ID: 1142047083

View in Genome Browser
Species Human (GRCh38)
Location 16:87932453-87932475
Sequence GTGGCAATGAGCCCTTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142047083_1142047088 1 Left 1142047083 16:87932453-87932475 CCAACAAAAGGGCTCATTGCCAC 0: 1
1: 0
2: 0
3: 2
4: 84
Right 1142047088 16:87932477-87932499 TGCACGGAGGCGACGCCACCTGG 0: 2
1: 0
2: 1
3: 3
4: 45
1142047083_1142047089 13 Left 1142047083 16:87932453-87932475 CCAACAAAAGGGCTCATTGCCAC 0: 1
1: 0
2: 0
3: 2
4: 84
Right 1142047089 16:87932489-87932511 ACGCCACCTGGATGCTGAATAGG 0: 2
1: 0
2: 0
3: 3
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142047083 Original CRISPR GTGGCAATGAGCCCTTTTGT TGG (reversed) Intronic
900294139 1:1940204-1940226 GTGAGGATGAGCCCTTTTGGGGG + Intronic
906673395 1:47676449-47676471 GGAGGAAAGAGCCCTTTTGTGGG - Intergenic
908813066 1:68003874-68003896 GTGATGATGAGCACTTTTGTTGG + Intergenic
913658718 1:120987739-120987761 TTGGCAGTGAGCCCAGTTGTTGG + Intergenic
914010081 1:143770864-143770886 TTGGCAGTGAGCCCAGTTGTTGG + Intergenic
914648700 1:149679523-149679545 TTGGCAGTGAGCCCAGTTGTTGG + Intergenic
924132273 1:240923413-240923435 GTGGTACTGAGGCATTTTGTTGG + Intronic
924194387 1:241590447-241590469 GTGGCAAAGAGAGCTTTTGAAGG + Intronic
1070109343 10:73468024-73468046 ATGGCAATGAGCAATTTTCTAGG + Intronic
1070578899 10:77703974-77703996 GCGGCAATGAGGCCTTTGGTAGG + Intergenic
1070711690 10:78687542-78687564 GTGCTAATGAGCCCTAATGTGGG - Intergenic
1072168599 10:92838384-92838406 TTCCCAATGAGCCCTTGTGTTGG + Intronic
1077842298 11:5988185-5988207 TAGGCAATGAGTCCTTTTGAGGG - Intergenic
1084722413 11:70915689-70915711 GAGGCAGGCAGCCCTTTTGTGGG - Intronic
1086438564 11:86805513-86805535 GGGTCCCTGAGCCCTTTTGTAGG - Intronic
1087988013 11:104709060-104709082 CTGGCTATGGGCCTTTTTGTGGG - Intergenic
1098808946 12:75059293-75059315 GTAGCCATGAGGCCTTTTCTGGG + Intronic
1104212256 12:126700286-126700308 GTGGCACGGAGCCCTTGTCTTGG - Intergenic
1111474725 13:88729266-88729288 GTGGCAATAATCCCTGTTGCTGG - Intergenic
1115504100 14:34077923-34077945 GTGGCAAAGAGCCTGGTTGTAGG + Intronic
1116705931 14:48300035-48300057 GTGCCACTCATCCCTTTTGTTGG - Intergenic
1118345638 14:64938867-64938889 AAGACAATGAGCCCTTTGGTTGG - Intronic
1123875528 15:24620362-24620384 GTGATAATGTTCCCTTTTGTGGG + Intergenic
1124710601 15:32006861-32006883 GTAGCAATGAGCTCCTTGGTAGG - Intergenic
1127281247 15:57495377-57495399 GTGGCATTGAGCTGTCTTGTGGG + Intronic
1130556593 15:84927139-84927161 GTTTTAATGAGCCCTTTTCTAGG - Intronic
1132355789 15:101170266-101170288 CTGTGAATGAGCACTTTTGTAGG - Intergenic
1141186818 16:81793474-81793496 GTGGTGATGGGCCCTTTTGAGGG + Intronic
1142047083 16:87932453-87932475 GTGGCAATGAGCCCTTTTGTTGG - Intronic
1143308862 17:5971810-5971832 GAGGCAATGAGCCCTGATGGAGG - Intronic
1143349349 17:6276091-6276113 GCGCCAATCAGGCCTTTTGTTGG - Intergenic
1145846681 17:28044313-28044335 GTGGTAATGGGCGCTTTTCTCGG - Intronic
1146808044 17:35880934-35880956 GTTGGAATGAGTCCTCTTGTGGG + Intergenic
1156288625 18:35723995-35724017 TTGGCAATGTGGCCTTTTTTTGG + Intergenic
1157784968 18:50473578-50473600 TTGGAAATGAGGCCTTTCGTTGG + Intergenic
1161120849 19:2525397-2525419 GTGGCTATGAGCCTTTTGCTAGG - Intronic
1163378533 19:16949110-16949132 GTGTCAATGAGCCATTTTCCAGG + Intronic
925785895 2:7431232-7431254 GCGGCAAAGAGCCCTTCTTTGGG - Intergenic
933223117 2:79714117-79714139 TTGGAAATGAGCCCTGTTGGAGG - Intronic
935054365 2:99552751-99552773 TTGGCACTGAGCCCTCTGGTAGG + Intronic
942737554 2:179133069-179133091 GTGCCAGTGGGGCCTTTTGTGGG - Intronic
942775664 2:179579108-179579130 GTGACAATGACCTCTTATGTTGG + Intronic
943266124 2:185735407-185735429 GAGGCAATGAGCCCTATGGATGG + Intergenic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
947569635 2:231222310-231222332 GTGGAAATGAGTCCCTTTCTTGG + Intronic
1172096366 20:32462437-32462459 GTGGGCATGAGCCCTCCTGTGGG - Intronic
1173334820 20:42103987-42104009 GTGGCTATGTGCACATTTGTGGG - Intronic
949294561 3:2506297-2506319 CTGGTACTGAGCTCTTTTGTCGG - Intronic
953149059 3:40307992-40308014 GTGGAAATGAAGGCTTTTGTAGG - Intergenic
954427657 3:50451855-50451877 GTGGCAATGGTCCATTTTGCAGG + Intronic
955503412 3:59607255-59607277 GTGGTCATGAACTCTTTTGTGGG - Intergenic
961994141 3:131223265-131223287 ATGAAAATGAGTCCTTTTGTGGG + Intronic
966687835 3:182715411-182715433 GTGGCAGTGAGGGGTTTTGTAGG + Intergenic
969164028 4:5289578-5289600 CTTGCAGTGAGCCATTTTGTTGG - Intronic
969211838 4:5693698-5693720 ATGGCCAAGAGCCCTTTTTTGGG - Intronic
969436995 4:7194024-7194046 GTGGCCCTTGGCCCTTTTGTGGG - Intronic
969596181 4:8150482-8150504 GTGACACTGAGCACTTTTCTTGG + Intronic
973711443 4:53633757-53633779 GTGGCAATCAGCTCTCTTCTGGG - Intronic
974966530 4:68767918-68767940 GTGACAAAGAGAGCTTTTGTAGG - Intergenic
975713698 4:77185872-77185894 CTGGCATTGTGCCCTTTGGTTGG + Intronic
978425210 4:108574989-108575011 CTGACAGTGGGCCCTTTTGTGGG + Intergenic
990992835 5:61701892-61701914 GAGGCCAGCAGCCCTTTTGTTGG + Intronic
992673629 5:79083764-79083786 GTGGCAAAAAGCCCCTTTCTGGG - Exonic
992678328 5:79127891-79127913 GTGGCAAAAAGCCCCTTTCTGGG - Exonic
998857240 5:146405286-146405308 GTTGCAGTGAGCCTTTTTCTGGG - Intergenic
1001019808 5:168173351-168173373 GTGTCACTGAGTCCTTTTGGTGG - Intronic
1011996324 6:93593446-93593468 GTGGCAATGAGGCCTTTGCCAGG + Intergenic
1018177502 6:161189758-161189780 TTGGCATTCAGCCCTTTTTTGGG - Intronic
1020101679 7:5397428-5397450 GTGCCATTGAGCCCTGTGGTGGG - Intronic
1022198108 7:28089180-28089202 GTGGCGATGAGGCCTTTGGGAGG + Intronic
1023098052 7:36683276-36683298 GTAGCTATGAGCCCTTCTGGAGG + Intronic
1031159427 7:118148576-118148598 GTGGCAGTGAACCTTTATGTTGG - Intergenic
1032624122 7:133571206-133571228 GTTGCAATAAGCCCCTTTGATGG + Intronic
1035074791 7:156170162-156170184 GTGGGAATGTGTCCTTTTTTAGG - Intergenic
1037098241 8:15011673-15011695 TTGGCAATGATACCTTTTGTGGG - Intronic
1041024734 8:53672518-53672540 GTGGGAAAGAGCCCTTATGGTGG + Intergenic
1041772653 8:61488769-61488791 AGAGCAATAAGCCCTTTTGTAGG + Intronic
1042384994 8:68164079-68164101 GTGCCACTGACCCCTTTTTTGGG - Intronic
1048260174 8:132938537-132938559 GGTGCAATAAGCACTTTTGTAGG + Intronic
1048940111 8:139393127-139393149 GTGGCACTGAGCCATTTGTTAGG - Intergenic
1050084154 9:1947067-1947089 CTGGCTGTGAGCCCTTTTATGGG + Intergenic
1051919505 9:22248434-22248456 GTGGCTATCAGACCTTTTTTTGG + Intergenic
1055704340 9:78981218-78981240 GTGGCAAACAGCCCTTCTTTGGG + Intergenic
1186650218 X:11551471-11551493 GCTGCAATGAACACTTTTGTTGG + Intronic
1190156093 X:47993502-47993524 GTGGGAATGAGCCCTTAACTTGG + Intronic
1190699961 X:52980310-52980332 ATGGAAATGATCCCTTTGGTAGG - Intronic
1201867893 Y:18673933-18673955 GCAGCAATGAGCCCTCATGTTGG + Intergenic