCTGAGGGACTGAGG - Intronic
1117827566 14:59719471-59719493 GCTTACATTCTGGTGGAAGAGGG - Intronic
1117953438 14:61104656-61104678 GGTCACATTCTGAGGGACTGGGG + Intergenic
1119981970 14:79091760-79091782 TCACACATTCTGAAGTAAGGTGG + Intronic
1120023947 14:79560924-79560946 GTGCACAGTATGATGGAAGGGGG - Intronic
1120385035 14:83834123-83834145 GCTCACATTATTATGGAGGTTGG + Intergenic
1121285078 14:92728969-92728991 GCTGACATACTGGTGGAAGAAGG - Intronic
1122987190 14:105217930-105217952 GCCCACATTCTGGGGGGAGGAGG - Intronic
1124616916 15:31248705-31248727 GCTGAGCTTCTGGTGGAAGGAGG - Intergenic
1124840136 15:33233837-33233859 GCTCACATTCTAGTGGATAGAGG - Intergenic
1125075927 15:35618257-35618279 GTTCACTTTCTGATCTAAGGGGG + Intergenic
1126565118 15:50088682-50088704 GCTCACATTCTGGTCGGGGGCGG - Intronic
1129964197 15:79719377-79719399 GCTCACTCTCTGAGGGCAGGAGG - Intergenic
1130542808 15:84834007-84834029 GTTCATATTGGGATGGAAGGAGG + Intronic
1130928075 15:88399873-88399895 GCTCACATCCTTTTGGAACGTGG + Intergenic
1131422142 15:92316014-92316036 GCTAACATTCTAAAGGGAGGAGG - Intergenic
1132806936 16:1779236-1779258 GCTCACGTTCTGGTGGGAGGAGG - Intronic
1133738621 16:8634430-8634452 GATCAAATTCTGGTGGAGGGGGG - Intronic
1134276375 16:12780110-12780132 CCCCACACTCTGGTGGAAGGGGG + Intronic
1134665589 16:16016123-16016145 GATCACATTCTGAGAGCAGGTGG - Intronic
1135326787 16:21531138-21531160 GCTCACGTTCTGATGGAAGGAGG - Intergenic
1135876022 16:26200770-26200792 GCTTACATTCTAGTGGAAAGAGG - Intergenic
1136337042 16:29616552-29616574 GCTCACGTTCTGACGGAAGGAGG - Intergenic
1136776578 16:32874977-32874999 GCTCACAGTCTAGTGGAAGATGG - Intergenic
1136894037 16:33986536-33986558 GCTCACAGTCTAGTGGAAGATGG + Intergenic
1137041655 16:35618171-35618193 GATCACATTCTCATCAAAGGTGG - Intergenic
1137744573 16:50811221-50811243 GTTCTCATACTGATGGAAAGGGG + Intergenic
1137905794 16:52320654-52320676 GCTTACATTCTAATGGAGGGGGG - Intergenic
1139648315 16:68347994-68348016 GCTCACAGCCTGATGGGAGATGG + Intronic
1141596109 16:85097869-85097891 GGTCACATTCTGAAGTATGGGGG - Intergenic
1142039836 16:87885888-87885910 GCTCACATTCTGATGGAAGGAGG - Exonic
1203078993 16_KI270728v1_random:1137086-1137108 GCTCACAGTCTAGTGGAAGATGG - Intergenic
1142965644 17:3579433-3579455 GCTTACTTTCTGAAGGAAGGAGG + Intronic
1147207968 17:38852443-38852465 GCTCATATTGTGTTGGAGGGGGG - Intronic
1149531471 17:57398932-57398954 GCTTACATTCTAATAGAATGTGG - Intronic
1149642063 17:58209381-58209403 GCTGACATTCTGGGGGAAGCAGG + Intronic
1152892333 17:82889669-82889691 CCCCACATTCTCCTGGAAGGCGG - Exonic
1155289418 18:24325658-24325680 GCTCATATTCTGGTGGGAGGAGG - Intronic
1157283988 18:46364731-46364753 GCTCACATACTGATGGAGGGTGG + Intronic
1157304679 18:46508297-46508319 GGTCACATTCTGAGGGACTGTGG - Intronic
1157883073 18:51340697-51340719 GGTCACATTCTGAGGGACTGGGG + Intergenic
1157914741 18:51654375-51654397 GATCACATGCTGATGGAAAATGG + Intergenic
1158372218 18:56821143-56821165 GCTTACATTTTCATGGAGGGAGG + Intronic
1158467774 18:57706685-57706707 GGTCACATTCTGAGGGATGGAGG - Intronic
1158789448 18:60759576-60759598 GCTCACATTCTGATCCAACAAGG - Intergenic
1159880492 18:73854317-73854339 GGTCACATTCTGATGTATCGAGG - Intergenic
1161435383 19:4259751-4259773 GCTCAGATTCTAAAGGAGGGAGG - Intronic
1161788952 19:6347162-6347184 GGTCACATTCTGAGGGACGAGGG - Intergenic
1164931936 19:32182678-32182700 GATCACAATATGAGGGAAGGAGG + Intergenic
1166221422 19:41367269-41367291 GTTAACATTCTGATAGGAGGAGG + Intronic
925258536 2:2510020-2510042 GGTCAAATGCTGATAGAAGGAGG - Intergenic
925737144 2:6973446-6973468 GATTAAATGCTGATGGAAGGTGG + Intronic
925771752 2:7289031-7289053 GGTCACATCCTGATGGCGGGGGG + Intergenic
926468963 2:13228694-13228716 TTTGAAATTCTGATGGAAGGAGG + Intergenic
927275363 2:21257875-21257897 TCTCACATTCTTATGGAATAAGG - Intergenic
927590378 2:24351283-24351305 GCTCACAGTCTAATAGAAGCGGG - Intronic
928179349 2:29057014-29057036 GCTCTCCTTGTGATGGAGGGAGG + Exonic
928572736 2:32625388-32625410 GCTCACTCTCTGAAGGAAAGCGG - Intergenic
928613013 2:33009357-33009379 GCTCACATTCTGAGGTACTGGGG - Intronic
928990384 2:37226996-37227018 GCTCACATTCATATTGGAGGAGG - Intronic
929863775 2:45700702-45700724 GGTCACATTCTGAAGTACGGGGG - Intronic
933082956 2:78016349-78016371 GGTCACATTCTGAGGGACTGGGG + Intergenic
935768213 2:106390600-106390622 GCTCACATTCTAGTGGAATCAGG - Intergenic
938137971 2:128774828-128774850 GCTCACTTTGGGATGGAGGGAGG + Intergenic
939261039 2:139809380-139809402 GATCACATTCTGAGGAAAGAAGG + Intergenic
940592411 2:155747032-155747054 CCACACCTTCTGATGGAAAGTGG - Intergenic
941185875 2:162320783-162320805 GTTCACATTCTAATGGGAGTGGG + Intronic
941442460 2:165555259-165555281 GCTTTCATTCTGGTGGAAGTGGG - Intronic
941648962 2:168072548-168072570 GCTCACGTTCTTATGGGAGTAGG - Intronic
942488961 2:176470661-176470683 ACTCTCACTCTGATGGATGGAGG - Intergenic
942568945 2:177293980-177294002 GCTCACATTCTGACGTACTGAGG - Intronic
944316065 2:198286950-198286972 GCTCACATGATTATGGAAGCTGG - Intronic
947340292 2:229131098-229131120 GCTCACATTCTGAGGTACTGAGG + Intronic
948026736 2:234784362-234784384 GGTCACATTCTGGTGAGAGGTGG + Intergenic
948256338 2:236571163-236571185 GCTCATATTCTGATGAAAGAAGG - Intronic
948397962 2:237661473-237661495 GCTCACATCTGGAAGGAAGGAGG - Intronic
1171475945 20:25408899-25408921 GGACACATTCTGCTGGAAGATGG + Intronic
1172661197 20:36570276-36570298 GCTCCCTTTTTGATGGAAGTGGG - Intergenic
1172971113 20:38873604-38873626 GCTCACACGCTGTTGGCAGGAGG + Intronic
1176964941 21:15201961-15201983 GGTCACATTCTGAGGTATGGGGG + Intergenic
1179461522 21:41538581-41538603 GGTCACATTCTGAGGTACGGGGG - Intergenic
1181016059 22:20069611-20069633 GCTCCCATTCTGATGGAGACAGG - Intergenic
1181915296 22:26274947-26274969 GCTAACATTGTGATTGATGGTGG - Intronic
1182091149 22:27595746-27595768 GCCCACAGTCTGAGGGGAGGTGG - Intergenic
1182426078 22:30273500-30273522 GGTCACATTGGGATGGGAGGGGG + Intergenic
1184416707 22:44356055-44356077 AGTCACATTCTGAGGGATGGGGG - Intergenic
1184898721 22:47430214-47430236 GCTTAAATTCTTATGGAGGGAGG - Intergenic
949830457 3:8208773-8208795 GCTTACATTCCAATGGAAGAGGG - Intergenic
950420555 3:12896246-12896268 GCTCACAATCTCAGGGCAGGGGG + Intergenic
951284381 3:20791099-20791121 GCAGAGATTCTGATGCAAGGGGG + Intergenic
952812333 3:37415632-37415654 GCTTACATTCTGGTGGCAGGAGG - Intronic
953060793 3:39427365-39427387 GCTCACTTTCTGTAGGAGGGAGG + Intergenic
953075188 3:39563252-39563274 GTTGACATTCTGTGGGAAGGGGG - Intergenic
953410459 3:42687972-42687994 GCTCTCAGCCTGATGGTAGGAGG + Intronic
955639629 3:61068389-61068411 GCTGACTTGATGATGGAAGGAGG - Intronic
956865334 3:73363583-73363605 GGTCACATTCTGAGGCATGGGGG + Intergenic
961376545 3:126469820-126469842 GCTGAAACTCTGACGGAAGGAGG + Intronic
962234790 3:133698737-133698759 GGTCACATTCTGAGGTAATGTGG + Intergenic
962864521 3:139436579-139436601 GCTCACATTCTGAGGTACTGGGG - Intergenic
964679280 3:159319234-159319256 GCTCACATTCAGATGGTGAGTGG - Intronic
965159457 3:165113285-165113307 GCTCATGTGATGATGGAAGGTGG + Intergenic
966008032 3:175040565-175040587 GTTCACATTCAGATGGGAAGTGG - Intronic
969185481 4:5471228-5471250 GGTCACATTCTGAAGTAGGGGGG - Intronic
969231193 4:5832847-5832869 GGTCACATTCTGAGGTAATGGGG - Intronic
969567800 4:7990100-7990122 CCTCACTGTCTGATGGAAGAGGG - Intronic
969978828 4:11133048-11133070 GGTCACATTCTGAGGGACTGGGG + Intergenic
970124528 4:12793900-12793922 TCACACAATCTGATGGAGGGTGG - Intergenic
970395320 4:15659493-15659515 GCTCACATTCTCCTGGTAGAAGG - Intronic
972963287 4:44479827-44479849 TCACACATTCTGTTGGAGGGAGG - Intergenic
974338739 4:60586422-60586444 GCACTCTTTCTGATGGAATGGGG + Intergenic
975413072 4:74077627-74077649 GGTCACATTCTGATGTACTGGGG + Intergenic
977859071 4:101933752-101933774 TCTCACAGTCTAGTGGAAGGTGG + Intronic
978237235 4:106473918-106473940 GCCTACATTCTGGTGGAGGGAGG + Intergenic
979450932 4:120870440-120870462 GCTCACAGTCTAGTGGGAGGTGG + Intronic
979745194 4:124204752-124204774 GCTCATAATCTTAAGGAAGGGGG + Intergenic
981373114 4:143983390-143983412 GCTTACAATCTAATGGGAGGAGG + Intergenic
981382208 4:144086664-144086686 GCTTACAATCTAATGGGAGGAGG + Intergenic
981844557 4:149152752-149152774 GATCGCATTCTCATGGGAGGAGG - Intergenic
982830322 4:160051487-160051509 ACTCATATTCTAATGGCAGGAGG + Intergenic
982952452 4:161716726-161716748 TCTCACATTCTACTGGAGGGTGG - Intronic
984025103 4:174533920-174533942 GCTCACTTTCTAGTTGAAGGAGG + Intergenic
985785667 5:1892657-1892679 GGTCTCATTCTGATGAAATGGGG + Intergenic
987548681 5:19348944-19348966 GCTCACATTCTGAGGTACTGGGG - Intergenic
987933880 5:24438344-24438366 GCTCAAATCCTGATGGAAAATGG + Intergenic
989333026 5:40281863-40281885 ACTCACATTCTGAGGTAATGGGG + Intergenic
990144700 5:52745790-52745812 GCTCACATTCTGAGGTACTGGGG + Intergenic
990335455 5:54768011-54768033 GCACAGATTCTGAGGCAAGGAGG - Intergenic
991899793 5:71448444-71448466 GTTCCCATTCTGTTGGAAGTAGG - Intergenic
992711556 5:79463188-79463210 GCTCACAGTCATATGGAAGAGGG - Intronic
992877198 5:81068712-81068734 GTTCACACTCTGAGGGAGGGAGG - Intronic
996634087 5:125669456-125669478 GATCACGTTCTAATGTAAGGGGG - Intergenic
996749748 5:126876573-126876595 GCTTCCATTGTGATGGGAGGAGG - Intronic
997849445 5:137317728-137317750 CTTCACATTCTGGAGGAAGGAGG - Intronic
998109485 5:139490035-139490057 ACCCACATTTTGTTGGAAGGAGG + Intergenic
1002427664 5:179185673-179185695 CCTCACATTCTGCTTGGAGGTGG + Intronic
1002706302 5:181162677-181162699 AGTCACATTCTGAGGGAAAGAGG - Intergenic
1003982567 6:11403249-11403271 GCTTACATTCTGGAGGGAGGTGG + Intergenic
1004251785 6:14028863-14028885 GCCCCCTTTCTGATGGCAGGAGG - Intergenic
1006003210 6:30982866-30982888 GGACACAGTCTGATGGGAGGAGG - Intergenic
1006861413 6:37173920-37173942 GCTGACATTCTGCAGAAAGGAGG - Exonic
1011091529 6:83607262-83607284 ACTCACACTCTGGTGGTAGGAGG - Intronic
1011572054 6:88748229-88748251 GCTCATACTCTGAGGGAAGTAGG - Intronic
1011756184 6:90500542-90500564 GCTCACATTGGGAATGAAGGTGG + Intergenic
1013182679 6:107731563-107731585 GCTCCCAGTCTGGAGGAAGGTGG - Intronic
1013234421 6:108184539-108184561 GCTCAAAGTCTGATGGGTGGAGG + Intronic
1013279967 6:108626974-108626996 GCTGACATACTGATTGATGGTGG + Intronic
1015695096 6:135971064-135971086 GATCACATTCTGAGGTACGGGGG - Intronic
1015937399 6:138417107-138417129 GCTCCCATTTTAATGGGAGGAGG - Exonic
1020641708 7:10762656-10762678 GCTGACTTTATAATGGAAGGGGG - Intergenic
1022186774 7:27976944-27976966 GCTCACATTCTGGTAGAAGGAGG + Intronic
1026435088 7:70389481-70389503 TCTCTCATTCTGTTGGAAGGAGG + Intronic
1027567054 7:79808207-79808229 GCTTAAATTCTAATGGAGGGAGG - Intergenic
1028520831 7:91728929-91728951 GCTTAAATTCTGGGGGAAGGTGG - Intronic
1030474924 7:110019407-110019429 GCTGAGATACTGATGGAAGCTGG + Intergenic
1033030327 7:137820061-137820083 ACTCACCTTCTGGTGGAAGAAGG - Intronic
1033094103 7:138414624-138414646 GGTCACATTCTGATGTACTGGGG + Intergenic
1034491251 7:151394269-151394291 GCTCACATTCGCGTGGAGGGAGG - Intronic
1037563149 8:20092816-20092838 GCTTCCATTCACATGGAAGGTGG - Intergenic
1038409306 8:27345684-27345706 GCTGACTTTCTGATCAAAGGAGG + Intronic
1038425760 8:27462899-27462921 GCTCACACTCTGCGGTAAGGTGG + Intronic
1038439048 8:27558934-27558956 GCTCCCTCTCTGAGGGAAGGTGG - Intergenic
1039822391 8:41145588-41145610 GTTCAAATTCTGTTGGAAGCAGG - Intergenic
1040995225 8:53394265-53394287 GCTCTCATACTGAGGAAAGGAGG + Intergenic
1042018485 8:64343925-64343947 GCTCACATTCTATTGGGAGAAGG + Intergenic
1043848061 8:85183826-85183848 AATCACATTCTGATGTATGGAGG - Intronic
1043909575 8:85845999-85846021 GCTCACATGATTATGGAGGGGGG + Intergenic
1049717007 8:144097832-144097854 GCCCCCATTCTGATGGCAGCAGG + Intergenic
1052755052 9:32532495-32532517 GCTTAGAGTCTGATTGAAGGAGG + Intergenic
1052976177 9:34412017-34412039 GCTCAGATCATGCTGGAAGGTGG + Intronic
1056545466 9:87609283-87609305 GCTCACATTATTATGGAAGCTGG - Intronic
1056699737 9:88892315-88892337 GGCCACATTCTGAGGGAATGGGG - Intergenic
1057198255 9:93126994-93127016 GCTCAGACTCTGAGGGGAGGGGG - Intronic
1058959637 9:109980353-109980375 GCTCACATTCTTTTGCAAGGAGG + Intronic
1059075601 9:111190528-111190550 GAGCACATTCTGCTGGAATGAGG - Intergenic
1059497437 9:114721204-114721226 ACTTACATTCTAATGGGAGGAGG - Intergenic
1059641744 9:116223871-116223893 GAGCACATTTTGATGGAAGAAGG - Intronic
1185473952 X:402317-402339 GCTCACGTTCTGATTGGTGGGGG - Intergenic
1187009338 X:15264343-15264365 GGTCACATTCTGAGGCACGGGGG + Intronic
1187418007 X:19110179-19110201 GCTCACATTCTAGTGTGAGGAGG + Intronic
1187864775 X:23714164-23714186 GCTCAGATTCTGAGGAAAGCAGG - Intronic
1188830483 X:34890742-34890764 CCTCAAATTCTCATGGCAGGTGG + Intergenic
1189312497 X:40029695-40029717 GGTCACATTCTGATGTACTGGGG - Intergenic
1190430532 X:50374122-50374144 GGTCACATTCTGATGTACTGGGG - Intronic
1190858658 X:54322112-54322134 GCTCACATTCTGATTGGATGAGG - Intronic
1192153604 X:68726932-68726954 GCCCACCTTCTTTTGGAAGGAGG + Intergenic
1192283482 X:69708723-69708745 GCTCCCATTTTGATGGGAGCTGG + Intronic
1194399232 X:93422359-93422381 GCTGAGATTCTGTTGAAAGGTGG - Intergenic
1199643204 X:149882547-149882569 GCTCACTTTGTGATGAATGGGGG + Intronic