ID: 1142041463

View in Genome Browser
Species Human (GRCh38)
Location 16:87897177-87897199
Sequence CACCAGGTCCAGGGGATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 3, 1: 0, 2: 3, 3: 31, 4: 239}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142041463_1142041471 -1 Left 1142041463 16:87897177-87897199 CCCTGGATCCCCTGGACCTGGTG 0: 3
1: 0
2: 3
3: 31
4: 239
Right 1142041471 16:87897199-87897221 GGGCTGTTTCCACCTCCACAAGG 0: 1
1: 2
2: 1
3: 14
4: 227
1142041463_1142041475 14 Left 1142041463 16:87897177-87897199 CCCTGGATCCCCTGGACCTGGTG 0: 3
1: 0
2: 3
3: 31
4: 239
Right 1142041475 16:87897214-87897236 CCACAAGGCAGCCAATTCCCCGG 0: 3
1: 0
2: 2
3: 23
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142041463 Original CRISPR CACCAGGTCCAGGGGATCCA GGG (reversed) Intronic
900338670 1:2177401-2177423 CACCAGCACCATGGGATCCAGGG + Intronic
900466794 1:2829742-2829764 CACCAGGCTCAGGGGAGACAAGG + Intergenic
900468060 1:2835413-2835435 CACAAGGCCCCGGGGATCCCGGG + Intergenic
905168806 1:36098411-36098433 CAGTTGGTCCAGGGGGTCCATGG + Exonic
905201767 1:36321050-36321072 GACCAGGTCCAGGTGATGCAGGG + Exonic
906155848 1:43613494-43613516 CACCAGTTCCAAGTGCTCCATGG + Intronic
907559679 1:55377060-55377082 CAGCAGGTGCAGAGGCTCCAAGG + Intergenic
908459152 1:64332501-64332523 CACAAATTCCAGGGGTTCCATGG + Intergenic
911192633 1:94963028-94963050 CAGCAAACCCAGGGGATCCAAGG + Intergenic
915302425 1:154959234-154959256 CACCAGGGCCAGGAAAGCCAGGG + Exonic
915905148 1:159872013-159872035 CACCAGGGCCAGGTGAGGCAAGG - Intronic
916512447 1:165484199-165484221 CACCAGGCCAGGGGTATCCATGG + Intergenic
918246151 1:182661276-182661298 CACCAGGCCCAGGGAATGCTGGG - Intronic
920560064 1:206932514-206932536 CACCAGGCCCAGGGGCACCAGGG + Exonic
920686955 1:208116845-208116867 CATCTGGGTCAGGGGATCCAGGG - Intronic
1063095848 10:2908187-2908209 TAACAGATCCACGGGATCCAGGG - Intergenic
1064014696 10:11763020-11763042 CACCAGGCCCAGGGGAGCAGTGG - Intronic
1066957422 10:42186234-42186256 CACCAGGTGCAGGTGCACCATGG - Intergenic
1067064096 10:43093967-43093989 CAGCAGGGCCACGGGCTCCAGGG + Intronic
1067068672 10:43117454-43117476 CACCTGGTCCAAGGGGTCCTGGG + Intronic
1069728898 10:70598674-70598696 CAGCACGTGCAGGGGTTCCAGGG + Exonic
1070829386 10:79409373-79409395 CACAAGGTACAGGGGGTCCCTGG - Intronic
1071343127 10:84666343-84666365 CACTAGGTCCAGAGGAACAAAGG - Intergenic
1071601248 10:86959683-86959705 CCCCAGGGCCAGGGGACACATGG + Intronic
1071951640 10:90709915-90709937 CACCAGGACCTGAGGAGCCATGG + Intergenic
1072861041 10:99006317-99006339 CACAAGGTCCAACAGATCCAGGG - Intronic
1075711097 10:124530851-124530873 CTTCAGGCCCAGGGAATCCAGGG - Intronic
1076132827 10:128025757-128025779 GACCTGCTCCAGGGGACCCAGGG + Intronic
1076387773 10:130070315-130070337 CACCAGGTCCGGGGGTGCGATGG - Intergenic
1076566469 10:131402956-131402978 GACCAGCTGCAGGGGAGCCATGG + Intergenic
1077014473 11:393620-393642 GACCAGGGCCAGGGCCTCCATGG + Intronic
1077302782 11:1854914-1854936 CTCCTGGCCCGGGGGATCCAGGG - Intronic
1077370137 11:2177917-2177939 CACCAGGACAAGAGGCTCCAGGG - Intergenic
1077370272 11:2178411-2178433 CACCAGGACAAGAGGCTCCAGGG + Intergenic
1077473899 11:2777485-2777507 CCCCGTGTCCAGGGGACCCAAGG - Intronic
1078642945 11:13113394-13113416 CACCAGGTCCCAGTGACCCATGG - Intergenic
1080450458 11:32374814-32374836 TCCCAGGTCCAGGTGAGCCAAGG - Intergenic
1081056471 11:38415730-38415752 CATCAGGTTTAGGGGATCCTTGG - Intergenic
1081740454 11:45435880-45435902 GACCAGGACCAGAAGATCCAAGG - Intergenic
1085153190 11:74268443-74268465 CCCCAGGTCCTGGGGCTGCAGGG + Intronic
1089642463 11:119856817-119856839 CCCCAGGCCCTGGGGCTCCACGG - Intergenic
1090803907 11:130190670-130190692 CACCAGGGCGTGGGGCTCCATGG - Exonic
1091784669 12:3235951-3235973 CAGCAGGTCCAGGGGAATCCTGG - Intronic
1091818686 12:3458377-3458399 CAGCAGGTCCATGGGCCCCAGGG + Intronic
1094502594 12:31034457-31034479 CAGCAGGCCCATGGGCTCCAGGG - Intergenic
1094840132 12:34339367-34339389 CACGGGGTCCAGGGGACCCTGGG + Intergenic
1094847930 12:34369549-34369571 CACAAGGCCCAGGGGACCCTGGG - Intergenic
1094849200 12:34374813-34374835 CACAAGGCCCAGGGGACCCTTGG - Intergenic
1095981556 12:47977355-47977377 CAGCGGGGCCAGGGGAGCCAGGG + Exonic
1095983700 12:47986407-47986429 CAGCGGGTCCAGGGGCTCCCTGG + Exonic
1095985605 12:47997608-47997630 CACCAAGACCAGGGGGACCAGGG + Exonic
1096627821 12:52906156-52906178 CACCTGGCCCAGGGGATCCTAGG - Intronic
1097342156 12:58451334-58451356 TTCCAGGTCCATGGGACCCATGG + Intergenic
1101044876 12:100794695-100794717 CCCCAGGTGCAGGGGAGGCATGG - Intronic
1102471906 12:113164032-113164054 CCCCAGGTCCAGGGTCCCCAGGG + Intronic
1103243193 12:119432186-119432208 CACCAGTCCCTGGGGCTCCAAGG - Intronic
1103910565 12:124349826-124349848 CACTCGGTCCAGGGGCACCAGGG + Intronic
1104078718 12:125411955-125411977 AAACAGGTCCAGGGGACCCAAGG - Intronic
1105665670 13:22553030-22553052 CGCCAGGTCCAGGGATTCCCTGG - Intergenic
1106226277 13:27789630-27789652 CGCCAGGCCCAGGGGCTCCCGGG + Intergenic
1106491603 13:30229254-30229276 CACCAAGACCAGGGGAGTCATGG - Intronic
1113248694 13:108427617-108427639 CAACTGCTGCAGGGGATCCAAGG + Intergenic
1113456177 13:110450432-110450454 CATCAGGTCCAGGTGGTCCAGGG - Exonic
1118741748 14:68744743-68744765 CACTAGGTTCTGGGGATACAGGG + Intergenic
1119287015 14:73463508-73463530 CAACAGCTCCTGGGGAACCAAGG - Intronic
1119521552 14:75289722-75289744 CACCAGGTTCAGGAGTTACATGG + Intergenic
1121451191 14:94009203-94009225 CACCAGGGCCATGGGATCGATGG + Intergenic
1121692413 14:95887258-95887280 CCCCAGGTACTGAGGATCCAGGG - Intergenic
1122801541 14:104232797-104232819 TGCCAGATCCATGGGATCCAGGG + Intergenic
1123665732 15:22608485-22608507 CCCCAGGCCCTGGGGCTCCAGGG + Intergenic
1123752028 15:23364167-23364189 CCCCAGGCCCTGGGGCTCCAGGG - Intronic
1124284394 15:28388092-28388114 CCCCAGGCCCTGGGGCTCCAGGG - Intronic
1124298303 15:28523522-28523544 CCCCAGGCCCTGGGGCTCCAGGG + Intronic
1124482958 15:30092532-30092554 CCCCAGGCCCTGGGGCTCCAGGG - Intronic
1124489410 15:30144603-30144625 CCCCAGGCCCTGGGGCTCCAGGG - Intronic
1124520619 15:30404686-30404708 CCCCAGGCCCTGGGGCTCCAGGG + Intronic
1124538038 15:30561533-30561555 CCCCAGGCCCTGGGGCTCCAGGG - Intronic
1124544498 15:30613594-30613616 CCCCAGGCCCTGGGGCTCCAGGG - Intronic
1124564461 15:30801029-30801051 CCCCAGGCCCTGGGGCTCCAGGG - Intergenic
1124754118 15:32393724-32393746 CCCCAGGCCCTGGGGCTCCAGGG + Intronic
1124760612 15:32446052-32446074 CCCCAGGCCCTGGGGCTCCAGGG + Intronic
1124778021 15:32603010-32603032 CCCCAGGCCCTGGGGCTCCAGGG - Intronic
1126446555 15:48752400-48752422 CAGCAGGTCCAGGGTCTCCTTGG + Exonic
1129659230 15:77543655-77543677 GACCAGGACCTGGGGCTCCAGGG + Intergenic
1129946207 15:79541264-79541286 CAGCAGGTCCACTGGATCCATGG + Intergenic
1131558338 15:93418375-93418397 CTCCCGGTCCAGGGCATCCCAGG - Intergenic
1131640508 15:94287768-94287790 ACCCAGCTCCAGGGGATCTATGG - Intronic
1132577362 16:670206-670228 CACCAGGGGCAGGGGAGCCAGGG - Intronic
1132664870 16:1076928-1076950 CAACAGGGCCAGTGGACCCATGG - Intergenic
1132906281 16:2284388-2284410 CACCAGGAACACGTGATCCAGGG + Exonic
1133975086 16:10594863-10594885 CCCCAGGTCCAGGTGTTCAAGGG + Intergenic
1135328433 16:21542639-21542661 CACCAGGTCCAGGGGATCCAGGG - Intergenic
1136338780 16:29628612-29628634 CACCAGGTCCAGGGGATCCAGGG - Intergenic
1137305893 16:47199661-47199683 CCCCCGGTCCATGGGGTCCATGG - Intronic
1138515408 16:57533253-57533275 CACCCGCTCCAGGGGACCCTGGG - Intronic
1138868226 16:60849579-60849601 CAGCAGGTCCAGTGGGTCCCTGG + Intergenic
1140116380 16:72045014-72045036 CACCAGGACCAGGGGCTACAGGG - Intronic
1141426669 16:83948900-83948922 AGGCAGGTCCAGGGGAACCAGGG + Intronic
1141763270 16:86043061-86043083 CAGCAGGTACAGGGCAGCCAGGG - Intergenic
1142041463 16:87897177-87897199 CACCAGGTCCAGGGGATCCAGGG - Intronic
1142144555 16:88487504-88487526 CAGCAGGTCCAAAGGCTCCAAGG + Intronic
1142397301 16:89839546-89839568 CACCAGGGCCAGGGCAGACAGGG - Intronic
1143136666 17:4716199-4716221 CCCCAAGTCCAGGGGGCCCAGGG + Intronic
1143515701 17:7418243-7418265 CACCACTTCCAGGGTCTCCAGGG - Exonic
1145910036 17:28537153-28537175 CACCAGTACCAGGGGGTCGAGGG - Exonic
1147334042 17:39716235-39716257 CCCCAGGTCCAAGTGAACCAGGG - Intronic
1148157864 17:45433502-45433524 CACCACCTCCTGGGGACCCAGGG + Intronic
1148193982 17:45700122-45700144 GACTAGGTCCAGGGCATCTAGGG - Intergenic
1148792933 17:50183721-50183743 CACCAAGTGCAGGGCATCCAGGG + Exonic
1148794209 17:50189412-50189434 CAGCAGGGCCAGGGGGACCAGGG + Exonic
1148795854 17:50196313-50196335 CAGCAGGGCCAGGGGCTCCAGGG + Exonic
1150789909 17:68195702-68195724 CACCACCTCCTGGGGGTCCAAGG - Intergenic
1152254080 17:79227344-79227366 CATCTGGTCCATGGGATCAAAGG - Intronic
1152264270 17:79284910-79284932 CACCAGGGCCAGAGGATGAAGGG - Intronic
1154205772 18:12335522-12335544 CACCAGTTACAGGGGATCTGTGG - Intronic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1158491724 18:57916264-57916286 GGCCAGGACCAGGGGTTCCAAGG + Intergenic
1160159356 18:76459648-76459670 CATCAGGTCCAGGGGAGGCTGGG - Intronic
1160238989 18:77109118-77109140 CACCAGGTCCAGGGTTCCCTGGG + Intronic
1161104050 19:2434559-2434581 CACAAGGCCCAGGTGATCCTGGG + Intronic
1161581239 19:5082210-5082232 CAGCGGCTCCAGGGGCTCCAGGG - Intronic
1161708275 19:5832547-5832569 GGCCGGGCCCAGGGGATCCATGG + Exonic
1163031030 19:14544308-14544330 CCCCAGGGCCAGGGGTTACAGGG - Intronic
1165613000 19:37173144-37173166 CACCAAGTGAAGGGGATCCTGGG + Intronic
1166281328 19:41796285-41796307 CACCAGGTTCAGGGACCCCAGGG + Intergenic
1166930197 19:46297514-46297536 CACCAGGTGCCTGGGATCCTAGG + Intronic
1167111723 19:47466383-47466405 CACCAAGGCCAGGGGAGCCATGG + Exonic
1167758212 19:51426534-51426556 CTCCAGGACCCGGGGATGCAAGG + Intergenic
1168116157 19:54222285-54222307 CACCAGCTCCAGGGGGTCGCTGG + Exonic
1168119140 19:54242033-54242055 CACCAGCTCCAGGGGGTCGCTGG + Exonic
1168121924 19:54256496-54256518 CACCAGCTCCAGGGGGTCACTGG + Exonic
1168129974 19:54311871-54311893 CACCAGCTCCAGGGGGTCGCTGG + Exonic
1168134010 19:54338403-54338425 CACCAGCTCCAGGGGGTCGCTGG + Exonic
1168171877 19:54594923-54594945 CACCAGCTCCAGGGGGTCACTGG - Exonic
1168181197 19:54664009-54664031 CACCAGCTCCAGGGGGTCACTGG - Exonic
1168185406 19:54697035-54697057 CACCAGCTCCAGGGGGTCACTGG - Intronic
1168201704 19:54819983-54820005 CACGATGTCCAGGGGATCACTGG - Exonic
1168341299 19:55624481-55624503 CACCAGGTCCAGTGGCTCCTGGG + Exonic
1168353176 19:55687855-55687877 CACCGGGTCCAGGGGCCCCCAGG - Intronic
925467842 2:4125618-4125640 CAGCAGCTCTAGGGGAACCAAGG - Intergenic
926239049 2:11070845-11070867 CCCCAGCTCTAGGGGTTCCAGGG - Intergenic
927141864 2:20136323-20136345 CACCATGTCCATGGAATGCAGGG - Intergenic
927670917 2:25068146-25068168 CACCCAGTCCAGGAGAACCAGGG - Intronic
928279731 2:29935162-29935184 CACCAGGTCTTGGGGAGCCTGGG - Intergenic
930509388 2:52325818-52325840 CACCAGGGCTAGGGAATCCTGGG + Intergenic
930837760 2:55812555-55812577 CAGCAGGGCCAGGTCATCCAGGG + Intergenic
932347908 2:71007550-71007572 CAGCAGGTCCAGAACATCCATGG + Intergenic
932371306 2:71190469-71190491 CATGAGGTCCAAGGGATCTAAGG + Intronic
933580967 2:84126366-84126388 GACTAGGTTCAGGGCATCCAGGG + Intergenic
935638545 2:105269455-105269477 CAGCAGGTCCACGGCAGCCACGG + Exonic
936528566 2:113259062-113259084 CACCAAGTCCAAGGGTTCCCTGG + Intronic
937065506 2:119013832-119013854 TGCCAGGTACTGGGGATCCAGGG + Intergenic
937241977 2:120467689-120467711 GAGCAGGCCCAGGAGATCCAAGG - Intergenic
937986351 2:127639886-127639908 CAGGGGGTCTAGGGGATCCAGGG - Intronic
938689767 2:133776881-133776903 CACCAGGCCCAGAGGACGCAGGG + Intergenic
940392983 2:153154166-153154188 CACCAGGTCCATGGGAATTATGG - Intergenic
947167013 2:227272999-227273021 CTGCAGGTCCTGGGGACCCAGGG - Exonic
947954016 2:234171839-234171861 CAGCAGGAGCAGGGGGTCCACGG + Intergenic
948200679 2:236127920-236127942 CACCTGGCCCAGGGGATGCTGGG + Exonic
948582271 2:238996531-238996553 CCCCAGGGACAGGGGAGCCAGGG - Intergenic
948885055 2:240878220-240878242 CACCAGGTGCAGGGGAGGCCGGG + Intronic
1170929138 20:20753058-20753080 CACCAGGTGCACAAGATCCATGG + Intergenic
1171040377 20:21757186-21757208 CACGGGAGCCAGGGGATCCAGGG - Intergenic
1171082781 20:22205025-22205047 CACCAGGGCACTGGGATCCAAGG - Intergenic
1171493510 20:25538486-25538508 CACCAGGTCCAGGGCATCAAAGG - Intronic
1172274189 20:33670856-33670878 CACCAGGTCCAGGGTCCCAAAGG + Intronic
1173870480 20:46338932-46338954 CACCAGGGCCAAGGGGTCCATGG + Intergenic
1174602993 20:51739725-51739747 CACCATGTCCAGAACATCCAGGG - Intronic
1175249970 20:57603345-57603367 CACCAGGGCCTGGGGACCCAGGG + Intergenic
1175276369 20:57773898-57773920 CCCCAGCTCCAGGAGCTCCAGGG - Intergenic
1176196155 20:63837059-63837081 CACCAGGCCTAGGGGAGGCACGG + Intergenic
1176231620 20:64036004-64036026 CACCTCTCCCAGGGGATCCAGGG - Intronic
1178486615 21:33023443-33023465 CACCAGGGCCAAGGGAGCCCAGG + Intergenic
1179225497 21:39449351-39449373 CACAAAGACCAGGAGATCCACGG - Intronic
1179454652 21:41490801-41490823 CCCCAGGTCCAGGAGCTCCCAGG + Intronic
1179572217 21:42284483-42284505 CCCCAGGTTCCGGGGGTCCAGGG - Intronic
1179996121 21:44975259-44975281 CACCAGCTCCAGGAGCTACAAGG - Intronic
1180226346 21:46394858-46394880 GAACAGGCACAGGGGATCCAGGG - Intronic
1182177219 22:28303021-28303043 CACCAGCTCCTGGGGACCCAGGG - Intronic
1184614924 22:45631516-45631538 CACCAGGCCCAGGGTGCCCAGGG + Intergenic
1184823336 22:46929853-46929875 CACCAGGTCCAGGGGACCGTTGG - Intronic
949536218 3:4998046-4998068 CAGCAGGGCCAGGGCAGCCAAGG - Intergenic
950469885 3:13177937-13177959 CCCCAGGCCTAGGGGATGCAGGG - Intergenic
950496642 3:13337909-13337931 CACGAGGTCCTGGGGAAACAGGG + Exonic
952637123 3:35545839-35545861 CACCAGGACTCGGGGATACAAGG - Intergenic
954136375 3:48583935-48583957 CACCTGGTCCAGGGGGACCCTGG + Exonic
956785451 3:72638493-72638515 CATCAGATCCAGGGGAGCCCAGG - Intergenic
956786537 3:72647518-72647540 CAGCAGGTGCAGGGGTCCCAAGG + Intergenic
959378441 3:105613233-105613255 AACCAGATCCAGGGCACCCAGGG - Intergenic
960998822 3:123358658-123358680 GACAAGGTCCAGGGGGTCCCAGG + Intronic
961338464 3:126200301-126200323 CCCCAGTTCCAGGGGATCAGTGG + Intergenic
961374094 3:126450916-126450938 CACCAGGCTCAGGGGGTCCCGGG + Intronic
961558844 3:127714984-127715006 CAGCAGCGCCAGGGGCTCCAGGG + Intronic
961663426 3:128482314-128482336 CCCCAGATCCAGGGGCTCGAGGG - Intronic
964743184 3:159988535-159988557 CACCAGGTGCAGGACACCCAGGG - Intergenic
964977363 3:162636991-162637013 CAGTAGGTCCAGTGGATCCCTGG - Intergenic
968041520 3:195593165-195593187 GACAAGGTCTATGGGATCCAGGG - Intergenic
968619823 4:1599062-1599084 CACCGAGGCCAGGGGATCCAGGG + Intergenic
968619844 4:1599128-1599150 CACCGAGGCCAGGGGATCCAGGG + Intergenic
968619866 4:1599194-1599216 CGCCGAGGCCAGGGGATCCAGGG + Intergenic
968619885 4:1599260-1599282 CACCGAGGCCAGGGGATCCAGGG + Intergenic
968664962 4:1816014-1816036 CACCAGGTCCAGGGTTTCCACGG + Intronic
969608827 4:8215994-8216016 GACCAGGTCCAGGGAGACCATGG - Intronic
976281948 4:83334627-83334649 CACCAGGTGCAGCGGCTCCTGGG + Exonic
979190030 4:117845389-117845411 CACAAGGTCCAGGTGATACTTGG + Intergenic
980881405 4:138713519-138713541 CACCAGCTCCAGGGTATGCATGG - Intergenic
981023441 4:140052439-140052461 CACGGGGTCTAGGTGATCCATGG - Intronic
981255901 4:142660242-142660264 CACCAGGACTTGGGGATGCAAGG + Intronic
981712940 4:147726653-147726675 CTCCAGGTCCAAGGGACTCAGGG + Intergenic
982358003 4:154490609-154490631 CACCAGATCTAGAGGCTCCAGGG + Intronic
985723676 5:1504346-1504368 CACCTGGTCCCGGGGCTCCAGGG + Intronic
985834268 5:2259144-2259166 CACCAGGTCAGGGTGATGCAGGG + Intergenic
988064618 5:26218605-26218627 CCCCAAGTCCAGTGGCTCCAGGG - Intergenic
990909376 5:60838366-60838388 GACCAGGTCCTGGGGAGGCAAGG - Intronic
995393536 5:111664096-111664118 CACCAGGACTCGGGGATGCAAGG - Intronic
997825057 5:137098841-137098863 CACCGGGTCCACAGGCTCCACGG + Intronic
1001775923 5:174329045-174329067 AAGGAGGTCCAGGGGATCCCTGG + Intergenic
1001937994 5:175719769-175719791 CACCAGATCCTGGGGAGGCAAGG - Intergenic
1002056043 5:176598341-176598363 CTTCAGGTCCAGGCGATCCCAGG - Exonic
1002100442 5:176855093-176855115 CTCCAGGTCCATGGGACCCCAGG + Intronic
1002301055 5:178257457-178257479 CACCAGGTAGATGGGAACCATGG + Intronic
1002701254 5:181126892-181126914 CACCAGGCCCAGGAGACCCCCGG - Intergenic
1002800112 6:514646-514668 CAGCTGCTCCAGGGGCTCCAGGG + Intronic
1005419689 6:25636033-25636055 CACCAGGATCAGGGGACCCATGG - Intergenic
1007344288 6:41216679-41216701 AATCAGGTCCAGGGCACCCAAGG - Intergenic
1008298563 6:49806316-49806338 CTCCAGGTGCAGGGGATACCCGG + Intergenic
1008858801 6:56124238-56124260 CAGCAGGTCCAGGGAGGCCAGGG + Exonic
1009472415 6:64043998-64044020 CCCCAGGTCCAGGAGTTGCAGGG - Intronic
1010669875 6:78674825-78674847 CACCAGGACTTGGGGATGCAAGG - Intergenic
1012256321 6:97036800-97036822 CTCCAGCTCCAGGGGATGCAAGG + Intronic
1012474257 6:99603574-99603596 CACCAGCACCAGGGTCTCCAAGG + Intergenic
1012804657 6:103878871-103878893 CACCAGGACTAGGGGATGCAAGG + Intergenic
1013181244 6:107718600-107718622 ACCCAGGGCCAGGGAATCCAGGG - Intronic
1017892772 6:158652922-158652944 AACCAGGTACAGGGCATCTAGGG + Intronic
1019181046 6:170187429-170187451 CAACAGGTCCAGGGGACACCCGG + Intergenic
1020555491 7:9664644-9664666 CACCAGGACTCGGGGATGCAAGG - Intergenic
1023987418 7:45104883-45104905 CTCCAGGTCCAGGGGTTCCCTGG - Intronic
1024613184 7:51084510-51084532 GTCCAGGTCCAGGGGAGTCAAGG - Intronic
1024622585 7:51174998-51175020 CCCCAGCTCCAGAGGATCCCGGG + Intronic
1029112156 7:98217933-98217955 CACCTGGTCCAGGGGCCCCACGG + Exonic
1029719965 7:102356790-102356812 CCCCAGTTTCAGGGAATCCATGG + Intergenic
1029752648 7:102552467-102552489 CCCCAGTTTCAGGGAATCCATGG - Intronic
1029770599 7:102651560-102651582 CCCCAGTTTCAGGGAATCCATGG - Intronic
1030810874 7:113970831-113970853 CATCAGGTGAAGGGGATGCAAGG + Intronic
1031522486 7:122783503-122783525 CACCAGGTCAAGGGTCTGCAAGG - Intronic
1033138540 7:138804473-138804495 CACCAGCTCCAGGTCACCCAAGG - Exonic
1033280371 7:140002243-140002265 GACCAGGTGCTGGGGGTCCAAGG - Intronic
1034462854 7:151207864-151207886 CACCAGCTCCAAGTGACCCAGGG - Exonic
1037880621 8:22571761-22571783 CCCCAGGTCCAGGGGATGGCTGG - Exonic
1040518188 8:48151504-48151526 CACCTGCTCCAGGCGATCCTGGG - Intergenic
1041933998 8:63316713-63316735 CACCAGGTCCAGTGGATGCAAGG + Intergenic
1046068432 8:109222728-109222750 CACCAGGACTTGGGGATGCAAGG + Intergenic
1047409135 8:124609940-124609962 CACCAGGGAGAGGGGATCCATGG - Intronic
1048227446 8:132602319-132602341 CACCAGCTCCTGAGGATCCTTGG - Intronic
1048236939 8:132700315-132700337 GACCAAGTCCAGGGGATTGAGGG - Intronic
1049497335 8:142942422-142942444 CAGCTGGTCGAGGGGAGCCATGG - Intergenic
1049571303 8:143371461-143371483 GCCCAGGGCCAGGGGATCCTGGG + Intronic
1049740979 8:144240758-144240780 CACCAGGGCCACGGGAGACAGGG - Intronic
1049773791 8:144395564-144395586 CACAGGGGTCAGGGGATCCAGGG + Intronic
1053390400 9:37731042-37731064 CAGGAGGTCCAGGGGGTCCTTGG - Exonic
1057152334 9:92807419-92807441 CACCAGGCTCAGGGGAGCCAAGG - Intergenic
1061225886 9:129280826-129280848 CACCAGGTCCAGCTGGGCCAGGG - Intergenic
1062196655 9:135278038-135278060 CACCACGTGCTGGGGACCCAAGG + Intergenic
1062654008 9:137592734-137592756 CCCGAGGGCCAGGGGAGCCAAGG + Intergenic
1203377248 Un_KI270442v1:385561-385583 CCCCAGTTCCAGAGGAGCCAGGG + Intergenic
1185467048 X:361411-361433 CACCAGGCCCATGTCATCCATGG + Exonic
1188554127 X:31392500-31392522 CACCAGGGTCAGGGGATCTGTGG - Intronic
1189153497 X:38730866-38730888 CACCAGGCCCTGCGGATCCTGGG - Intergenic
1190245689 X:48688874-48688896 CACCAGCTCCAGGGGGTGGAGGG - Exonic
1190372983 X:49760986-49761008 CACCAGGTCCAGGAGATCTTAGG - Intergenic
1193353131 X:80484629-80484651 CTCCAGGTCCAGGGTGGCCATGG + Intergenic
1197445854 X:126552045-126552067 GCCCAGGCACAGGGGATCCAGGG + Exonic
1199024889 X:142924851-142924873 CTCCAAGTCCTGGGGGTCCATGG - Intergenic
1199639213 X:149843394-149843416 CACCATGTCCACTGGATCCCAGG + Intergenic
1199725328 X:150574299-150574321 CACCAGCTCCCGGGGAGCAAGGG - Intronic
1200225329 X:154413771-154413793 CTCCAGGTCCACAGGATCCCTGG - Intronic