ID: 1142041351

View in Genome Browser
Species Human (GRCh38)
Location 16:87896467-87896489
Sequence GAGGATCACCACATGCATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 92}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142041351_1142041356 0 Left 1142041351 16:87896467-87896489 CCTTTATGCATGTGGTGATCCTC 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1142041356 16:87896490-87896512 AGGCAGCTAGAATGGGACACCGG No data
1142041351_1142041354 -7 Left 1142041351 16:87896467-87896489 CCTTTATGCATGTGGTGATCCTC 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1142041354 16:87896483-87896505 GATCCTCAGGCAGCTAGAATGGG 0: 1
1: 0
2: 2
3: 13
4: 121
1142041351_1142041353 -8 Left 1142041351 16:87896467-87896489 CCTTTATGCATGTGGTGATCCTC 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1142041353 16:87896482-87896504 TGATCCTCAGGCAGCTAGAATGG 0: 1
1: 0
2: 2
3: 14
4: 192
1142041351_1142041357 17 Left 1142041351 16:87896467-87896489 CCTTTATGCATGTGGTGATCCTC 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1142041357 16:87896507-87896529 CACCGGTGAGCACACCAATGAGG 0: 3
1: 0
2: 1
3: 4
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142041351 Original CRISPR GAGGATCACCACATGCATAA AGG (reversed) Intronic
903025105 1:20423062-20423084 GTGCATCAACATATGCATAATGG + Intergenic
904905932 1:33897172-33897194 GAGGAACACCACATGAAGTAGGG + Intronic
905431003 1:37923591-37923613 GAGGATACCAACATGAATAAGGG + Intronic
907018270 1:51039066-51039088 GAAGATCAACGTATGCATAATGG + Intergenic
924603664 1:245513751-245513773 GAGGAACAGCACCTGCATTAGGG + Intronic
1068517499 10:58042455-58042477 GAGGATTACCATATACAAAATGG - Intergenic
1072984998 10:100131451-100131473 GAGGATCACCTGAGGCATGATGG + Intergenic
1074297900 10:112208092-112208114 CAGGATAACCACATGCATCAGGG + Intronic
1079247223 11:18761518-18761540 GAGGGTGACCACATGAAAAAGGG + Intronic
1081240115 11:40695167-40695189 CCTGATCACCACAAGCATAATGG - Intronic
1081443486 11:43106510-43106532 GAGGATGGCCACATGAAAAAGGG + Intergenic
1082565150 11:54668015-54668037 GAGGATCACCACAGTGATATGGG - Intergenic
1082897352 11:58205928-58205950 GAGGAAAAACACATGCAGAAGGG + Intergenic
1086322053 11:85661008-85661030 GATGATTAGCACATGGATAAAGG - Intronic
1086807674 11:91265976-91265998 GAAGATCACCACCTGTGTAAAGG - Intergenic
1086966635 11:93034757-93034779 GAGGGTCACCTCATGGAAAAAGG + Intergenic
1088055753 11:105574538-105574560 GAGGAGAAACACATACATAAAGG + Intergenic
1098796326 12:74893005-74893027 GAGGCTCACCACTTGCAGCAGGG - Intergenic
1104029949 12:125057826-125057848 GTGGATTTCCACATGCATGAGGG + Intergenic
1105566828 13:21557747-21557769 GAAGTACATCACATGCATAAAGG + Intronic
1105872179 13:24515165-24515187 GTGTATCAGCATATGCATAAAGG + Intergenic
1110083065 13:71342347-71342369 GTGTATCAACAAATGCATAATGG + Intergenic
1111666901 13:91281102-91281124 AAGGATCTCCAAATGCATTATGG - Intergenic
1114498417 14:23150398-23150420 GAGGATCACCAGCAGCATGAAGG + Intronic
1115870800 14:37800640-37800662 GAGGATCTCCAGAAGCTTAAGGG + Intronic
1121682248 14:95803355-95803377 GCGCATCACCACATGTATGAGGG + Intergenic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1124883281 15:33661423-33661445 GAGGAACACCCCATGGATAGTGG + Intronic
1125365943 15:38916278-38916300 TACCTTCACCACATGCATAAAGG - Intergenic
1127490245 15:59455604-59455626 GATCCTCACCACATTCATAAAGG + Intronic
1134891564 16:17845894-17845916 ATAGATCACCACGTGCATAACGG + Intergenic
1135328315 16:21541928-21541950 GGGGCTCACCACACGCATAAAGG - Intergenic
1136338662 16:29627901-29627923 GGGGCTCACCACACGCATAAAGG - Intergenic
1136728490 16:32382774-32382796 GAGCACTACCATATGCATAATGG - Intergenic
1138094124 16:54199030-54199052 GAGGATCACCGCACACATCAGGG + Intergenic
1138741789 16:59319466-59319488 GAGGATCACCAAGTGAAGAAGGG + Intergenic
1139025361 16:62810287-62810309 GAAGTTCAACACATGCATGATGG - Intergenic
1141878640 16:86843229-86843251 GTGGATCACCACATACAGCAGGG + Intergenic
1142041351 16:87896467-87896489 GAGGATCACCACATGCATAAAGG - Intronic
1202997948 16_KI270728v1_random:134981-135003 GAGCACTACCATATGCATAATGG + Intergenic
1142932420 17:3298372-3298394 CACGATCATCAGATGCATAAAGG - Intergenic
1143962526 17:10732359-10732381 GTGGATTACCACATGCACTATGG + Intergenic
1153417385 18:4862473-4862495 AAGGATCACCAAAAGTATAAGGG - Intergenic
1157913368 18:51640006-51640028 GAGGAAGAACACATGCATGAAGG - Intergenic
1158118529 18:54023839-54023861 GAGGCCCACCAAATGCATGAAGG + Intergenic
1162846715 19:13398335-13398357 AAGAATCCCAACATGCATAAGGG - Intronic
925033544 2:670388-670410 GAAGATCTCCACCTGCACAAAGG + Intronic
927222441 2:20725871-20725893 GATGATGACCACAAGGATAAAGG + Intronic
929790348 2:45017867-45017889 CAGGCTCACCCCAGGCATAATGG - Intergenic
930988170 2:57614983-57615005 GAGGAAAACCACATGAGTAAAGG + Intergenic
936714952 2:115175457-115175479 GAGAATCACCACTTGCACATGGG + Intronic
937400333 2:121577268-121577290 GATGATTATCCCATGCATAAAGG - Intronic
940076174 2:149744346-149744368 GGTGATCATCACATGCATATAGG + Intergenic
941618740 2:167753440-167753462 GAGGATCACCAAATGGCTTAAGG - Intergenic
1173334246 20:42100098-42100120 GAGAATACCCACATGCAAAATGG + Intronic
1175551573 20:59821357-59821379 GAGGATCAACACCGGCATAAGGG - Intronic
1181329588 22:22079652-22079674 GAGGATCTCCTCATGCAAATGGG - Intergenic
1182391933 22:30005056-30005078 AATAATCACCACATGCACAAAGG - Intronic
1182720987 22:32399814-32399836 AAGGATGACCACATCCTTAAAGG + Intronic
1184910864 22:47533207-47533229 GAGAAATACCACATGCACAATGG - Intergenic
1185182394 22:49370988-49371010 GAAGCTCACCACATGCAATAAGG - Intergenic
952265273 3:31779318-31779340 GAGACTCACCTAATGCATAAGGG + Intronic
954145617 3:48632923-48632945 GAGGATGCCCACATCCATCATGG - Intronic
955505751 3:59631637-59631659 AATGATCACCACATTCCTAAAGG - Intergenic
957848581 3:85774254-85774276 GATGATTTCCACATGCATATCGG + Intronic
963047301 3:141112147-141112169 GGGGGTCACCACCTGCCTAAGGG - Intronic
967154656 3:186681410-186681432 GAGGATGAAGAAATGCATAAGGG - Intergenic
975444820 4:74450484-74450506 GAGGATCACAGCAGACATAAAGG - Exonic
984877199 4:184379958-184379980 GAGCATCAACCCATTCATAAGGG + Intergenic
992094315 5:73346951-73346973 GTATATCACCATATGCATAATGG + Intergenic
1004312750 6:14560115-14560137 GACTATCTCCACATGCAAAATGG - Intergenic
1007263245 6:40578279-40578301 TATGATCCCAACATGCATAAGGG + Intronic
1009530669 6:64809810-64809832 GGGGATCACTAGATGCAGAATGG + Intronic
1010251775 6:73714491-73714513 GTGGATCAGCACCTGCAGAAGGG - Intronic
1014891049 6:126846857-126846879 GAGCATCACCATATGCATTTTGG - Intergenic
1015649626 6:135441347-135441369 GAGTACCAACACAGGCATAACGG + Intronic
1015895297 6:138011122-138011144 GAGAATCAACACATGCTTTATGG - Intergenic
1016582135 6:145640401-145640423 GAGGAAAACCACAGGAATAATGG + Intronic
1018505903 6:164468318-164468340 CAGGATTACCACATGTAAAATGG + Intergenic
1019071306 6:169347483-169347505 GAGGATCACCAGATACAAAGAGG - Intergenic
1021112378 7:16709974-16709996 GAGAAACACCAAATGCATACGGG + Intergenic
1023987744 7:45107024-45107046 GAGGAGCACCCCAGGCACAAAGG + Intronic
1026793776 7:73352537-73352559 CAGGATCAGCACCTGCAGAATGG - Intronic
1030273154 7:107691646-107691668 AAGGAGCATCACATGCATATTGG - Intronic
1031390039 7:121202772-121202794 CAGGCTCACCACTTGCAAAATGG - Intronic
1032027810 7:128457267-128457289 GAGGTTCAACACATGCTTCATGG - Exonic
1034386110 7:150742564-150742586 GAGGATGACCACATGTCTCATGG - Exonic
1037075913 8:14718438-14718460 AAGGATCCCCACAAGAATAAAGG + Intronic
1053540165 9:38965349-38965371 GAGAATCACCCCATGCTGAAGGG - Intergenic
1053804514 9:41787506-41787528 GAGAATCACCCCATGCTGAAGGG - Intergenic
1054625975 9:67398575-67398597 GAGAATCACCCCATGCTGAAGGG + Intergenic
1057300384 9:93875445-93875467 GTGGACCAACATATGCATAATGG + Intergenic
1058228840 9:102400443-102400465 GAGGATCAGCATATAGATAAGGG + Intergenic
1058789510 9:108428515-108428537 AAGGATAACCAAATGCAAAATGG - Intergenic
1189715991 X:43866825-43866847 GAGGAACACCAGATCCAGAAGGG + Intronic
1199518201 X:148703177-148703199 GAGAATCACCACATTGTTAAAGG - Intronic
1201330933 Y:12820043-12820065 GAGGATCACCTCAACCGTAATGG + Intronic