ID: 1142045997

View in Genome Browser
Species Human (GRCh38)
Location 16:87925686-87925708
Sequence CCATGATTCTCGGAAGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142045997_1142046003 24 Left 1142045997 16:87925686-87925708 CCTGGAACTTCCGAGAATCATGG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1142046003 16:87925733-87925755 AGAAGCCCTTGGCCAAGCGCTGG No data
1142045997_1142046001 13 Left 1142045997 16:87925686-87925708 CCTGGAACTTCCGAGAATCATGG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1142046001 16:87925722-87925744 AGATGATCCGCAGAAGCCCTTGG 0: 1
1: 0
2: 0
3: 3
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142045997 Original CRISPR CCATGATTCTCGGAAGTTCC AGG (reversed) Intronic
900581270 1:3410873-3410895 CCAAGATTTTCAGAAGTCCCTGG - Intronic
903766595 1:25739047-25739069 CCCTGCTTCTCGGGAGTTCAAGG + Intronic
905486297 1:38299113-38299135 TGAGGATTCTCGGAAGTCCCAGG - Intergenic
907931529 1:59005542-59005564 CCAGGGTTCTGGGATGTTCCAGG - Intergenic
909114896 1:71520982-71521004 CCATGATTTTTGCAAGTTGCTGG + Intronic
911679829 1:100702582-100702604 GCATGAGTTTCAGAAGTTCCTGG + Intergenic
911837077 1:102634243-102634265 TAATGCTTCTCAGAAGTTCCTGG - Intergenic
1064464159 10:15562776-15562798 CCATGGTTCTGGGATGTCCCAGG - Intronic
1067801015 10:49359805-49359827 CCATGCTGCTCTTAAGTTCCCGG + Intergenic
1070480374 10:76876680-76876702 CCATGATTGTAGAAATTTCCTGG + Intronic
1071669779 10:87597620-87597642 ACATGATTCTTGGAAGGTCCTGG + Intergenic
1076361389 10:129891924-129891946 CCAGGAATCTCGGAATTTCCCGG - Intronic
1077577965 11:3398694-3398716 ACATAATTCTCAGAAATTCCAGG + Intergenic
1078452358 11:11449639-11449661 CCATTTTTCTGGGAAGTTCCTGG - Intronic
1084577438 11:69998497-69998519 CCATTCTTCTAGGAAGATCCTGG + Intergenic
1091071518 11:132568660-132568682 CCATTCTTCTCTGAGGTTCCAGG - Intronic
1100404538 12:94262179-94262201 CCATGATTTTCACAAGTCCCTGG + Intronic
1105687035 13:22793877-22793899 CCCTGATTCTCAGAGGTTCCTGG + Intergenic
1118503990 14:66390604-66390626 CCATGATTCATGGAAGCACCTGG - Intergenic
1119416584 14:74474422-74474444 CACTGAATCTCTGAAGTTCCTGG - Intergenic
1119548211 14:75488913-75488935 GGATGATTCTAGGAAGATCCTGG + Intergenic
1125828170 15:42693189-42693211 CCAGGATACTCGGAAGTACTGGG - Exonic
1129654018 15:77510785-77510807 CAGTGTTTCTGGGAAGTTCCTGG - Intergenic
1129918326 15:79294532-79294554 CCATGGCTCTCGGGAGTCCCTGG + Exonic
1131121392 15:89825180-89825202 CCATCATTCCAGGCAGTTCCGGG + Intergenic
1133816235 16:9199450-9199472 CCAAGATGCTGGGAACTTCCTGG + Intergenic
1139323837 16:66136201-66136223 CCAAGTTTCACAGAAGTTCCTGG - Intergenic
1142045997 16:87925686-87925708 CCATGATTCTCGGAAGTTCCAGG - Intronic
1143772077 17:9175274-9175296 CCAGGGCTCTCGGAAGTCCCTGG + Intronic
1144824664 17:18099040-18099062 CAATGATTCCAGGAAGGTCCAGG - Exonic
1148148698 17:45383347-45383369 GCATGATTCTAGGAGGTTCAAGG - Intergenic
1152267485 17:79304797-79304819 CTAAGATTCTCGGAAGGTGCTGG + Intronic
1152753404 17:82077082-82077104 CCAGGGGTCTCTGAAGTTCCTGG - Intergenic
1163729343 19:18940539-18940561 GCGGGAATCTCGGAAGTTCCAGG - Intronic
927086009 2:19674702-19674724 CCATGACACTCAAAAGTTCCCGG + Intergenic
947078510 2:226369829-226369851 CCATCATTCTTGGGAATTCCTGG + Intergenic
1170161306 20:13314264-13314286 TCATTATTCTCTGAACTTCCTGG - Intergenic
1170179311 20:13511575-13511597 CCATGAATACCTGAAGTTCCGGG + Intronic
1174730520 20:52912140-52912162 CTATGTTTCTAGGCAGTTCCAGG + Intergenic
1178422086 21:32451146-32451168 ACATAATTCTCGGAAAATCCAGG - Intronic
1179619210 21:42601585-42601607 CCATGATCCTAGGACTTTCCAGG + Intergenic
951267672 3:20588667-20588689 CAATGATGCACAGAAGTTCCTGG + Intergenic
952879680 3:37975758-37975780 ACATGATTCTCTGAAGAGCCGGG - Exonic
953038780 3:39236741-39236763 CCATGACTCTCTGAGGTTGCTGG + Intergenic
953415253 3:42712037-42712059 CCTGGATTCTCAGAAGCTCCTGG + Intronic
955504851 3:59621551-59621573 CCATTATTCTCTGAAATCCCGGG + Intergenic
956074325 3:65488752-65488774 CCCTGATCCTGGGAAGTTCGAGG - Intronic
957026771 3:75191478-75191500 CCATAGTTCTCGGGAGTTCAGGG + Intergenic
957283021 3:78178148-78178170 CAATGATTCTCAAAACTTCCTGG + Intergenic
960188504 3:114673872-114673894 ACATTATTCTATGAAGTTCCAGG + Intronic
964563797 3:158027016-158027038 CCATTACTTTCAGAAGTTCCTGG - Intergenic
973204752 4:47547775-47547797 CCAGGATCCTGGGAAGTTCGAGG - Intronic
974711898 4:65608218-65608240 CCATGATTTTAGAAAGTGCCTGG + Intronic
980877930 4:138680673-138680695 GCATAGTTCTGGGAAGTTCCTGG - Intergenic
992465361 5:76998940-76998962 CAATGATTCTGGGGAATTCCTGG - Intergenic
999360777 5:150984851-150984873 CCATAATGCTAGTAAGTTCCAGG - Intergenic
1001541176 5:172540808-172540830 GTTGGATTCTCGGAAGTTCCTGG + Intergenic
1004500783 6:16208142-16208164 CCATGAATCTAGGAAATACCAGG + Intergenic
1005733291 6:28719829-28719851 CCACGAGTCTCGGATTTTCCTGG + Intergenic
1020438538 7:8192270-8192292 CCTTTAATCTGGGAAGTTCCTGG + Intronic
1028683465 7:93565770-93565792 CCAAGATTCACAGAAGTTCATGG - Intronic
1031491930 7:122399994-122400016 CCATGGTTTTCAGAAGTTACAGG + Intronic
1042090114 8:65149848-65149870 CCAAGGGTCTCAGAAGTTCCTGG + Intergenic
1048921954 8:139239486-139239508 CCATCATTTTAGGAAGTACCAGG - Intergenic
1051149516 9:14065282-14065304 CCATGTTTCTAGGATTTTCCTGG - Intergenic
1056070043 9:82976879-82976901 ACATGATTCTGAGAGGTTCCTGG + Intergenic
1060310551 9:122456504-122456526 CCATGATTCTCCTAGCTTCCTGG - Intergenic
1060732731 9:126048476-126048498 CCAGGATTCTCAGAAGTGCCTGG + Intergenic
1061147777 9:128809720-128809742 CCATGCTTCTAGGAACTGCCTGG + Exonic
1185664035 X:1750142-1750164 CCATTATTATCTGAAGTTACAGG + Intergenic
1191096050 X:56673877-56673899 CCCTGATTCTTTGAACTTCCTGG - Intergenic
1192131553 X:68556795-68556817 ACATGATTCTCAGAAGATACAGG + Intergenic
1197349886 X:125370530-125370552 CCAAGTGTCTAGGAAGTTCCAGG + Intergenic