ID: 1142042049

View in Genome Browser
Species Human (GRCh38)
Location 16:87900451-87900473
Sequence AGGCTGGTCCAGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 2, 2: 1, 3: 23, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142042049_1142042053 -4 Left 1142042049 16:87900451-87900473 CCCAGCTCCATCTGGACCAGCCT 0: 1
1: 2
2: 1
3: 23
4: 261
Right 1142042053 16:87900470-87900492 GCCTCCACCATTGTTAACACAGG 0: 1
1: 0
2: 3
3: 14
4: 83
1142042049_1142042058 26 Left 1142042049 16:87900451-87900473 CCCAGCTCCATCTGGACCAGCCT 0: 1
1: 2
2: 1
3: 23
4: 261
Right 1142042058 16:87900500-87900522 CTCATCCGTCCGCACATGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142042049 Original CRISPR AGGCTGGTCCAGATGGAGCT GGG (reversed) Intronic
900521278 1:3106557-3106579 AGGCTGGACAAGGTGGGGCTTGG + Intronic
900658676 1:3772489-3772511 CGCCTGGTCCAGAAGGGGCTGGG - Intergenic
900800017 1:4731688-4731710 AGGCTGGTCCAGAAAGGCCTGGG + Intronic
901026795 1:6282558-6282580 AGGCTGGTCTCGGTGCAGCTAGG - Intronic
901745653 1:11371520-11371542 AGGCTGGGACAGATGTAGCTGGG + Intergenic
901963374 1:12845392-12845414 AGGCTGGTCAGGGTTGAGCTGGG + Intergenic
901990571 1:13109724-13109746 AGGCTGGTCAGGGTTGAGCTGGG + Intergenic
903834372 1:26193338-26193360 AGGTTAGGACAGATGGAGCTTGG + Intronic
904188779 1:28726976-28726998 AGGCTGGTCCAATTTTAGCTGGG - Intergenic
904672345 1:32175302-32175324 AGCCTGGCCCAGAGGCAGCTAGG - Exonic
904910682 1:33932001-33932023 AGGCTGGTGCAGAGGGACATGGG + Intronic
905395822 1:37665720-37665742 AGGCTGTTTTAGATGGAGGTAGG + Intergenic
907267108 1:53269148-53269170 AAGCTGGTACAGTTGGAGCAAGG - Intronic
907528483 1:55069578-55069600 GGGCTGATCTAGTTGGAGCTGGG + Intronic
908148326 1:61271681-61271703 AGCCTGGTCCTTTTGGAGCTAGG + Intronic
912867047 1:113266967-113266989 AGGCTGGTGCAGCTGAAGCGTGG - Intergenic
913314190 1:117536276-117536298 AGGCTGGAGCAGAATGAGCTAGG + Intergenic
913334480 1:117696460-117696482 AGGCTGTTCCAGATTGAGAGTGG - Intergenic
916246029 1:162689034-162689056 AGGCTGGTTGACATGGAGCTTGG + Intronic
916562973 1:165949157-165949179 ACCCTGGTGCAGATGGAGATCGG + Intergenic
916792499 1:168136674-168136696 AGGGCGGTCCGGATGGAGCCAGG - Intronic
919779274 1:201212101-201212123 AGGATGGTCCAGAGCGAGCCAGG + Exonic
920292594 1:204934272-204934294 GGGCTGGTCCAGGTAGAGGTGGG + Intronic
920347795 1:205317708-205317730 AGGCAGGTGCAGAGGGAGCTGGG + Intronic
922345845 1:224695759-224695781 AGTCTGGACCAGATGAAACTAGG + Intronic
922797097 1:228345599-228345621 AGCCTGGTCCAAAGGGAGCGGGG - Intronic
922989680 1:229895804-229895826 AGGCTGTTCCAGATTGTTCTAGG + Intergenic
1062960307 10:1568247-1568269 ATATTGGTCTAGATGGAGCTTGG + Intronic
1063505407 10:6593627-6593649 GGGCTGATGCAGCTGGAGCTGGG - Intergenic
1063595975 10:7435971-7435993 AGGGTGGACCAGATGGAGGGGGG + Intergenic
1063993570 10:11594294-11594316 AGTCTGATTCAGAGGGAGCTTGG + Intronic
1065168639 10:23006186-23006208 AGGCCGGTGCAGCTAGAGCTGGG + Intronic
1066139554 10:32489718-32489740 AGGCTGGTGCAGAGTGAGCATGG + Intronic
1066351717 10:34642387-34642409 AGGCAGGGCCAGATGGGGCTGGG - Intronic
1067058014 10:43063621-43063643 AGGCTGGTCCAGTGGTTGCTGGG - Intergenic
1068892792 10:62165137-62165159 ATCCTGGTGGAGATGGAGCTTGG - Intergenic
1069553693 10:69382692-69382714 ATGCGGGCCGAGATGGAGCTGGG + Exonic
1069723684 10:70564556-70564578 TGGCTCCTGCAGATGGAGCTGGG + Intronic
1070557530 10:77540036-77540058 GGGATGGTCCAGATGGAGGTAGG - Intronic
1070624499 10:78041047-78041069 AGGCTGGTCTTGATTGAACTCGG + Intronic
1070900266 10:80022487-80022509 AGTGTGGTCCAGATGCACCTCGG - Intergenic
1070902019 10:80038357-80038379 AGTGTGGTCCAGATGCACCTCGG - Intergenic
1072802793 10:98405038-98405060 AGGCTGGCCCAGGGGGAGATGGG + Intronic
1074455328 10:113590925-113590947 AGGCTGGTCCTGGGGGAGGTAGG - Intronic
1076290294 10:129340613-129340635 AGGGTGGTCCAAAGGGAACTGGG - Intergenic
1077012748 11:386096-386118 AGGGAGGCCAAGATGGAGCTGGG + Intergenic
1077902221 11:6498574-6498596 TAGCAGGTCCAGATGGAGGTGGG - Exonic
1079217858 11:18530515-18530537 AGGTTAATCCAGATGGAGTTAGG - Exonic
1079259559 11:18865055-18865077 AGTGTGTTCCACATGGAGCTAGG - Intergenic
1079658970 11:23017209-23017231 AAGCTGGTCCTGGTGGGGCTTGG + Intergenic
1080052462 11:27871139-27871161 AGGCTGGTGCAGCTGGAGCCGGG + Intergenic
1084498698 11:69521496-69521518 AGGCTGCTCCAGCTCTAGCTGGG - Intergenic
1084608546 11:70186534-70186556 AGACTGGGCCAGCTGGGGCTGGG - Intronic
1084779255 11:71397770-71397792 AGGGTGGCCCTGATGGGGCTGGG - Intergenic
1084784663 11:71435281-71435303 AGGCTCCTCGAGTTGGAGCTGGG + Exonic
1085449463 11:76623235-76623257 AGCCTGGGGCAGAGGGAGCTGGG - Intergenic
1085599884 11:77845935-77845957 AGGCAGGTCCATATGGGGATTGG - Intronic
1086593110 11:88539715-88539737 AAGTAGGTCCAGATGGAGGTAGG - Intronic
1088070280 11:105775143-105775165 AGGCATGTGAAGATGGAGCTGGG - Intronic
1089231578 11:116982144-116982166 AGACTGTCCCAGATGGAACTGGG - Intronic
1089926850 11:122267799-122267821 AGGCTAGACTGGATGGAGCTGGG - Intergenic
1090944480 11:131417734-131417756 GAGCTGGTCCAGATGGATTTTGG - Intronic
1094489805 12:30952673-30952695 AGGATGGTCCAGTTGGGGGTTGG + Intronic
1095219175 12:39588182-39588204 AGACTGTTCCAGATGTAGATAGG - Intronic
1096774136 12:53954098-53954120 AGGCAGGTCCATGTGGAGCTAGG + Intergenic
1096885948 12:54719519-54719541 TGGAGGGTCCAGATGGAGCCAGG - Intergenic
1097031857 12:56095502-56095524 AGACTGGTCCAGATTTAGGTTGG + Intronic
1097081392 12:56433793-56433815 AGGCTTGTCCTGGTGGTGCTGGG + Exonic
1097102522 12:56599726-56599748 AGGCTGTCCCAGAAGGAGATTGG - Exonic
1097277352 12:57822478-57822500 AGGCTGGAACAGACAGAGCTCGG + Exonic
1098300304 12:69047523-69047545 AGCCTGGTACAGAAGGAGCCAGG + Intergenic
1101082988 12:101208339-101208361 AGGCTGGTTCAACTGGTGCTGGG - Intronic
1101556680 12:105816659-105816681 AGGCTGGTCCCCCAGGAGCTTGG + Intergenic
1101727717 12:107402016-107402038 AAGCTGGTCTTGATGGAGATCGG + Intronic
1103930137 12:124445622-124445644 AGGCTGCTCCAGGGGAAGCTGGG + Intronic
1104842405 12:131831391-131831413 ATGCTGGGCCAGATGGTGCCAGG + Intronic
1105507415 13:21022496-21022518 AGATTGGTCCAGGTGGACCTTGG + Intronic
1106438984 13:29748715-29748737 AAACTGGTCAAAATGGAGCTGGG - Intergenic
1106451949 13:29890142-29890164 AGGATGGTAGAGCTGGAGCTTGG - Intergenic
1106667326 13:31865352-31865374 TAGCTGATCCAGGTGGAGCTTGG + Intergenic
1107569236 13:41638965-41638987 AGGCTGGTACAGCTGCAGATGGG + Intronic
1109391972 13:61705505-61705527 CTGATGGTGCAGATGGAGCTGGG - Intergenic
1113036195 13:106052471-106052493 AGGCTGGTGCACAGGGAGCAGGG - Intergenic
1114930883 14:27466216-27466238 AGGCTGGTCCAAAAGGTTCTTGG + Intergenic
1114930987 14:27466728-27466750 AGACTGGTCCTGATGGCACTAGG + Intergenic
1118740963 14:68738831-68738853 AGGGTGGTTGAGATGGAGCTTGG - Intergenic
1119383765 14:74244611-74244633 AAGCTGGTCTGGGTGGAGCTGGG + Intronic
1120675025 14:87411611-87411633 AGGCAGATCCTGATGGGGCTGGG + Intergenic
1121618632 14:95331155-95331177 CCGCTGGCCCAGATGGAGCCGGG + Intergenic
1122599701 14:102915148-102915170 AGGCCGCCCGAGATGGAGCTGGG - Intergenic
1123066155 14:105620414-105620436 AGGCTGGTCGAGCTGCACCTCGG - Intergenic
1123070299 14:105639467-105639489 AGGCTGGTCCAGCTGCACCTCGG - Intergenic
1123074889 14:105663126-105663148 AGGCTGGTCCAGCTGCACCTCGG - Intergenic
1123089536 14:105736251-105736273 AGGCTGGTCCAGCTGCACCTCGG - Intergenic
1123095324 14:105764411-105764433 AGGCTGGTCCAGCTGCACCTCGG - Intergenic
1123109393 14:105858625-105858647 AGGCTGGGCCAGGTTGAGCTGGG - Intergenic
1123145848 14:106129407-106129429 AGGCAGGTGCAGATGGAGGCTGG - Intergenic
1123166593 14:106330973-106330995 AGGCAGGTGCAGATGGAGGGAGG - Intergenic
1123169277 14:106356012-106356034 AGGCAGGTGCAGATGGAGGGAGG - Intergenic
1124239903 15:28020220-28020242 AGGCTGCTCGAGAAGGAGCTCGG + Intronic
1126878740 15:53071978-53072000 AGGCTGGACAAGATAAAGCTTGG - Intergenic
1128048236 15:64638955-64638977 AGCATGTTCAAGATGGAGCTTGG + Intronic
1129317136 15:74751833-74751855 AGGAAGATCCAGAAGGAGCTGGG + Exonic
1130684238 15:86023000-86023022 AGGCTGGAGCAGAGGGTGCTGGG + Intergenic
1132735439 16:1383752-1383774 ACGCGGGTCCTGATGGTGCTGGG + Intronic
1133319695 16:4905281-4905303 AGGCTTGTTCAGATGGAGCACGG - Intronic
1133738103 16:8630941-8630963 TGGCTTGTGAAGATGGAGCTGGG - Intronic
1133914109 16:10093297-10093319 AGGCTGCTCCTTTTGGAGCTAGG - Intronic
1134156525 16:11848447-11848469 AGGCTTGTCCTGATTAAGCTAGG - Intronic
1134849308 16:17468088-17468110 AGTCTGGTATAGCTGGAGCTTGG - Intronic
1135221095 16:20614595-20614617 AGGCTGGTCAAGATGCAGTCTGG + Intronic
1135329037 16:21545887-21545909 GGGCTGGTCCAGATGGAGCTGGG - Intergenic
1135755032 16:25090103-25090125 AGGGCGGCCCAGAAGGAGCTCGG + Intergenic
1136065487 16:27755488-27755510 AGCCTGCTCCACAGGGAGCTCGG + Intronic
1136339383 16:29631864-29631886 GGGCTGGTCCAGATGGAGCTGGG - Intergenic
1136411284 16:30078903-30078925 AGGCAGGTCCTGATAGGGCTGGG + Intronic
1136997997 16:35203845-35203867 AGGCTGGTCACGGTGCAGCTGGG - Intergenic
1137939924 16:52674090-52674112 ATGCTGGTCTCTATGGAGCTTGG - Intergenic
1138559912 16:57795249-57795271 TGGCTGGTCCAGATGTGGCCAGG + Intronic
1142042049 16:87900451-87900473 AGGCTGGTCCAGATGGAGCTGGG - Intronic
1142642676 17:1293737-1293759 ACGCTGTCCCAGACGGAGCTTGG + Intronic
1142715070 17:1742818-1742840 GGGCTGGGCCAGCTGGAGCCTGG + Exonic
1144575273 17:16425895-16425917 AGGCTGGGGCAGATGTGGCTGGG + Intronic
1146631117 17:34470041-34470063 AGTGTGGTCCAGAGGTAGCTGGG - Intergenic
1147678620 17:42224708-42224730 AGGTGGGTCCAGAGGGAGGTGGG + Intronic
1150101007 17:62423760-62423782 AGTCTGGTCCGGGTGGCGCTCGG - Intergenic
1151228529 17:72664880-72664902 TGGCTGGTGTAGCTGGAGCTAGG - Intronic
1151747167 17:76017894-76017916 GGTCTGAGCCAGATGGAGCTGGG + Exonic
1151980367 17:77504767-77504789 AGGCTGGGCCAGGCGGGGCTGGG + Intergenic
1152559089 17:81068921-81068943 AGCCTGGAGCAGCTGGAGCTCGG - Intronic
1152608627 17:81305063-81305085 AGGCTGGGACAGATGGTGCCTGG - Intergenic
1153227752 18:2910870-2910892 AGGCTGATTAAGCTGGAGCTTGG + Intronic
1157743504 18:50114643-50114665 ACGCTGCTCCAGACGGAACTTGG + Intronic
1159071473 18:63627428-63627450 AGGCTTGTCCTCATGGACCTGGG + Intergenic
1160449930 18:78955607-78955629 AGGCCGGTCTAGATGAGGCTGGG + Intergenic
1160554088 18:79714923-79714945 AGGCTGCCCCAGAGGGAGCCGGG + Exonic
1160702920 19:517310-517332 AGGCCGGTCCAGTTGGAGCTGGG + Intronic
1161109894 19:2463175-2463197 AGCCTGGTTCTGAGGGAGCTCGG + Intergenic
1161605381 19:5211999-5212021 AAGCTGGCCCAGGTGGAGCCTGG - Exonic
1162971243 19:14182670-14182692 AGGCTGGCTCAGATGGGTCTGGG + Intronic
1163828535 19:19536961-19536983 AGGCTGGGTCAGATGGAGGAGGG + Intronic
1164403744 19:27923196-27923218 AGGCACGCTCAGATGGAGCTAGG - Intergenic
1164923652 19:32108951-32108973 AGGAGGCTCCAGATGGGGCTGGG - Intergenic
1166130725 19:40744160-40744182 AGGCTGGCCCAGGAGGTGCTGGG - Exonic
1167794042 19:51697591-51697613 AGACTGGACCAGATGTAGGTGGG + Intergenic
1167947330 19:52998969-52998991 AATGTGGTCCAGATGCAGCTGGG + Intergenic
925242835 2:2347631-2347653 AGGTTTGTCCAGATAGACCTGGG - Intergenic
926151579 2:10428508-10428530 ACGCTGGTCAAGATGGCCCTTGG + Intergenic
927504657 2:23604988-23605010 AGGCAGGGCCAGGTGGAGTTGGG - Intronic
929086329 2:38171160-38171182 AGGGTGGTCTAAATGGAGGTAGG - Intergenic
929601256 2:43206189-43206211 AGGCTGGCTGAGAAGGAGCTAGG + Intergenic
932531073 2:72533210-72533232 AGACTAGTCCAGAATGAGCTTGG + Intronic
933997821 2:87682830-87682852 AGTCTGGTCCTCGTGGAGCTGGG - Intergenic
939656459 2:144831896-144831918 AAGCGGGTCTAGATGTAGCTGGG + Intergenic
941783935 2:169478236-169478258 AGGCAGGGCCACATTGAGCTAGG + Intergenic
942322366 2:174746860-174746882 AGGATGGCCTAGATGGAGCCAGG + Intergenic
943668149 2:190632262-190632284 AGGCAGGGCCAGATGCAGCAAGG - Intergenic
944893631 2:204142496-204142518 AGGCAGGGCCAGATGGAGAAGGG - Intergenic
946159861 2:217829530-217829552 AGGCTGGTGCAAATGGCGCTGGG + Intronic
947581380 2:231321305-231321327 GGGCTGGCCCGGATGGAGCGGGG + Intronic
947981584 2:234414973-234414995 ATGCTGGTTCAAATGGAGCAAGG - Intergenic
948257347 2:236577873-236577895 AGCTGGGTCCAGAGGGAGCTCGG - Intronic
948718427 2:239881132-239881154 AGGGCGGCCCAGATGGAGGTGGG - Intergenic
1171117990 20:22543491-22543513 ATGCTGGTTCAGATGAAGTTTGG + Intergenic
1172310202 20:33912257-33912279 AGGCTGGCCTAGTTGGAGTTGGG + Intergenic
1173146968 20:40533392-40533414 AGGCTGGGCCAGATGGTGAAGGG - Intergenic
1175044453 20:56091803-56091825 ACACTGGTCCTGATGGAGGTAGG - Intergenic
1175251214 20:57611135-57611157 AGGCTGGGCCAACTGGAGCAGGG - Intronic
1178445864 21:32641221-32641243 AGGCTAGTCCAGTAGGAGCTGGG - Intronic
1179974230 21:44854753-44854775 AGGCTGGGCGAGAAGGAGCAGGG + Intronic
1180900512 22:19368847-19368869 AGGGTGGAGCAGCTGGAGCTCGG - Intronic
1182352197 22:29705312-29705334 AGGTGGGTCCAGGAGGAGCTGGG - Intergenic
1182632248 22:31695652-31695674 AGGCTGCTGCAGACGGAGGTAGG - Intronic
1182963942 22:34504179-34504201 AGGCTGGTAGAGAGGGAGCAGGG + Intergenic
1183405996 22:37630973-37630995 AGGCTGGTGGCGCTGGAGCTGGG - Exonic
1183470914 22:38006260-38006282 ACGCTGGTCTAGATGGAATTTGG + Intronic
1183965934 22:41442583-41442605 AGGCTGGACCAGATGGCTGTGGG + Intronic
1184243722 22:43225155-43225177 TGGCTGGTGAAGATGGAGCTGGG - Intronic
1184565958 22:45292298-45292320 AGGCTGGCCCAGCTTGAGCCTGG + Intronic
1184664910 22:45983187-45983209 ACACTGGTCCACATGGAGCAGGG - Intergenic
1184832948 22:47001634-47001656 AGGCTGGTGCCTGTGGAGCTCGG - Intronic
1185215126 22:49594374-49594396 AGGCTGGCCCTGAGGGAGCTGGG - Intronic
1185331681 22:50254853-50254875 AGGCTGGCACAGAAGGAGCCGGG - Intronic
950439573 3:13001440-13001462 AGGTGGGGCCTGATGGAGCTTGG - Intronic
952400761 3:32961227-32961249 AGTCTGGTGCAAATGGAGTTTGG - Intergenic
952591647 3:34962478-34962500 AGGCTGCTCTAGAGGGAGATTGG + Intergenic
952902584 3:38119995-38120017 AGGCTGGACAGGATGAAGCTTGG - Intronic
952927323 3:38329531-38329553 AGGCTGGACAGGATGGAGCTTGG + Intergenic
953051429 3:39347816-39347838 AGGCTGCTTCAGAAAGAGCTAGG + Intergenic
953330821 3:42051627-42051649 AAGCTGGTCCATATGGAGAAAGG - Intronic
953418359 3:42735824-42735846 TTGCTGGTCCAGGTGGTGCTGGG + Exonic
953981957 3:47417727-47417749 AGGCTGGTCCAGAGGAGCCTGGG - Exonic
954453022 3:50581907-50581929 AGGCTGCTCCAGAAGGAACCTGG + Exonic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
955626154 3:60921794-60921816 AAGCTGCCCCAGATGGACCTTGG - Intronic
956908835 3:73795789-73795811 GGGCTGGTCAAAATGGAGTTAGG + Intergenic
957323449 3:78662060-78662082 AAGCAGGTCCAGAGAGAGCTGGG - Exonic
959116690 3:102186910-102186932 AGCCTGGTCTAGAGGGAGCAAGG + Intronic
960297070 3:115957409-115957431 AGGCTGGTCAGGATGAAGTTTGG - Intronic
963106035 3:141648037-141648059 ACACTGGTCCAGATGTTGCTGGG - Intergenic
965741638 3:171881431-171881453 AGGCTGGTGTAGCTGGAGCGTGG + Intronic
967414365 3:189200152-189200174 TGCCTGGCCCAGGTGGAGCTGGG + Intronic
968166530 3:196470379-196470401 AAACTGGTCCAGATGAGGCTGGG - Exonic
969441633 4:7220496-7220518 AAGCAGGGCCAGATGGAGCCAGG + Intronic
969619789 4:8273249-8273271 AGGCTGAGCCTGATGGAGCCGGG - Intronic
971840013 4:31838776-31838798 ATGATGGTCCAGGTGGAGCCAGG + Intergenic
974169898 4:58252510-58252532 AGGCAGTCCCAGATGGAGATGGG - Intergenic
975195340 4:71518070-71518092 AGGCTGGTACCCATGGAGCCAGG - Intronic
976074719 4:81284741-81284763 CGGCTGGAGCAGAGGGAGCTGGG - Intergenic
976186773 4:82449842-82449864 GGGCTGGGCCAGAGTGAGCTGGG - Intronic
976365776 4:84230700-84230722 AGGCTGGAGCTGATGCAGCTGGG + Intergenic
984933442 4:184868584-184868606 GGCCTGGACCAGCTGGAGCTGGG + Intergenic
985337389 4:188911432-188911454 ATGCAGGTGCAGATGGAGGTTGG - Intergenic
987395583 5:17420008-17420030 AGGCTGGCACTGATGGACCTAGG - Intergenic
990341881 5:54831541-54831563 TTGCTGGTCCATATGGAGATGGG - Intergenic
992127370 5:73655705-73655727 GGGCTGGTCCACAGGGAGCCAGG + Intronic
993953875 5:94208669-94208691 AGGATGGGAAAGATGGAGCTGGG + Intronic
996031665 5:118712004-118712026 AGGCTGGTGTGGAGGGAGCTAGG - Intergenic
996123977 5:119704792-119704814 AGGGTGGTCAGGATGCAGCTTGG - Intergenic
996535042 5:124569087-124569109 AGGCTAGTGCACATGGAGCCAGG - Intergenic
997368073 5:133338548-133338570 AGGCTGGTGCAGGGGAAGCTTGG + Intronic
997528506 5:134568424-134568446 TGGCTGGTTCAGGTGGAGCCTGG + Intronic
997793311 5:136782579-136782601 AGACTGGACCAGAGAGAGCTAGG - Intergenic
998136956 5:139678943-139678965 GGACTGGGCCAGATGGAGCAAGG - Intronic
999570018 5:152909295-152909317 AGGCTGGACCAGATGTTTCTCGG + Intergenic
1000022416 5:157329744-157329766 TGGCTGGTCCAAATTGAGATGGG - Intronic
1001106862 5:168861708-168861730 AGAATGGTCCACATGCAGCTTGG - Intronic
1001330820 5:170761170-170761192 TGCCTGGTACAGATGGAGCCTGG + Intergenic
1002415288 5:179117278-179117300 AGCCTGGGCCTGATGGTGCTGGG + Intronic
1003893964 6:10589547-10589569 AGCCTGCTCCAGATGGACCCCGG - Intronic
1004013725 6:11713158-11713180 AGTCTTTTCCAGTTGGAGCTGGG - Intronic
1005650400 6:27879952-27879974 AGGCTGGAACAGACAGAGCTCGG + Intergenic
1005857412 6:29873047-29873069 TGGATGGTCCAGATGGTGATAGG - Intergenic
1006444137 6:34069444-34069466 CGGCTGCTCCAGAGTGAGCTGGG + Intronic
1008436119 6:51478594-51478616 TGGCTGGACCAGATCCAGCTGGG - Intergenic
1011154098 6:84310304-84310326 AGGCAGGTCGAGAGGCAGCTGGG + Intergenic
1013425550 6:110009497-110009519 AGGCTGTTCCAAATGGCTCTTGG - Intergenic
1015306161 6:131710959-131710981 GGGCTGGTCCTGGAGGAGCTAGG - Exonic
1015699743 6:136022840-136022862 AATCTGATCCAGAAGGAGCTGGG - Intronic
1017959704 6:159210938-159210960 GGCCTGGTCCTGATGGAGGTGGG + Intronic
1019605525 7:1908166-1908188 AGGCTGCTGCAGCTGGAACTGGG + Intronic
1021976206 7:26013208-26013230 AGGCTGGTGCTGTTGGAGGTAGG - Intergenic
1022649080 7:32258563-32258585 TGGCTGGTACAGATTGTGCTGGG - Intronic
1024657838 7:51466957-51466979 AGCCTGGTGCACAGGGAGCTGGG - Intergenic
1025142897 7:56480075-56480097 GGGCTGGTCATGGTGGAGCTGGG - Intergenic
1031380794 7:121083624-121083646 AGGGAGGTACAGATGGAGCCAGG + Intronic
1032030157 7:128476623-128476645 AGTCTGGTCCGGGTGGCGCTCGG - Intergenic
1032415495 7:131732537-131732559 TGGCTGGAGCAGAGGGAGCTGGG - Intergenic
1032594943 7:133230110-133230132 AACCTGGACCAGATGGAGTTAGG - Intergenic
1034175837 7:149099124-149099146 TGGCTGTACCAGATGCAGCTAGG + Intergenic
1034354783 7:150443701-150443723 AGCCAGGTCTAGATGGAGCCTGG - Intergenic
1034799006 7:154040530-154040552 AGGCTGGTAAATATGGAGCGAGG + Intronic
1037259483 8:16991618-16991640 GGGGTGGTCCAGATAGAGGTGGG - Intergenic
1037693051 8:21199069-21199091 AGGTTGTTCCTGATGGGGCTGGG - Intergenic
1037709427 8:21343766-21343788 AGGCAGGTCCACACAGAGCTTGG - Intergenic
1037908324 8:22728369-22728391 AGGCTGGTTCCTATAGAGCTAGG + Intronic
1038092570 8:24270352-24270374 AGGGTGGCCCAGATGGCGCCTGG + Intergenic
1038927026 8:32151954-32151976 AGGCATGTCTAGATGGGGCTAGG - Intronic
1039174666 8:34790130-34790152 AGGGTGGTAGAGATGGAGGTAGG + Intergenic
1040105598 8:43539807-43539829 AGGCTGGGGCATGTGGAGCTAGG + Intergenic
1040119966 8:43672992-43673014 ATGAAGGTCCAGATGTAGCTGGG - Intergenic
1040439911 8:47430322-47430344 AGGCATGTCCAAATGGAGCATGG - Intronic
1041257584 8:55992478-55992500 AGGAGGCTCCATATGGAGCTGGG - Intronic
1041873579 8:62662191-62662213 AGTCTGGGCCTGATGGTGCTGGG - Intronic
1043855384 8:85259048-85259070 AGACAGGTCCAGTTTGAGCTTGG - Intronic
1047689739 8:127339633-127339655 AGGAATGTACAGATGGAGCTAGG + Intergenic
1047768051 8:128005406-128005428 AGACTGGGCCAGGTGGGGCTTGG + Intergenic
1048270877 8:133027045-133027067 AGGCTGTACCTGGTGGAGCTGGG + Intronic
1048816567 8:138339921-138339943 AGGCTGGACCGGATGGGGGTGGG - Intronic
1048870354 8:138792158-138792180 AGGATGGACCTGATGGAGCCTGG - Intronic
1049257409 8:141621282-141621304 AGGATCGTCCAGATGAAGCTGGG - Intergenic
1049312632 8:141941433-141941455 TGGCTGGTCCAGGGGGAGCCTGG + Intergenic
1053289672 9:36871695-36871717 AGGTTGGTGCAGTTGGATCTGGG + Intronic
1056926110 9:90835712-90835734 TGGCTGCTTCAGATGGAGCTTGG - Intronic
1057139419 9:92717648-92717670 ATGCTGGCCCTGATGGAGCTGGG + Intronic
1057736307 9:97664752-97664774 CAGCTAGTCCAGATGGAACTCGG + Intronic
1060109636 9:120897305-120897327 AGGCTGGCCCAGAGGCAGATGGG + Intergenic
1061670101 9:132183765-132183787 AGGCTGGTCCAGGTGGTCCAGGG - Intronic
1062021777 9:134322979-134323001 CGGCAGGTCCACATGGAACTGGG - Intronic
1062055670 9:134468639-134468661 AGGCTGCCCCAGGTGGAACTGGG - Intergenic
1062496454 9:136833683-136833705 AGGCTGCTGCAGCTGCAGCTGGG - Intronic
1062534655 9:137016157-137016179 AGGCCGGTCAGGATGGACCTGGG + Exonic
1187287335 X:17918013-17918035 AGACTGGTCCTCATGGAGCAAGG + Intergenic
1187711872 X:22062554-22062576 TGGCTGGTCCAAATGGAGAAGGG - Intronic
1189566215 X:42244026-42244048 ATTCTGGTCCTCATGGAGCTTGG + Intergenic
1197148318 X:123192610-123192632 AGGGAGGTCCAGATAGAGCATGG - Intronic
1200135154 X:153871209-153871231 CTCCTGGTCCAGATGGTGCTAGG + Intronic
1200226816 X:154422125-154422147 GGGGTTGCCCAGATGGAGCTGGG + Intergenic