ID: 1142047534

View in Genome Browser
Species Human (GRCh38)
Location 16:87935258-87935280
Sequence CCTGAGACCCAGAAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 745
Summary {0: 2, 1: 1, 2: 11, 3: 82, 4: 649}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142047529_1142047534 9 Left 1142047529 16:87935226-87935248 CCAAAGCAGGCTCTCATTCTACG 0: 1
1: 1
2: 0
3: 4
4: 61
Right 1142047534 16:87935258-87935280 CCTGAGACCCAGAAAGAGGAAGG 0: 2
1: 1
2: 11
3: 82
4: 649

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142047534 Original CRISPR CCTGAGACCCAGAAAGAGGA AGG Intronic
900478054 1:2885290-2885312 CCTGGGCCCAAGAAACAGGAGGG + Intergenic
900822056 1:4897361-4897383 CCAGAGACCGAGGAAGTGGATGG - Intergenic
901201825 1:7471581-7471603 TCTGAGACCCAGCGAGAGCAGGG + Intronic
901298701 1:8182256-8182278 CCGCAGCCCTAGAAAGAGGAGGG - Intergenic
901461157 1:9392644-9392666 CCTGGGACCCTGAGAGAGGGAGG + Intergenic
902163231 1:14549472-14549494 CCTGTGGCCCAGACACAGGATGG + Intergenic
902293030 1:15447393-15447415 ACTGAGGCCCAGAGAGAGGAAGG + Intronic
902438960 1:16416768-16416790 CCTGAGCCCCAGAAATAGGATGG + Intronic
902936377 1:19767761-19767783 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
902942552 1:19811188-19811210 CCTGAGACGTAGAGAGACGAAGG + Intergenic
903067858 1:20710826-20710848 ACTGACACCCAGAAAGGAGAAGG + Intronic
903140100 1:21334289-21334311 GCTGGGAGCCAGAGAGAGGAGGG - Intronic
903226652 1:21897515-21897537 CCTGAGAAACAAAGAGAGGAAGG - Intronic
903368794 1:22821483-22821505 CCTGAAGCCCAAAGAGAGGAAGG + Intronic
903382860 1:22909000-22909022 CCTGGGAGACAGAAAGAGGAGGG - Exonic
903465003 1:23545882-23545904 GCTGAGACCCAGAAATAAGAAGG - Intergenic
903648443 1:24908881-24908903 CCTGAGGCCCAGAGAGAAGAAGG - Intronic
903653222 1:24933457-24933479 TGTGAGGCCCAGAGAGAGGAGGG - Intronic
903658048 1:24960803-24960825 ACTGAGGCCCAGAGAGAGGAAGG + Intronic
903708909 1:25307228-25307250 CCTGAGGCCCAGAGAGGGGTGGG + Intronic
904118093 1:28176939-28176961 CATGAGAGTGAGAAAGAGGAGGG + Exonic
904398969 1:30243370-30243392 CCTGAGACTCAGAGAGGTGAGGG + Intergenic
904586963 1:31586005-31586027 ACTGAGACTCAGAAAGAGAAAGG + Intronic
904684719 1:32251706-32251728 CCTGAGGCCCAGAGAGAACAAGG + Intronic
904851541 1:33463245-33463267 ACTGAGGCCCAGACAGAAGAAGG - Intergenic
905250253 1:36643800-36643822 CCTGAGTCCCAGACATAGGAGGG + Intergenic
906390146 1:45408070-45408092 CTTGAGACCTAGAAAGAAGTGGG - Intronic
906616872 1:47239519-47239541 ACAGAGACCAAAAAAGAGGAAGG - Intergenic
906845175 1:49183990-49184012 ACTGAGGCCCAGAAAGGTGAAGG + Intronic
907164228 1:52396055-52396077 CCCAAGAGCCAGAAAGAGGCTGG - Exonic
907183744 1:52592837-52592859 GCTGAGACCCAAATAGGGGAAGG - Intergenic
907220603 1:52904698-52904720 GCTGTGGCCCAGAACGAGGAGGG - Exonic
907320794 1:53601007-53601029 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
907411347 1:54285896-54285918 ACTGAGTCCCAGAACGAGAAAGG - Intronic
907626384 1:56034453-56034475 TCTGAGAACCAGAAATAGGAAGG + Intergenic
907639602 1:56173681-56173703 TTAGAGACCCAGAAAAAGGAGGG - Intergenic
908267543 1:62394145-62394167 CCTGGGAAGCAGCAAGAGGAGGG - Intergenic
909232890 1:73114809-73114831 CATGAGACCCATAAAGATTAAGG - Intergenic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
911240660 1:95462360-95462382 GCTGAGACCCAGAAAGACCAAGG + Intergenic
911263799 1:95719370-95719392 ACTGAGACCCAGAAAGGTGATGG - Intergenic
911326758 1:96477542-96477564 CCTGAAACAAAGAAAGAAGAAGG - Intergenic
912553762 1:110501214-110501236 ACTGAGACCCAGAAAGTCCAAGG - Intergenic
912701508 1:111881716-111881738 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
913227198 1:116710619-116710641 CCCAAGACCCAGAAAGGGGAAGG + Intergenic
914505052 1:148281562-148281584 CGTGAGGCTCAGAAACAGGAGGG - Intergenic
914507512 1:148302586-148302608 CGTGAGGCTCAGAAACAGGAGGG + Intergenic
914756045 1:150562123-150562145 CCTGAGACCCAGGGAGGGGTGGG + Intergenic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915546187 1:156599455-156599477 CCTGAGCCAGAGACAGAGGAAGG + Intronic
915806916 1:158863743-158863765 ACTGAGACCCAGAAAATGGATGG - Intergenic
916059442 1:161088735-161088757 CCTGATGCCCAGAGAGTGGATGG - Intronic
916339976 1:163722381-163722403 CTTGAGACACTGTAAGAGGAAGG + Intergenic
916877278 1:168982895-168982917 TCTGAGACCCAGAAACAGATTGG + Intergenic
916964005 1:169916584-169916606 ACGGAGACCCAGGATGAGGAGGG - Intergenic
917478341 1:175387854-175387876 GCTAAGACCCGGAAAGAGGGAGG - Intronic
919762253 1:201105657-201105679 ACTGAGGCCCAGAGAGAGCAAGG - Intronic
919979062 1:202631069-202631091 ACTGACAGCCAGAGAGAGGAAGG + Intronic
920088489 1:203435348-203435370 TCTGAGACCCAGAAAGGCTAAGG + Intergenic
920114078 1:203607589-203607611 GCTGAGACCCAGAGAGCTGAAGG - Intergenic
920373744 1:205495334-205495356 CCTGAGACCAAGAGAGAAAATGG - Intergenic
920676379 1:208041243-208041265 CCTGAGACCTTGCTAGAGGAAGG + Intronic
921164751 1:212498773-212498795 GCTGAGGCCCAGCAAGAGGGAGG - Intergenic
921541657 1:216423562-216423584 CATGAGAGCAAGAAAGAGGAGGG - Intergenic
922003221 1:221502239-221502261 CCTGAGAACTAGAGAGATGATGG + Intergenic
922026418 1:221753832-221753854 ACTGAGGCTCAGAAAGAGTAAGG - Intergenic
922418803 1:225445761-225445783 CCTGAGGCCCAGAGAAGGGATGG - Intergenic
922912501 1:229229525-229229547 CCTCAGACCCAGAGAGACGCTGG + Intergenic
922944007 1:229494794-229494816 CCTGAGCAACAGAAAGAGGGTGG + Intronic
923753626 1:236770355-236770377 ACTGACATCCAGCAAGAGGAGGG - Intergenic
924175789 1:241389970-241389992 CCTGAGAACCAGAAAGCCAATGG + Intergenic
924578523 1:245302590-245302612 TCTGTGACACAGAAAAAGGAGGG - Intronic
1063886101 10:10580562-10580584 ACTGAGGCCCAGAAAAATGAAGG - Intergenic
1065293393 10:24253103-24253125 GCTGAGACCCAGAGGAAGGAAGG + Intronic
1065812612 10:29456131-29456153 CCTGAGGGTCAGAAAGAGGCAGG - Intergenic
1067089205 10:43258061-43258083 CCTGAGATCCTGAATGGGGAAGG - Intronic
1067191196 10:44069541-44069563 CCTGAGGCTCAGAAAGATTAAGG + Intergenic
1067279017 10:44857410-44857432 CCTGAGAACCCAAAAGAGGCAGG - Intergenic
1067279519 10:44860805-44860827 ACTGAGATTCAGAAAGAGAAAGG - Intergenic
1068520635 10:58073468-58073490 CCGGAGACTCAGAAGGAGGGAGG - Intergenic
1068799293 10:61121359-61121381 TGTGAGACAGAGAAAGAGGAAGG - Intergenic
1069651942 10:70055045-70055067 CCTGGGAACCAGACAGAAGATGG - Intronic
1069716177 10:70522890-70522912 ACTGAGGCCCAGAGAGGGGAAGG + Intronic
1069728430 10:70595997-70596019 ACTGAGACCTAGCAGGAGGAAGG - Intergenic
1069780197 10:70950544-70950566 CCTGAGACCCAGAGTTGGGAAGG - Intergenic
1069800974 10:71081239-71081261 ACTGAGGCCCAGAGAGGGGACGG + Intergenic
1069832386 10:71289236-71289258 ACTGAGTCACAGAGAGAGGAAGG + Intronic
1070765903 10:79056275-79056297 ACTGAGACCCAGGCAGGGGAAGG - Intergenic
1070774971 10:79104136-79104158 TCTGAGGCCCAGAGAGGGGAGGG - Intronic
1070778797 10:79125813-79125835 ACTGAGGCCCAGAGATAGGAGGG + Intronic
1072936319 10:99716968-99716990 CCTGATACCGTGGAAGAGGAAGG - Intronic
1073079966 10:100853503-100853525 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1073218203 10:101848474-101848496 CCTGAGAAACAAAAAGGGGAAGG + Intronic
1074078694 10:110151418-110151440 CCTCAGCTCCAGGAAGAGGAGGG - Intergenic
1074438946 10:113458319-113458341 AATGAAACCCAGAAAGAGAAAGG + Intergenic
1074585709 10:114766504-114766526 CCCGAGACCCTGGAATAGGAGGG + Intergenic
1074859280 10:117498004-117498026 GCTGAGGCCCAGAGAGGGGAAGG + Intergenic
1074869992 10:117568803-117568825 ACTGAGGCCAAGAAAGTGGAGGG + Intergenic
1075050289 10:119178516-119178538 CCGGGGACGCCGAAAGAGGAGGG + Intronic
1075173818 10:120141011-120141033 CCTGGGGTCCAGAAAGAGAAGGG - Intergenic
1075688201 10:124378391-124378413 CCTGAGTCCAAGAAGGAAGAAGG + Intergenic
1075953427 10:126501898-126501920 TCAGAGACTCAGAAAGGGGAGGG + Intronic
1076664947 10:132082027-132082049 CCTGGGACTCACAATGAGGAGGG - Intergenic
1077456739 11:2685937-2685959 CGTGTGACCCAGCAGGAGGATGG - Intronic
1077648376 11:3946884-3946906 CCTGAGACACAGAGAGGGAAAGG - Intronic
1077674022 11:4181777-4181799 CATTAGACCCATAAAGAGGCAGG - Intergenic
1077700522 11:4437247-4437269 CCTGAGACCCATAAAAATAATGG - Intergenic
1077841686 11:5982518-5982540 GCTGGGACCCAGAAAGAGGCTGG + Intergenic
1077901987 11:6497234-6497256 CGGGGGAGCCAGAAAGAGGAGGG - Intronic
1078088802 11:8251212-8251234 ACCAAGACCCAGAAAGGGGAAGG + Intronic
1078480086 11:11667945-11667967 CCTGGGACACAGATAGAGAATGG + Intergenic
1078871289 11:15347571-15347593 CCTGAGAATCAAAAAGAGAAAGG - Intergenic
1079245208 11:18747008-18747030 ACTGAGACCCAGGGAGAAGAAGG - Intronic
1079350380 11:19686774-19686796 ACTAAGACCCAGATAGAGAAGGG - Intronic
1080008000 11:27429876-27429898 CCTGAGAGACAGGAAGAGGGGGG + Intronic
1080609775 11:33893836-33893858 CCTAAGCCCCAGAAATAGAAAGG - Intergenic
1080870371 11:36231495-36231517 CCAGAGCACCAGAAAGAAGAAGG - Exonic
1081636059 11:44723049-44723071 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1081751150 11:45512084-45512106 GCTGAGGCCCAGAAAAAGGAAGG + Intergenic
1081967334 11:47177779-47177801 CCTGGGACCCAGGGAGGGGAGGG - Exonic
1083170784 11:60923000-60923022 TCAGAGACCCTGAAAGAGGAGGG + Exonic
1083487768 11:62994410-62994432 CCTGAGCCCCAGAGAGTGCAGGG + Intronic
1083634235 11:64111563-64111585 CCTGAGACTCAGAGACATGAGGG - Intronic
1083660594 11:64250292-64250314 CTTGAGGCCCAGAGAGGGGAAGG - Intergenic
1083886428 11:65575717-65575739 ACTGAGACCCAGAAAGGGGAAGG - Intergenic
1084195964 11:67523718-67523740 CCTGGGTCCCAGGAGGAGGAAGG + Intergenic
1084274610 11:68044946-68044968 CCTGGCACCCAGATGGAGGAGGG + Exonic
1084667523 11:70584473-70584495 CATGGGACCCGGATAGAGGAGGG - Intronic
1084954380 11:72683706-72683728 TCTGGGAACCAGGAAGAGGAGGG - Intergenic
1085205013 11:74726475-74726497 CCTGAGTACAAGAATGAGGATGG + Intronic
1085272779 11:75280205-75280227 CCTGAGACCAGGGAAGAGGAAGG - Intronic
1086069310 11:82782269-82782291 TCTGCCACCCAGAAAAAGGAGGG - Intergenic
1086167864 11:83800237-83800259 ACTGAGGCCCAGAGAGATGAAGG - Intronic
1086402063 11:86469185-86469207 ACTGAGACCCAGACAGAGAAAGG - Intronic
1087706395 11:101497527-101497549 GCTGACACTGAGAAAGAGGAAGG - Intronic
1088906758 11:114160964-114160986 CCTGGGACACAGGAAGGGGAAGG - Intronic
1088987835 11:114925699-114925721 CCTGGTACCCTGAGAGAGGAAGG + Intergenic
1089096493 11:115923958-115923980 ACTAAGACCCAGAGAGAGGAAGG + Intergenic
1089281884 11:117380536-117380558 CTTGAGAGCCAGCAGGAGGATGG + Intronic
1089418591 11:118314358-118314380 AGTGAGACCCAGATAGAGAATGG - Intronic
1089562718 11:119352956-119352978 ACGGAGGCCCAGAAAGAGGGAGG + Intergenic
1090069815 11:123534321-123534343 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090269615 11:125376962-125376984 ATAGAGGCCCAGAAAGAGGAGGG - Intronic
1090384138 11:126346823-126346845 CCTGAGACCCTGAAGCAGGTTGG - Intergenic
1090608347 11:128448465-128448487 CCTGAGACAAGGAAAGAGGTGGG + Intergenic
1091918882 12:4288753-4288775 GCAGAGACTCAGAAACAGGACGG - Intronic
1092104904 12:5914467-5914489 CCTGATACCGAGACAGAGTAGGG + Intronic
1092226519 12:6751883-6751905 CCTGAGACCCAAAGAAAGGTTGG - Intronic
1092253749 12:6915414-6915436 CCTGGGAGCCAAGAAGAGGATGG - Exonic
1093848505 12:24006502-24006524 CCCGAGACACAAAAAGAGAAAGG - Intergenic
1095215800 12:39545868-39545890 CCAAAGAAGCAGAAAGAGGAAGG + Intergenic
1095649732 12:44593235-44593257 ACTGAGATCCAGAAAGGAGATGG + Intronic
1095854428 12:46844552-46844574 CTTCTGGCCCAGAAAGAGGAAGG - Intergenic
1095929305 12:47609746-47609768 CCTGAAACCTGGAAGGAGGAAGG + Intergenic
1095949505 12:47773993-47774015 GCTGAGACCCACAGGGAGGACGG + Intronic
1096228385 12:49883676-49883698 CCTGAGACCCTGAGGGAGCAGGG + Intronic
1096474394 12:51899288-51899310 CCCGAGACTCAGGAAGAGGCTGG - Intergenic
1096515688 12:52153944-52153966 ACTGAGGTCCAGAGAGAGGAAGG - Intergenic
1098870898 12:75815833-75815855 ACTGAGGCCCAGAAAGGAGAAGG + Intergenic
1099355186 12:81625937-81625959 CCTAAGTCACAGAAAGAGAAAGG + Intronic
1099381076 12:81953497-81953519 CCTCAGACCCAGACTGATGAAGG + Intergenic
1099927443 12:89034883-89034905 CCTGAGACCCTGAAAAAATAAGG + Intergenic
1101439157 12:104690300-104690322 ACAGAGACCCAGAGACAGGAAGG - Intronic
1101640050 12:106581320-106581342 GCTGAGGCCCAGAACGATGAAGG + Intronic
1102079405 12:110085902-110085924 CCTGAGAGGGAGAAAGTGGAAGG + Intergenic
1102425281 12:112839044-112839066 CCTGAGACTCACAAGGAGAAAGG - Intronic
1102432031 12:112891097-112891119 ACTGAGACCCAGAGAGGGCAAGG + Intronic
1102514927 12:113440007-113440029 CCTGAGGCCTGGAAAGGGGACGG - Intergenic
1102688814 12:114744479-114744501 ACTGAGACCCAGGGAGGGGAGGG + Intergenic
1102795071 12:115682105-115682127 TCTGAGACCCAGAGGGATGAAGG - Intergenic
1103037002 12:117664690-117664712 ACTGAGACCCAGATAGAGGAAGG + Intronic
1103204815 12:119120385-119120407 ACTGAGGCCCAGGAAGATGAAGG - Intronic
1103463492 12:121123523-121123545 CCTGAGAGGGAGAAAGTGGAAGG - Intergenic
1103721549 12:122978169-122978191 CCTGAGGCCCAGAGAGGGGAAGG - Intronic
1103737773 12:123071257-123071279 CCCTGGACCCAGAAAGAGCAGGG - Intronic
1104365037 12:128168921-128168943 ACTGACTCCCAGAAAGAGGAGGG + Intergenic
1104727746 12:131088194-131088216 ACTGAGCCCCAGAGAGAGGGGGG + Intronic
1104894214 12:132153899-132153921 CCTGGGACACAGCAAGAGGACGG - Intergenic
1107552784 13:41492845-41492867 TCTGAGGCCCAGAGAGGGGAAGG - Intergenic
1108605344 13:52031812-52031834 TCTGAGACTCAGAAAGATAAAGG - Exonic
1112239406 13:97666350-97666372 CCTGAGACCCAGAAGCAGTGAGG + Intergenic
1112553237 13:100442811-100442833 GCTGAGACCTACGAAGAGGAGGG + Intronic
1112607988 13:100926866-100926888 CCTGAGAGCCAGACAGCTGATGG - Intergenic
1113435455 13:110287615-110287637 TGTGAGACCCAGAAAGAAGCCGG + Intronic
1113554065 13:111216894-111216916 TCTGAAAGGCAGAAAGAGGAAGG - Intronic
1113592795 13:111512733-111512755 CCTGGGTCCCAGGAGGAGGAGGG + Intergenic
1113983488 13:114295583-114295605 TCAGAGACGCAGGAAGAGGAGGG - Intronic
1114194540 14:20465646-20465668 ACTGAGGCCCAGGAAGAGCAAGG - Intergenic
1114535502 14:23419724-23419746 TCTGAGAACCAGGCAGAGGAAGG + Intronic
1116428038 14:44813689-44813711 CCTGAGAGGAAGAAAGAGGAGGG + Intergenic
1116684610 14:48021784-48021806 CCTAAGACAAAGAAAGAGCAGGG + Intergenic
1117410845 14:55449608-55449630 ACTGAGACACAGAGAGAAGAAGG + Intronic
1118433557 14:65747739-65747761 TTAGAGACTCAGAAAGAGGAGGG + Intergenic
1118623307 14:67633906-67633928 ACAGAGACCCAGGAAGAGAAGGG - Intronic
1118839350 14:69499560-69499582 CCTGAGTCCCAGAAGGAGACTGG + Intronic
1119258606 14:73222106-73222128 ACTGAGAACCAAAAACAGGAAGG - Exonic
1119507969 14:75189311-75189333 CCCCAGACCCTGAAGGAGGATGG - Intergenic
1119741485 14:77016524-77016546 CCTGTGACCCCCAAAGAGGCAGG + Intergenic
1120329609 14:83074523-83074545 CCAGAGAGCAAGAAAGAGGGGGG + Intergenic
1120980902 14:90288133-90288155 CCTGAGACCCAGCAAGGTCAGGG + Intronic
1121822132 14:96979512-96979534 ACTGAGAACCAGAGAGACGAAGG + Intergenic
1121942347 14:98083104-98083126 CCTGAGAACCAGAGAGTTGATGG - Intergenic
1122156639 14:99754062-99754084 ACTGAGTCCCAGAGAGGGGAAGG - Intronic
1122409162 14:101517311-101517333 GCTGAGACCCAGCAAGGTGAAGG - Intergenic
1124494658 15:30178948-30178970 ACTGACAGCCAGAGAGAGGAAGG + Intergenic
1124748912 15:32359697-32359719 ACTGACAGCCAGAGAGAGGAAGG - Intergenic
1127916082 15:63456478-63456500 CCTGAGGCCCAGAAAGAGGAAGG - Intergenic
1127982324 15:64044519-64044541 GCTGAGATCCAGAAAGGGGAAGG + Intronic
1128157185 15:65399008-65399030 CCTGACACCTAGGAAGAGAAGGG - Intronic
1128161677 15:65426797-65426819 ACTGAGGCCCAGAGAGAGGATGG - Intergenic
1128224015 15:65989246-65989268 CCTGAGACCCAGCAAGCAGGAGG + Intronic
1128264474 15:66254459-66254481 ACTGAGACCCAAAGAGAAGAGGG + Intergenic
1128686681 15:69691525-69691547 CATGTGAACCAGAGAGAGGATGG + Intergenic
1128710649 15:69869017-69869039 ACTGAGACCTAAGAAGAGGAAGG - Intergenic
1129155510 15:73714846-73714868 GCTGAGACCCAGTAAGAAGCTGG + Intergenic
1129229502 15:74188983-74189005 ATCGAGACCCAGAGAGAGGAAGG + Intronic
1129523549 15:76200401-76200423 ACTGAGGCCCAGAGAGGGGATGG + Intronic
1129659068 15:77543065-77543087 ACTGAGGCCCAGAGAGAGGCAGG - Intergenic
1129669265 15:77598116-77598138 CCTGAGGCTCAGAAAGGTGAAGG + Intergenic
1129851309 15:78795484-78795506 CCTGAGGCTCAAAGAGAGGAAGG - Intronic
1130068654 15:80628173-80628195 CCTGAGAGCCAGAGAGCTGATGG - Intergenic
1130106295 15:80931139-80931161 CCTGAGACCCAGAAGGAGGTGGG - Intronic
1130222194 15:82029002-82029024 CCTGAAACCTAGAGAGAGGTTGG - Intergenic
1130306265 15:82713995-82714017 GTTGAGGCCCAGAGAGAGGAAGG - Intergenic
1130358793 15:83160771-83160793 CCTGAGACCCAGGCAGAAAATGG - Intronic
1130557749 15:84934882-84934904 CCTGAGACCCAGAGAGAAAAAGG - Intronic
1130995802 15:88903328-88903350 ACTGAGAGCCAGAGAGAGGAAGG - Intronic
1131266017 15:90915891-90915913 CATGAGGTCCAGAAAGGGGAAGG - Intronic
1131586426 15:93699716-93699738 CCTGAGACTGAGAGACAGGATGG + Intergenic
1131620077 15:94058909-94058931 TTTGAGACCCAGAGTGAGGAAGG - Intergenic
1131843962 15:96469164-96469186 CCTGAGATTCAGAAAGAGGGTGG + Intergenic
1132330338 15:101008298-101008320 CCTGAGATACAGACAGACGATGG - Intronic
1133222615 16:4325217-4325239 CCTGAGCCCCTGACATAGGAAGG + Intronic
1133319681 16:4905167-4905189 GCTGAGACCCAGCTAGGGGAAGG - Intronic
1133424194 16:5673444-5673466 GCTGAAAGCCAGAGAGAGGAAGG - Intergenic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1134071573 16:11263448-11263470 CCTGAGACTCAGAGAGATTAAGG + Intronic
1134107730 16:11495802-11495824 GCTGAGACACAGAAAGGGTAAGG + Intronic
1134673935 16:16076116-16076138 CCCCAGACCCAGAAAGCAGAAGG - Intronic
1135064238 16:19295981-19296003 CCTGAGTCCCAGAAAAGGGTGGG + Intronic
1136099739 16:27985169-27985191 CCTGAGACCCTGATAGAGTCTGG + Intronic
1136448339 16:30337573-30337595 CCTGAGACCCAGAAAGAGGAAGG - Intergenic
1136777052 16:32877572-32877594 CCTGACACCCGGACAGAGGCTGG - Intergenic
1136893567 16:33983941-33983963 CCTGACACCCGGACAGAGGCTGG + Intergenic
1137021619 16:35433314-35433336 ACTGAGGTCCAGAAAGAGGAAGG - Intergenic
1137037164 16:35576958-35576980 CCAGAAACCCAGAAAGAGAGAGG - Intergenic
1137037184 16:35577067-35577089 CCAGCAACCAAGAAAGAGGAGGG - Intergenic
1137445836 16:48531663-48531685 CCTGACACCCAGAGAAGGGAAGG + Intergenic
1137528608 16:49261412-49261434 CCTGAGCCCCAGAAAGGAGGTGG - Intergenic
1137731209 16:50691864-50691886 ACTGAGTCCCACAGAGAGGAAGG - Intergenic
1137731558 16:50693888-50693910 ACTGAGTCCCACAGAGAGGAAGG - Intronic
1137798594 16:51242309-51242331 ACTGAGGCCTAGAAAGAGAATGG - Intergenic
1137876580 16:52002424-52002446 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1138476612 16:57273917-57273939 CCTCAGGCCCAGAGAGAGAAAGG - Intronic
1138556830 16:57775745-57775767 CCTGAGCCCAAGACACAGGACGG + Intronic
1139268604 16:65661867-65661889 CCTGAGACCGAGACTGGGGAGGG + Intergenic
1139964151 16:70736347-70736369 TCTGAGACTCAGAATGAGAACGG - Intronic
1140965573 16:79963203-79963225 ACTGAGACCTAGAAAGATTAAGG + Intergenic
1141147893 16:81544510-81544532 CCTGAGAGCCACACAGAGGCCGG - Intronic
1141164590 16:81652037-81652059 ACTGACACCCCGAGAGAGGAAGG - Intronic
1141357824 16:83365183-83365205 CCTGAGAACCAGAGAGCTGATGG + Intronic
1141634021 16:85304219-85304241 ACTGAGTCCCAGGAAAAGGAAGG + Intergenic
1141703948 16:85654658-85654680 CCTGGCACCCCGAACGAGGACGG - Intronic
1141923701 16:87153376-87153398 CCTGAGACCCTGAAAATGAAAGG + Intronic
1141935518 16:87235714-87235736 CCTGAGGCCTGGAAGGAGGAAGG + Intronic
1142047534 16:87935258-87935280 CCTGAGACCCAGAAAGAGGAAGG + Intronic
1142112663 16:88340614-88340636 GCTGAGGCCCAGAGGGAGGAAGG + Intergenic
1142276301 16:89120644-89120666 CCTGTGACCCAGAGAGAAGATGG - Intronic
1142407082 16:89896216-89896238 CCTTAAGCCCAGAGAGAGGAAGG - Intronic
1203079467 16_KI270728v1_random:1139681-1139703 CCTGACACCCGGACAGAGGCTGG - Intergenic
1142560306 17:805477-805499 CCTGAGGCCCTGAAAGGCGAAGG - Intronic
1142642050 17:1289861-1289883 CCTGAGTCCCAGCTGGAGGAAGG + Intronic
1143020372 17:3914455-3914477 CCTGTGACACACACAGAGGAGGG + Intronic
1143028923 17:3956649-3956671 CCTGGGTCACAGAATGAGGAAGG + Intronic
1143337117 17:6179668-6179690 ACAGATTCCCAGAAAGAGGATGG + Intergenic
1143615394 17:8046446-8046468 CCTGAGGCTCAGGGAGAGGAAGG + Intronic
1143659627 17:8316452-8316474 CCTGAGACCCAGCGAGCAGAAGG - Intronic
1143789939 17:9286801-9286823 CCAGAGACTCAGAAAAAGGGTGG + Intronic
1143836330 17:9695778-9695800 CCAGAGACTGAGGAAGAGGAAGG - Intronic
1144459190 17:15444033-15444055 TCTCAAACCCAGAAAGATGAAGG + Intronic
1144761285 17:17709032-17709054 ACTGAGGCCCAGAGAGTGGAAGG + Intronic
1145347986 17:22053911-22053933 GCTGATACCTGGAAAGAGGAAGG - Intergenic
1147305467 17:39561137-39561159 CCTGAGACCTGGAATGGGGAAGG + Intronic
1147436481 17:40419588-40419610 ACTGAAACCCAGGTAGAGGAAGG - Intergenic
1147561320 17:41511143-41511165 ACTGAAACCCAGAGAGAGGCAGG + Intergenic
1147652808 17:42071892-42071914 CCTGGAAGCCAGAAGGAGGAGGG + Intergenic
1148427906 17:47616148-47616170 ACTGAGACCCAGAGGGATGAAGG + Intronic
1148483561 17:47976089-47976111 CCCAAGACCCAGAGAGAAGAAGG + Intronic
1148652322 17:49259199-49259221 ACTGAGGCCCAGAATGGGGAAGG + Intergenic
1148746776 17:49922748-49922770 ACTGAGACCCAGCAACATGAAGG - Intergenic
1148798709 17:50210055-50210077 CCTGAGGCCCAGAAGGTGGAGGG + Intergenic
1149299789 17:55294546-55294568 CCTTACACACAGAAAGGGGAAGG - Intronic
1149412024 17:56418671-56418693 ACTGAGACCCAGAAAGGTGAAGG + Intronic
1150791053 17:68200449-68200471 ACCGAGACCCTGAGAGAGGAAGG - Intergenic
1151263822 17:72938199-72938221 CCTGCCACCCAGAAAGGAGACGG + Intronic
1151624452 17:75267901-75267923 CCTGTGAGCCAGGGAGAGGAAGG + Exonic
1151624969 17:75270931-75270953 CCTGCCCCCCAGTAAGAGGAAGG - Exonic
1152020620 17:77778564-77778586 CCTGGAACCCTGGAAGAGGAAGG - Intergenic
1152501314 17:80711410-80711432 CCTGACACTAAGAACGAGGATGG + Intronic
1152701765 17:81823054-81823076 CCTGAGACCCCCAAGGATGAAGG + Intronic
1152851287 17:82637869-82637891 CCTGAGACCCACAATTAGAAAGG + Intronic
1152911235 17:83005933-83005955 CCTGAGATCCAGAGGTAGGAGGG + Intronic
1153970125 18:10218554-10218576 CCTGACAGGCTGAAAGAGGAGGG + Intergenic
1154304629 18:13221331-13221353 TCTGAGACCTAAAAAAAGGAAGG - Intronic
1154999759 18:21674844-21674866 CCTGATAGCCAGAGGGAGGAGGG - Intronic
1155354712 18:24941134-24941156 TCTGGGAACCAGAAATAGGAGGG - Intergenic
1156318314 18:35993124-35993146 CCTGGGACCTGGAAAGAGGCTGG + Exonic
1156720975 18:40069775-40069797 ACTGAGACCCAGAAAGTGAAAGG - Intergenic
1156833911 18:41529496-41529518 CCTGTGTCACATAAAGAGGAGGG + Intergenic
1157330396 18:46699924-46699946 ACTGAGACCAAGAAAGAGGCTGG - Intronic
1157989714 18:52480052-52480074 CCTAAGACTCAGAATGATGAAGG + Intronic
1158144623 18:54298325-54298347 CCTGATGTCCAGACAGAGGAGGG - Intronic
1158266046 18:55661712-55661734 CCTGAGTCCTAGAAGGAGGTAGG - Intronic
1158716583 18:59885712-59885734 CCTGGGACCCTGAAAGGAGAGGG + Intergenic
1159219433 18:65440319-65440341 CCTGAGACCAGGATAAAGGATGG - Intergenic
1160867591 19:1262620-1262642 AGTGAGAACCAGAAAGAGGGTGG - Intronic
1161321314 19:3642960-3642982 CGTGACACCCAGAAAGAGAGTGG + Intronic
1161609954 19:5237114-5237136 CCTGAGACCCACCAAGAGTTCGG - Intronic
1162509218 19:11107368-11107390 TGTGAGAGCCAGAGAGAGGAAGG - Intronic
1162899380 19:13785490-13785512 GCTGAGACTCAGAAAGGTGAAGG - Intergenic
1163262240 19:16198213-16198235 CCGGTTACCCAGAAACAGGATGG - Intronic
1163526600 19:17825167-17825189 ACTGAGACCCAGAGAGGGAAAGG + Exonic
1164650461 19:29887460-29887482 CATGAGACCCAGAAAGGGGCTGG + Intergenic
1164742234 19:30584267-30584289 CCTGAGTCCCACAAGGAGCAGGG - Intronic
1165948052 19:39457149-39457171 TCTGAGACCCAGAGAGATTAAGG - Intronic
1166049862 19:40252232-40252254 CCAGAAACCCAGCAAGAGGGAGG - Intronic
1166114224 19:40642957-40642979 GCTGAGGCTCAGAGAGAGGAAGG + Intergenic
1166225310 19:41391487-41391509 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
1166351657 19:42201708-42201730 CCCTAGAGCCAGAAAGAGGAAGG - Intronic
1166354630 19:42219631-42219653 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
1166359402 19:42246604-42246626 CCTGAGGCCCAGAAAGGGGAAGG - Intronic
1166391036 19:42409054-42409076 CCTGAAAGTCAGAGAGAGGATGG + Intronic
1166516883 19:43453868-43453890 ACTGAGGCACAGAAAGATGATGG + Intergenic
1166519401 19:43470261-43470283 TCTGAGACCCAGAGAGAGGAAGG + Intergenic
1166797506 19:45436160-45436182 ACTGAGGCTCAGAGAGAGGATGG - Intronic
1167110083 19:47455180-47455202 ACTGAGTCCCAGGAAGAGAAGGG + Intronic
1167112659 19:47471457-47471479 GATGAGACCCAGACACAGGAAGG + Intronic
1167203138 19:48081421-48081443 TCAGAGATTCAGAAAGAGGAGGG + Intronic
1167259703 19:48451386-48451408 ACTGAGGCTCAGCAAGAGGAAGG + Intronic
1167260447 19:48455021-48455043 ACAGAGACCCAGAGAGAGGGGGG - Exonic
1167306883 19:48714673-48714695 CCTGGGACCCTAAAACAGGATGG + Intronic
1167315748 19:48761899-48761921 ACAGAGACCCAGAGAGAGGGGGG + Intergenic
1167322793 19:48806796-48806818 CCTCAGACCCATAGAGAAGAAGG + Intronic
1167348895 19:48963051-48963073 ACAGAGACCCAGAGAGAGGGGGG - Intergenic
1167368480 19:49066726-49066748 ACAGAGACCCAGAGAGAGGGGGG - Intergenic
1167387149 19:49170680-49170702 CCTGAGTCCCTGAATGAGGCAGG - Intronic
1167413914 19:49360761-49360783 ACAGAGACCCAGAGAGGGGATGG + Intronic
1167413929 19:49360809-49360831 ACAGAGACCCAGAGAGAGAAGGG + Intronic
1167427660 19:49437714-49437736 GCAGAGACCCAGAGAGAGAAGGG + Intronic
1167441945 19:49513692-49513714 CAAGAGACCCAGAAAGAGAGGGG - Intronic
1167475925 19:49700974-49700996 ACAGAGACCCAGAAAGAGAGGGG - Intronic
1167552285 19:50169485-50169507 ACAGAGACCCAGAAGGGGGAGGG - Intergenic
1167564772 19:50249329-50249351 ACAGAGACCCAGAGAGAGAAGGG - Intronic
1167690232 19:50980568-50980590 ACAGAGACCCAGAGAGAGGAGGG + Intronic
1167690240 19:50980594-50980616 ACAGAGACACAGAGAGAGGAGGG + Intronic
1167690267 19:50980710-50980732 ACAGAGACCCAGAGAGAGGAGGG + Intronic
1167690281 19:50980762-50980784 ACAGAGACACAGAGAGAGGAGGG + Intronic
1167706516 19:51084326-51084348 AGAGAGACCCAGAAAGAGAAGGG + Intergenic
1167743581 19:51338772-51338794 CCTTAGTCCAAGAAAGAGGCAGG - Intronic
1167752699 19:51390424-51390446 ACAGAGACCCAGAGAGAGGAGGG - Intronic
1168132824 19:54332050-54332072 ACTGAGGCCCAGGCAGAGGAGGG + Intergenic
1168308744 19:55450591-55450613 ACAGAGACCCAGAGAGAGAAGGG + Intergenic
925162375 2:1694905-1694927 CCTGAGACACAGCAAGCTGAGGG + Intronic
925219482 2:2126452-2126474 TCTGGGGCCCAGAAAGAAGAGGG + Intronic
925423216 2:3728195-3728217 GCTGGGAACGAGAAAGAGGAAGG + Intronic
925633531 2:5919196-5919218 TATGAGACCCAGAAAGAGAAAGG + Intergenic
925702793 2:6655605-6655627 ACTGAGGCCCAGATAGAGGTTGG + Intergenic
925902428 2:8518123-8518145 CCTGAGACCCAGGAAGTTGCTGG - Intergenic
926185685 2:10689161-10689183 GCTGAGATCCAGCAAGGGGAAGG - Intronic
927326157 2:21807743-21807765 CCTGAAACAGAGAAAGTGGAGGG - Intergenic
927373540 2:22385820-22385842 TCTGAGGCCCATAAAGAGAATGG - Intergenic
927755178 2:25702502-25702524 ACTGGGACCCAGGAAGAGCATGG - Intergenic
927869658 2:26615503-26615525 GTTGAGGCCCAGGAAGAGGAAGG + Intronic
927881773 2:26694159-26694181 CCTGAGACCCAGACAGGGGAAGG - Intronic
927884402 2:26709790-26709812 CCTGAGGCCCAGCAAGGCGATGG + Intronic
928096163 2:28406479-28406501 ACGGAGACCCAGAAAGGTGAAGG + Intronic
928125473 2:28612456-28612478 GCTGAGCCCCAGAGTGAGGAAGG - Intronic
928810747 2:35221859-35221881 CAAGAGACCAAGAAAGAGCAGGG + Intergenic
930358095 2:50346306-50346328 CCTGAGCACCAGAGAGAAGAGGG - Intronic
931636322 2:64343802-64343824 CCAGAGTCCCAGAAGGAAGATGG - Intergenic
931653617 2:64490463-64490485 CCTGAGACCAAGAAATAGAAGGG - Intergenic
932170001 2:69545959-69545981 ACTGAGCACCAGAAAGAGGAAGG + Intronic
932226347 2:70044079-70044101 TCTGAGAACCAGACTGAGGAAGG - Intergenic
932232626 2:70095152-70095174 ACTAAGACCCAGAAAGAGGGAGG - Intergenic
932581798 2:72996862-72996884 CCTGAGTCTCAAAAAAAGGAAGG + Intronic
932820825 2:74898451-74898473 GCTGAGCCCAAGACAGAGGATGG - Intergenic
933920047 2:87036437-87036459 CCTGGGTCCCAGAATGAGGCAGG + Intergenic
933928441 2:87123169-87123191 CCTGGGTCCCAGAATGAGGCAGG + Intergenic
933931577 2:87157349-87157371 CCTGGGTCCCAGAATGAGGCAGG - Intergenic
933968004 2:87445930-87445952 CCTGGGACACAGCAAGAAGAAGG - Intergenic
934002948 2:87733461-87733483 CCTGGGTCCCAGAATGAGGCAGG - Intergenic
934712846 2:96527244-96527266 CCTGAGAACCCGAGAGAGCAGGG + Intergenic
935083824 2:99825771-99825793 CCTGAGGGCTAGAAACAGGAGGG - Intronic
935738826 2:106128581-106128603 CCTGAGAACCAGAGAGCCGAGGG - Intronic
936361543 2:111808085-111808107 CCTGGGTCCCAGAATGAGGCAGG + Intronic
936578619 2:113676110-113676132 TCTGAATCCCAGGAAGAGGAGGG - Intergenic
937056532 2:118941973-118941995 CCTGAGACCCAAAAGCTGGATGG - Intergenic
937268632 2:120633130-120633152 GCTGACATCCAGAAAAAGGAGGG + Intergenic
937864096 2:126735118-126735140 CCCGAGACCCTGAAGGAGCAAGG - Intergenic
939982440 2:148797608-148797630 CCTAGGACCCAGAGAGAGGAAGG + Intergenic
940136974 2:150447990-150448012 CCTGACCTCCAGAAAGAGGAGGG - Intergenic
941925583 2:170891200-170891222 CCTGATACCCAGAGAAAGGCAGG + Intergenic
942082081 2:172409854-172409876 ACTGAGACCCATAAAGGGTAAGG - Intergenic
942146723 2:173034405-173034427 CCAGACACCCAGGAAGAAGACGG + Intronic
942163263 2:173214973-173214995 CCTGAGAGACAGATTGAGGAAGG + Intronic
943372963 2:187039414-187039436 CCTGAGACCCAGAATGACTGCGG - Intergenic
944455151 2:199885449-199885471 CCTGAGACCCGGGAAGGGGGAGG + Intergenic
944634400 2:201660803-201660825 TGTGAGACCCAGGAAGGGGAAGG - Intronic
945201421 2:207285484-207285506 CTTGAGTCCCAGCAAGAGCAGGG - Intergenic
945340004 2:208640993-208641015 CCTGAGAACCAAACACAGGAGGG - Intronic
945952112 2:216049119-216049141 CCTGACAGCCAGAAAGAACAGGG + Intronic
946218094 2:218201889-218201911 TCTGAGAGCCAGAAAGAAAATGG + Intergenic
946479532 2:220040798-220040820 CAGGAGACCCAGAAGGAGCAAGG - Intergenic
947073258 2:226315025-226315047 CCTGAGACCCAGAAGGAAGAAGG - Intergenic
947708092 2:232292696-232292718 CCTGAGCCCCTGAAAGGAGAAGG + Intronic
948550475 2:238768964-238768986 CATGAGACACAGAAAGACAAAGG - Intergenic
948941660 2:241199909-241199931 CCTGAGGCCCTGAGAGGGGAAGG + Intronic
1168955293 20:1830268-1830290 ACTGAGGCCCAGAGAGGGGAAGG - Intergenic
1168970501 20:1927579-1927601 GGTGAGACCCAGACAGAGGTAGG + Intronic
1169502911 20:6178177-6178199 ACAGAGACACAGAAGGAGGATGG + Intergenic
1169889255 20:10434759-10434781 CCTGGAACCCAGAAGCAGGATGG - Intergenic
1169927713 20:10800305-10800327 CCTGAGACCCAGAGGCAGGGTGG - Intergenic
1170353646 20:15469472-15469494 CCTGGGATCCACAAAGATGATGG + Intronic
1170661526 20:18345844-18345866 CCAGAGACTCAGGAGGAGGAAGG + Intergenic
1170805226 20:19623916-19623938 CCTGAGACTCAGGAAGAAGAGGG + Intronic
1171341048 20:24430084-24430106 CCAGAGAACAAGAAAGAGGATGG + Intergenic
1172399568 20:34638137-34638159 GCTGGAACCCAGAAAGGGGATGG - Intronic
1172441787 20:34971314-34971336 CCTCAGCCACAGCAAGAGGAGGG - Intergenic
1172594293 20:36139657-36139679 ACTGAGACCCAGAGAGGGGAAGG - Intronic
1172603456 20:36199234-36199256 ACCGAGACCCAGAAAGAGGAAGG + Intronic
1172850463 20:37958974-37958996 CCTGTGAACAAGAAAGAGAAAGG - Intergenic
1173253648 20:41377580-41377602 CCTGAGATCTGGAGAGAGGATGG + Intergenic
1173542107 20:43861819-43861841 ACTGAGACCCAAAGAAAGGAAGG - Intergenic
1173569316 20:44066494-44066516 ACTGAGGCCCAGAAAGGGAAAGG + Intronic
1173648238 20:44646926-44646948 ACTGAGACTCAGAGAGGGGAGGG - Intronic
1173721356 20:45260859-45260881 ACTGAGGCCCAGAGAAAGGAAGG - Intergenic
1173903423 20:46607643-46607665 TCTGAGACTCAGGAAGGGGAAGG - Intronic
1173944729 20:46941415-46941437 ACTGAGCCCCAGAAAGATGAAGG - Intronic
1174407776 20:50313179-50313201 CATAAGACCCAGAGAGGGGAAGG + Intergenic
1175101100 20:56579399-56579421 GCTGAGATCCTGAAAGAGGTGGG + Intergenic
1175725208 20:61313293-61313315 CCGGAGACCCAGAAGCAGCAGGG + Intronic
1175937054 20:62518733-62518755 CCTGAGCACCGGAAAGAGGATGG + Intergenic
1178741550 21:35206621-35206643 TCAGAGACACAGAGAGAGGAGGG - Intronic
1179464812 21:41564546-41564568 ACTGAGACTCAGAGAGATGAAGG - Intergenic
1179574621 21:42299930-42299952 CCAGGGCCCCAGAACGAGGAAGG + Intergenic
1179837808 21:44049032-44049054 CCTGAGATGAAGCAAGAGGAGGG - Intronic
1179923437 21:44520033-44520055 CCTGGGAGCCAGGAAGAGGCGGG - Intronic
1181151391 22:20885884-20885906 CCTGAGATCCTGAAATAGCAGGG - Intronic
1181652998 22:24271161-24271183 CCCGAAGCCCAGAACGAGGACGG - Intronic
1181853339 22:25765589-25765611 ACTGAGGCCAAGAAAGGGGAAGG - Intronic
1181901493 22:26159944-26159966 AGTGAGACAGAGAAAGAGGAAGG + Intergenic
1181959940 22:26615879-26615901 CTTGTGTCCCAGAAGGAGGAGGG + Intronic
1181983444 22:26782603-26782625 ACTGAGACCCAGAGAGGGGCAGG + Intergenic
1182051895 22:27318819-27318841 TCTGAGAAACAGCAAGAGGAAGG + Intergenic
1182359485 22:29738250-29738272 CCTGAGCCTCAGGAAGGGGAAGG + Intronic
1182830932 22:33304086-33304108 GCAGAGACCCAGAAAGGGGAAGG - Intronic
1183074639 22:35419232-35419254 ACTGAGACCCAGAGGGAGGGAGG - Intronic
1183220018 22:36506476-36506498 CACGAGGCCCAGAAAGAGGCGGG + Intronic
1183236133 22:36619110-36619132 ACCGAGACCCAGAAAGGTGAAGG + Intronic
1183542217 22:38436013-38436035 CCTGAGACTCATGAAGAGGAGGG - Intronic
1183548363 22:38467482-38467504 ATTGAGACCAAGAGAGAGGAAGG + Intergenic
1183735881 22:39644610-39644632 CCTGAACCCCAGAAAGGTGAGGG + Intronic
1184034656 22:41912749-41912771 CCTGAAGCCCAGAAAGGAGAAGG + Intronic
1184424739 22:44402870-44402892 GATGAGACCCCCAAAGAGGAAGG - Intergenic
1184514407 22:44953093-44953115 CCTGGGCCTCAGAGAGAGGAAGG - Intronic
1184583361 22:45431351-45431373 GGTGAGACCCAGGAGGAGGATGG + Intronic
1184615247 22:45633526-45633548 CCTGAGACCCTGAAGCCGGAAGG + Intergenic
1184684163 22:46088470-46088492 ACTGAGACCCGGAGAGAGGAAGG - Intronic
1184688930 22:46108761-46108783 CCTGGGACCCAGGACGAGGAAGG - Intronic
1184689949 22:46112987-46113009 ACTGAGACCCAGAGAGATCAGGG - Intronic
1185009927 22:48307160-48307182 CCTGAGACAGAGCAGGAGGAAGG - Intergenic
949879107 3:8647982-8648004 CCTGGCTCCCAGAGAGAGGAGGG - Intronic
950281047 3:11708362-11708384 AATTAGACCCAGAAAGAGCAGGG + Intronic
952961820 3:38596856-38596878 ACTGAGGCCCAGAGACAGGAGGG - Intronic
953025016 3:39139758-39139780 ACTAAGACCCAGAGAGGGGAAGG - Intergenic
953480856 3:43250770-43250792 CCTGAGACCCACCATAAGGATGG + Intergenic
953866399 3:46586887-46586909 CCTGAGGACCAGATAGAGGAAGG + Intronic
953910316 3:46889515-46889537 CAAGAGTCACAGAAAGAGGAGGG - Intronic
954460176 3:50622026-50622048 CCTGGGAACCAGAAGGAAGATGG - Intronic
954575548 3:51674143-51674165 GCTCTGACCCAGAAAGGGGAGGG - Intronic
954628306 3:52034880-52034902 CCTGAGTCCCAGAAAGGTGGAGG + Intergenic
954854907 3:53635589-53635611 GCTGAAACCCAGATAGAGAAAGG - Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955923773 3:63985833-63985855 CCTGCGACCTAGAAAGAGTGAGG - Intronic
956482629 3:69688323-69688345 TCTGAGACCCAGGAAGCAGAAGG - Intergenic
957038332 3:75315527-75315549 ACTGAGACCTAGAAAGGAGAAGG - Intergenic
957584431 3:82115120-82115142 CCTGAGAGCCACATAGAGAAGGG - Intergenic
958822371 3:98990276-98990298 ATTGAGACCGAGAAAGAGGTGGG + Intergenic
960243009 3:115367341-115367363 CCAGAGGCCCGGAAAGAGAAGGG + Intergenic
961014513 3:123457290-123457312 CCTGGGAGCTAGAAGGAGGAGGG + Intergenic
961041418 3:123681252-123681274 GCTGAGATCCAAAAAGAGGGAGG + Intronic
961086352 3:124070839-124070861 ACTGAGACCCAGAAAGGAGAAGG - Intergenic
961449173 3:126994802-126994824 CCTGAGAGCAAGAAGGAGGCAGG - Intronic
961811663 3:129525463-129525485 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
961955577 3:130799608-130799630 TCAGAGACTCAGAAGGAGGATGG + Intergenic
962030270 3:131592298-131592320 ACTGAGGCACAGAAAGATGAAGG + Intronic
962247331 3:133806383-133806405 CCTGAGTCCCAGTCAGAGTAAGG + Intronic
962825488 3:139096623-139096645 ACTGGGGCCCAGAAAGAGGAAGG - Intronic
963838278 3:150079092-150079114 CCTGTGAGCCGGAAGGAGGAAGG + Intergenic
964887591 3:161502606-161502628 ACTGAGACCCAGAACGAGTGAGG - Intronic
965097100 3:164244337-164244359 CCTGAGAGCCAGAAAGCAAATGG + Intergenic
966918516 3:184597769-184597791 ACTGAGGCCCAGGGAGAGGAGGG - Intronic
967109201 3:186278495-186278517 ACTGAGACCCAGAGAAATGAAGG - Intronic
967790523 3:193543941-193543963 TCTGAGACTCAGAAAGAGGCTGG + Intronic
967954288 3:194865801-194865823 ACTGAGACTCAGAAGTAGGAAGG + Intergenic
968232912 3:197014997-197015019 GCTGAGATTCAGAAAGGGGAAGG + Intronic
968521747 4:1037378-1037400 CCTGTGAGCCAGAGAGAGTAGGG + Intergenic
969632379 4:8346227-8346249 ACTGAGGCCCAGAAAGAGCCAGG - Intergenic
969703432 4:8780031-8780053 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
971990193 4:33882490-33882512 CAAGAAACCCTGAAAGAGGATGG - Intergenic
972322870 4:37988862-37988884 CCTGAATTCCAGAGAGAGGAAGG - Intronic
972391680 4:38619503-38619525 CCTCAGAACCAGAAAAGGGAAGG - Intergenic
972541497 4:40043206-40043228 CCGGAGACCCAGGACGAGAAGGG - Intergenic
973251950 4:48069750-48069772 ACTGAGACATAGAAGGAGGAAGG - Intronic
973601778 4:52549434-52549456 CCAGGGAACCAGGAAGAGGATGG + Intergenic
974648368 4:64723276-64723298 CCTGAGAACCAGGAAGAGCAAGG - Intergenic
974725104 4:65788576-65788598 CCTGAGAACCAGGAAGCTGATGG + Intergenic
975334631 4:73161749-73161771 ACAGAGACACAGAAAGAGAAGGG + Intronic
975979956 4:80145982-80146004 CCTGAGACCAGGAAAGAAGTGGG + Intergenic
976855880 4:89604890-89604912 CAGGAGTCCCAGAAAGAGGGAGG + Intergenic
977302419 4:95282729-95282751 CCTGACACCCAGATGAAGGAAGG - Intronic
977686350 4:99851332-99851354 AATGAGAGACAGAAAGAGGAAGG + Intronic
978579090 4:110214705-110214727 ACTGAGGCCCAGAAAGGTGAAGG - Intergenic
979325138 4:119370490-119370512 CCTACATCCCAGAAAGAGGAAGG - Intergenic
979670662 4:123357244-123357266 GCTGAGGGCCACAAAGAGGAGGG - Intergenic
979931388 4:126636026-126636048 CATGAGAAGCTGAAAGAGGAAGG - Intergenic
980659798 4:135842401-135842423 CCTGAGAACTGGAAAGAGTAGGG + Intergenic
980842959 4:138288474-138288496 CCTGAGAACCAGGAAGAGACAGG + Intergenic
981542415 4:145859673-145859695 CGCGAGAACCAGAGAGAGGAAGG - Intronic
981595808 4:146420522-146420544 CCTGAGAGGAAGAAAGTGGATGG + Intronic
982932146 4:161421866-161421888 CCTGAGAGCTAGAAAGCTGATGG - Intronic
983139514 4:164132190-164132212 CGTGAAACGAAGAAAGAGGAAGG - Intronic
983243043 4:165255514-165255536 CCTACATCCCAGAAAGAGGAAGG - Intronic
984729587 4:183055201-183055223 GCTGAGAGGAAGAAAGAGGAGGG - Intergenic
987243592 5:16026274-16026296 CCTGAGAACAAGAAAGCTGATGG + Intergenic
989511296 5:42290352-42290374 TCTGAGACCTAGGAAAAGGAGGG - Intergenic
991563326 5:67978298-67978320 TCTGAGACACACAAAGAGAAGGG - Intergenic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
993705299 5:91162702-91162724 TCAGAGACCCAGAAGAAGGAGGG + Intronic
994420354 5:99523125-99523147 GCTGAGGCCCAGAAATATGAGGG + Intergenic
994420522 5:99523944-99523966 GCTGAGGCCCAGAAATATGAGGG + Intergenic
994486518 5:100390370-100390392 GCTGAGGCCCAGAAATATGAGGG - Intergenic
994486686 5:100391189-100391211 GCTGAGGCCCAGAAACATGAGGG - Intergenic
994486855 5:100392008-100392030 GCTGAGGCCCAGAAATATGAGGG - Intergenic
995209540 5:109521554-109521576 CCTGAGAGCCAGAGAGACAATGG + Intergenic
995255143 5:110037211-110037233 TCAGAGACCCAGAAGGAGTAAGG - Intergenic
995281417 5:110339918-110339940 CCTGAACTCCAAAAAGAGGAGGG + Intronic
995328893 5:110924058-110924080 CCTAAGACCTAGAAAGTGCATGG + Intergenic
996118175 5:119642314-119642336 CCTGAGACTCAGAAAGTGTCAGG + Intergenic
996892060 5:128432935-128432957 CCTGAGACTGAGCAAGAGCAGGG + Intronic
997885835 5:137629301-137629323 ACTGAGGCCCAGAAAGGGGAAGG - Intronic
998352948 5:141512880-141512902 CGTGAGACACAGGAAGAGGGTGG - Exonic
998374220 5:141680710-141680732 ACTGAGGCCCAGAGAGGGGAAGG + Intronic
998835983 5:146203514-146203536 CCTGAGAACCAGTAAGAGAGAGG - Intergenic
999087424 5:148905040-148905062 ACTGAGACACAGAAAGGGGCAGG - Intergenic
999088648 5:148915328-148915350 ACTAAGGCCCAGGAAGAGGAAGG + Intergenic
999149086 5:149414933-149414955 GCTGAGTCACAGAAAGAGCATGG + Intergenic
999240690 5:150125672-150125694 CCTGAGGCCCAGAGAGGGGCAGG + Intronic
999246974 5:150160242-150160264 ACTGAGGCCCAGAGAGTGGAGGG + Intergenic
999300432 5:150486822-150486844 CCCGAGACCCTGAGGGAGGAGGG - Intronic
999501655 5:152152552-152152574 ACTGAAACACAGAGAGAGGAAGG - Intergenic
1000139618 5:158389480-158389502 CCAAAGGCCCAGAAACAGGAGGG - Intergenic
1000362293 5:160458969-160458991 ACAGAGACCCACACAGAGGAAGG - Intergenic
1000687667 5:164272647-164272669 GCTGAGAGGCAGAAAGAGAAAGG + Intergenic
1001157386 5:169284633-169284655 CCTGAGACCCAAAGAGATGAAGG + Intronic
1001253754 5:170168124-170168146 ACTGAAGCCCAGAGAGAGGAAGG - Intergenic
1001314873 5:170634749-170634771 CCTGAAAGCCAAAAAGAGAAAGG + Intronic
1001757422 5:174181235-174181257 CATGAGACCCAGATAGGGCAGGG - Intronic
1001826126 5:174746474-174746496 ACTGAGGCCCAGATAGGGGAAGG + Intergenic
1001851101 5:174966503-174966525 TCTGAGAACCAGAAAAAGCAAGG - Intergenic
1001946576 5:175783816-175783838 CCTGAGAACCAGAAAGCTGATGG + Intergenic
1001950086 5:175810259-175810281 ACTGAGACCCAGAGTGGGGAGGG + Intronic
1002177919 5:177412608-177412630 ACAGAAACACAGAAAGAGGAGGG + Intronic
1002296372 5:178233311-178233333 CCTGAAGCCCAGAAAGGGAAAGG + Intergenic
1003066896 6:2911419-2911441 CCTGAGACTCAGAAAGGTTAAGG + Intergenic
1003623248 6:7720839-7720861 GGTGAGACCCAGAACGAAGAAGG - Intergenic
1003895094 6:10599847-10599869 CCTGGCACATAGAAAGAGGAAGG + Intronic
1004140492 6:13013608-13013630 CGTGAGACCCCGAGAGAGGTGGG + Intronic
1004476054 6:15973267-15973289 CCTGAGACCCAGAGAGCCAATGG - Intergenic
1005428291 6:25726969-25726991 GTTAAGACCCAGAAAAAGGAAGG + Exonic
1006005531 6:30998954-30998976 CCTGATACCCAAAAACAGGCTGG + Intergenic
1006361027 6:33587158-33587180 ACTGAGGCTCAGAAAGAGGAAGG - Intergenic
1006376828 6:33676373-33676395 CCACAGACCCAGAGCGAGGATGG + Intronic
1007103407 6:39267232-39267254 ACTGAGACCCAGAGAGAGAAGGG + Intergenic
1007168916 6:39848556-39848578 GCTGAGACCCGAGAAGAGGAAGG - Intronic
1007299684 6:40857463-40857485 CCTGAGGCCCAGGGAGATGAAGG + Intergenic
1007348499 6:41251167-41251189 TCTGAGACCCACAAATACGAAGG - Intergenic
1007391656 6:41552927-41552949 ACTGAGGCCCAGAGAGAAGACGG - Intronic
1007476701 6:42124117-42124139 CCAGAGGCCCAGGGAGAGGAAGG + Intronic
1007493223 6:42240576-42240598 GTTGAGACCCAGAGAGAGGAAGG - Intronic
1008070648 6:47095677-47095699 CCAGAGCTCCAGAAACAGGAAGG - Intergenic
1008496946 6:52143730-52143752 CCTGAGCCTCAGAAGGATGAGGG - Intergenic
1008750964 6:54733431-54733453 CATGAGAAACAGCAAGAGGAAGG + Intergenic
1009834196 6:68976740-68976762 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1011520301 6:88197122-88197144 CCTGGGACCCACACAGAGGGAGG + Intergenic
1011722701 6:90175839-90175861 TCTGAGGGCCAGATAGAGGAGGG - Intronic
1011806013 6:91073327-91073349 CCTGAGATCCAGAGAGCTGATGG + Intergenic
1014573835 6:123045450-123045472 AGTGACACCGAGAAAGAGGAAGG + Intronic
1017680028 6:156854233-156854255 CCAGAAAAACAGAAAGAGGAGGG - Intronic
1017981189 6:159402170-159402192 CAGGAGAGCCAGAAAGGGGAGGG - Intergenic
1019299274 7:295435-295457 CCTGGGACCCAGAAAAGGAAGGG + Intergenic
1019328839 7:452892-452914 CCTGGGTCCCAGAAAGACGACGG + Intergenic
1019332816 7:469253-469275 GCAGAGTCCCAGACAGAGGAAGG - Intergenic
1019550918 7:1602123-1602145 ACTGGGACCCAGACAGAGGCCGG - Intergenic
1019682517 7:2359336-2359358 CCTGCCACCCAGAAGGAAGAGGG + Intronic
1022247196 7:28571717-28571739 CCTTATCCCCAGAATGAGGATGG + Intronic
1023627095 7:42126884-42126906 CCTGTAATCCAGAAACAGGAAGG - Intronic
1023993128 7:45142041-45142063 TCTGAGACCCAGAGAGGGGACGG - Intergenic
1024629890 7:51238336-51238358 CATGAGACCCAGTATGTGGAGGG - Intronic
1024786791 7:52916885-52916907 CCTAAGAGCCAGAAAGAAGCAGG - Intergenic
1025603532 7:63022727-63022749 ACTGAGGCCCAGAAAGGTGAAGG - Intergenic
1025969606 7:66309955-66309977 CCTGAGATACAGAAAGAATAGGG + Intronic
1026068123 7:67093468-67093490 CCTAAAACTCAGAAAGTGGAAGG - Intronic
1026522521 7:71129951-71129973 CATGAACTCCAGAAAGAGGAGGG + Intergenic
1026708798 7:72718839-72718861 CCTAAAACTCAGAAAGTGGAAGG + Intronic
1026911255 7:74093159-74093181 CCTGAGCCCCTGAGGGAGGATGG + Intronic
1027149611 7:75723570-75723592 GCTGAGACCCAGCAAGGAGACGG - Intronic
1028295508 7:89124897-89124919 CCTGATAGACAAAAAGAGGATGG - Intronic
1028314293 7:89381048-89381070 CCTGAGACTCAAAAAGATGTAGG + Intergenic
1028651512 7:93155341-93155363 CCAGAGACCCACAGTGAGGAAGG + Intergenic
1029346659 7:99983599-99983621 CCTGAGACCTGGGATGAGGATGG - Intergenic
1029422061 7:100476969-100476991 GCTGAGACCAAGACAGAAGAAGG + Intronic
1029551144 7:101237713-101237735 CCTGAGCCCGAGGAAGAGGCAGG - Exonic
1029609070 7:101617025-101617047 ACTGAAGCCCAGAGAGAGGAAGG + Intronic
1029806854 7:103007137-103007159 CTGGAGTCCCAAAAAGAGGAAGG + Intronic
1030085499 7:105812002-105812024 GCTGAGACCCAGAAAACAGAAGG - Intronic
1032863335 7:135902387-135902409 CCTTTTACCCAGAAAGAGGCAGG - Intergenic
1033454008 7:141486235-141486257 ACGGAGACCCAGAAAGGTGAGGG + Intergenic
1033600188 7:142883788-142883810 CCTGATATCCAGCAAGAAGAAGG + Intronic
1033817854 7:145096852-145096874 CCAGAGTCCTAGAAAGAGGCTGG - Intergenic
1035455432 7:159005950-159005972 CCTGCGGCCGAGGAAGAGGACGG + Intergenic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1037596632 8:20359734-20359756 CCTGAGGCACAGAAAGCTGAGGG + Intergenic
1037884047 8:22586985-22587007 CCTGAGGCCCAGGGAGAGGAAGG - Intronic
1037905657 8:22714665-22714687 TCTGATACCCAGACAGAAGAGGG + Intronic
1039439900 8:37587973-37587995 ACTGAGACCCAGAGAGGCGAGGG + Intergenic
1039475306 8:37836492-37836514 CCTGGCACCCAGAAAGCAGATGG + Intronic
1042957714 8:74269722-74269744 CCTGAGACTCAGAGAGATTAAGG + Intronic
1043064765 8:75554878-75554900 CCTGAGACCCTGAAAGACAAGGG + Intronic
1043276515 8:78402685-78402707 CCTGAGTCCTAGAGAGAGTAAGG + Intergenic
1043360275 8:79464073-79464095 TTTGAGAACAAGAAAGAGGATGG - Intergenic
1045555713 8:103213047-103213069 CCTCTGACCCAGAAACAGAATGG + Exonic
1046450422 8:114383331-114383353 ACTGAGGCCCAGAAAGAGGAAGG + Intergenic
1047511646 8:125520427-125520449 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1047520720 8:125593657-125593679 ACTGAGGCCCAGAGAGATGAAGG + Intergenic
1047704905 8:127488569-127488591 GCTGAGACTCAGAAAGGGGGAGG + Intergenic
1047705418 8:127494504-127494526 CATGAGATCATGAAAGAGGAAGG + Intergenic
1048037157 8:130688242-130688264 CCTGAGACATAGATGGAGGAAGG + Intergenic
1049223882 8:141440552-141440574 ACTGAGCCCCAGAAAGGGAAAGG + Intergenic
1049624034 8:143612157-143612179 CCTGAGAGCCACAGAGAGGAGGG + Intergenic
1049741732 8:144244301-144244323 CCTGAGCCCAAGGAGGAGGACGG + Exonic
1049826945 8:144674980-144675002 CCTGAGTCCCCGAGAGAGCAGGG + Intergenic
1051748465 9:20317730-20317752 CCTGACACACAGAGAGAGCAAGG + Intergenic
1051804522 9:20977169-20977191 ACAGAGAACCAGAAAGATGATGG - Intronic
1052393936 9:27914624-27914646 TCTAAGACCCAGAAAAAGTAAGG + Intergenic
1052608265 9:30733169-30733191 CCTGTGACCCTAAATGAGGACGG - Intergenic
1052851360 9:33380383-33380405 ACTGAGGCCCAGAGAGTGGAGGG + Intergenic
1053164996 9:35837961-35837983 TCTTAGACACAGGAAGAGGAAGG - Intronic
1053207653 9:36200528-36200550 ACTGACACCCAGAAATAGGAAGG + Intronic
1053307206 9:36993532-36993554 ACTGAGGCCCAGACAGAGAAAGG + Intronic
1053451988 9:38201359-38201381 ACTGAGGCCCAGACACAGGAAGG + Intergenic
1053474563 9:38372658-38372680 ACTGAGACCCAGGAACAGAAAGG - Intergenic
1056619340 9:88197815-88197837 CCTGAAAGCCAGAAAGAAGAAGG - Intergenic
1057716929 9:97502480-97502502 ACTGAGATCCAGAAACAAGAGGG - Intronic
1057836673 9:98451071-98451093 ACTGAGACTCAGAAAGGGGTGGG - Intronic
1057838978 9:98469756-98469778 CCTAAGAGCCAGAGAGGGGAAGG - Intronic
1057850102 9:98559022-98559044 ACCGAGGCCCAGAAAGGGGAAGG - Intronic
1057945752 9:99326537-99326559 CCTGAGACCAAGGAAGAGAGGGG + Intergenic
1058261190 9:102834657-102834679 CTTGAGAGTCAGAAACAGGAGGG - Intergenic
1058680032 9:107432577-107432599 ACTGAGGCCCAGAGAGGGGAAGG - Intergenic
1058959271 9:109977767-109977789 GCTGATACCCAGAGAGAGGCAGG - Intronic
1059370376 9:113826225-113826247 TCAGAGTCCCAGAAAGAGAAGGG + Intergenic
1059464928 9:114462432-114462454 ACTGAGGCCCAGGGAGAGGAAGG + Intronic
1059531113 9:115036538-115036560 ACTGAGACCGAGGTAGAGGACGG + Intronic
1059536978 9:115090127-115090149 ACTGAGGCCTGGAAAGAGGATGG - Intronic
1059739232 9:117133468-117133490 ACTGAGGCCCAGAGAGTGGAAGG + Intronic
1059964674 9:119601967-119601989 ACTGAGGCCCAGGAAGGGGAAGG - Intergenic
1060130631 9:121094362-121094384 CCTGAGACACAGAGAGAAAAAGG + Intronic
1060141522 9:121214389-121214411 ACTGAGACTCAGAAAGATTATGG - Intronic
1060298109 9:122356668-122356690 ACTGAGACCCAGAGACTGGAGGG - Intergenic
1060865456 9:126991694-126991716 ACAGAGACACAGAAAGATGAGGG - Intronic
1060870657 9:127037363-127037385 CCTGAGACCCAAAGAGAGGAGGG - Intronic
1060881796 9:127122777-127122799 CCTCAGCCCCAGACAGAGGCGGG + Exonic
1060943857 9:127558436-127558458 ACTGAGGCCCAGGAAGATGATGG - Intronic
1060976780 9:127769822-127769844 ACTGAGACTCAGAGAGGGGAAGG - Intronic
1061028488 9:128065922-128065944 CCTCAGGCCCCGGAAGAGGAAGG - Intronic
1061196564 9:129110194-129110216 CCTTAGACCCAGAGACAGGCCGG - Intronic
1061390463 9:130314864-130314886 ACTGAGGCCCAGAGTGAGGATGG + Intronic
1061422562 9:130480177-130480199 ACTGAGGCCCAGAGAGAGCAGGG - Intronic
1061499451 9:130993642-130993664 CCTGAGGCCCAGAGAGGGGAAGG + Intergenic
1061759657 9:132841660-132841682 ACTGAGGCCCAGATGGAGGAAGG - Intronic
1061764129 9:132870741-132870763 CCCCAGGCCCAGTAAGAGGAAGG + Intronic
1061804532 9:133130764-133130786 ACTGAGCCCCAGAGAGAGCAGGG + Intronic
1061841010 9:133358592-133358614 CCTGAGCCCCAGGAAGAGGCTGG + Intronic
1061924199 9:133798035-133798057 CCTGGGACTCAGGAAGAGCAGGG - Intronic
1062130249 9:134888669-134888691 CCTCGGACCCAGAGTGAGGAGGG - Intergenic
1062322386 9:135996766-135996788 CCTGAGCCCCACACAGAGGCTGG - Intergenic
1062437649 9:136553706-136553728 TCTGTGAGCCAGAAAGAGAACGG + Intergenic
1186792424 X:13011940-13011962 TCTGAGGCTCAGAAAGATGAAGG - Intergenic
1187605092 X:20874396-20874418 CGTGTGACCCACAAAGAGCAAGG + Intergenic
1188326405 X:28808035-28808057 CCTTGGACACAGAAAGAAGAAGG - Intronic
1188694916 X:33178256-33178278 CCTGACACCTGGAAAGAGGCTGG + Intronic
1189136727 X:38558379-38558401 CCAGAGTCTCAGAGAGAGGATGG - Intronic
1189296259 X:39920409-39920431 ACTGAGACCCAGACAGGGGAGGG + Intergenic
1189607405 X:42694631-42694653 CCTGAGGCCCTGAGTGAGGATGG + Intergenic
1189705550 X:43755780-43755802 CCTGAAACCCAGACTGAGGATGG - Intergenic
1190435446 X:50420011-50420033 ACTGAGACTCAGAAAGAGGTAGG - Intronic
1190744138 X:53311240-53311262 ACTGAGGCCCAGAGAGAGAAAGG - Intronic
1191841167 X:65514383-65514405 ACTGAGGCCCAGAAAGGGGAAGG - Intronic
1192005602 X:67208750-67208772 AATGAGGTCCAGAAAGAGGAAGG - Intergenic
1192145270 X:68678020-68678042 ACTGAGACCCAGAAAAGGGAAGG + Intronic
1192226755 X:69233983-69234005 ACTGAGGCCCAGAAAGGGAAAGG - Intergenic
1192342944 X:70279004-70279026 CCTGAGGCTCAGAGAGAAGAAGG + Intronic
1192543032 X:71991099-71991121 CACGAAGCCCAGAAAGAGGAAGG - Intergenic
1192559123 X:72113886-72113908 ACTGAGGGTCAGAAAGAGGAAGG - Intergenic
1193058065 X:77175709-77175731 ACTGAAACCCAGAAATGGGAAGG - Intergenic
1194594980 X:95846862-95846884 TCTGAAAGCCAGAAAGAGCAAGG - Intergenic
1195002055 X:100651340-100651362 TTTGAGAACCAGAAAGGGGAGGG + Intronic
1195284453 X:103370255-103370277 ACTGAGACCCAGAAAAATTAAGG - Intergenic
1195303545 X:103556163-103556185 AGTGAGACCCAGAAAATGGAAGG - Intergenic
1195431276 X:104792137-104792159 ACTGAGGTTCAGAAAGAGGAAGG + Intronic
1195745189 X:108110285-108110307 CCTTAAGCCCAGAAAGAGGAGGG + Intronic
1195898974 X:109777859-109777881 CCAGAGATCCAGACAGAGCATGG + Intergenic
1196143222 X:112288699-112288721 CCTGGGTCCCAGAATAAGGATGG - Intergenic
1196796847 X:119508749-119508771 CTAGAGACTCAGAAAGGGGAGGG - Intergenic
1197048661 X:122031291-122031313 TTAGAGACCCAGAAGGAGGAGGG - Intergenic
1197049652 X:122042906-122042928 CCTGAGATCCATAAAGGGCAGGG - Intergenic
1197297847 X:124740906-124740928 TCTGTGCCCCAGAGAGAGGAAGG + Intronic
1197353027 X:125400868-125400890 CCTGAGAGCCAGAGAGACAATGG + Intergenic
1198809176 X:140518147-140518169 AGTGAGATCCAGAGAGAGGAAGG - Intergenic
1199297284 X:146173563-146173585 ACTGATACCCAGAGAAAGGAAGG - Intergenic
1199701241 X:150377271-150377293 CGTGAGGCCCAGAGAGGGGAAGG - Intronic
1199710807 X:150467790-150467812 TCTGAGACCCAGAGAGGGGCAGG - Intronic
1199807273 X:151312751-151312773 ACTGAGGCCCAGAAAGGGTAAGG - Intergenic
1199880767 X:151973081-151973103 ACTGAGGCCCAGATAGAGGAAGG + Intronic
1199967373 X:152831313-152831335 ACTGAGACCCGGAGAGGGGAAGG + Intronic
1200249729 X:154546607-154546629 CCTGAGACCCCGAGAGCGAAGGG - Intronic
1201852215 Y:18497803-18497825 GCTCAGAACAAGAAAGAGGACGG + Intergenic
1201881106 Y:18822581-18822603 GCTCAGAACAAGAAAGAGGACGG - Intronic
1202170264 Y:22036025-22036047 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202221101 Y:22550348-22550370 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic
1202322011 Y:23645314-23645336 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202548756 Y:26024742-26024764 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic