ID: 1142047567

View in Genome Browser
Species Human (GRCh38)
Location 16:87935472-87935494
Sequence CAGTGTGTCCCGTGCGAACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 1, 2: 0, 3: 1, 4: 48}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142047564_1142047567 4 Left 1142047564 16:87935445-87935467 CCGCCGGGTCTGGATGGTGAGTC No data
Right 1142047567 16:87935472-87935494 CAGTGTGTCCCGTGCGAACACGG 0: 1
1: 1
2: 0
3: 1
4: 48
1142047561_1142047567 10 Left 1142047561 16:87935439-87935461 CCCATTCCGCCGGGTCTGGATGG 0: 1
1: 0
2: 0
3: 7
4: 47
Right 1142047567 16:87935472-87935494 CAGTGTGTCCCGTGCGAACACGG 0: 1
1: 1
2: 0
3: 1
4: 48
1142047565_1142047567 1 Left 1142047565 16:87935448-87935470 CCGGGTCTGGATGGTGAGTCGTG No data
Right 1142047567 16:87935472-87935494 CAGTGTGTCCCGTGCGAACACGG 0: 1
1: 1
2: 0
3: 1
4: 48
1142047563_1142047567 9 Left 1142047563 16:87935440-87935462 CCATTCCGCCGGGTCTGGATGGT 0: 2
1: 0
2: 0
3: 5
4: 46
Right 1142047567 16:87935472-87935494 CAGTGTGTCCCGTGCGAACACGG 0: 1
1: 1
2: 0
3: 1
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142047567 Original CRISPR CAGTGTGTCCCGTGCGAACA CGG Intronic
909342775 1:74550271-74550293 CTGTGTGACCTGTGCAAACATGG + Intergenic
913553030 1:119935585-119935607 CAGTGTGTCCCAGGCTATCAGGG - Exonic
917615726 1:176742062-176742084 CAGTATGTCCTATGGGAACAGGG - Intronic
922763351 1:228145614-228145636 CAGCGTGTCCCGTGAGTCCAGGG + Exonic
1063470686 10:6282409-6282431 CAGTGTGTCTGTTGGGAACATGG + Intergenic
1074741427 10:116488082-116488104 CTGTGTGTCCCTTGAGAATAGGG - Intergenic
1083965831 11:66043188-66043210 CAGCGTGTTGTGTGCGAACATGG + Exonic
1094836356 12:34323980-34324002 CAGTGTGTGTCGTGCCGACAGGG - Intergenic
1096908542 12:54959446-54959468 CAGTATTTCCTGTGAGAACATGG + Intronic
1097951169 12:65429614-65429636 CAGTGGGCCCAGTGGGAACATGG - Intronic
1103903121 12:124313792-124313814 CAGTGTGTCTCTTAAGAACAGGG + Intronic
1104425026 12:128669293-128669315 CAGTGTGTCTTGTACAAACAAGG + Intronic
1113412824 13:110105321-110105343 CAGTCTGTGCCCTGGGAACAGGG - Intergenic
1121102609 14:91260414-91260436 CAGTGTGTCCTGTGACTACAAGG + Intergenic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1134365179 16:13570627-13570649 CAGTGTGAACAGTGTGAACAAGG + Intergenic
1136448305 16:30337359-30337381 CAGTGTGTCCTGTGCGAACACGG - Intergenic
1139530719 16:67541471-67541493 CAGTGTCTCCTGTGAGACCAAGG + Exonic
1142047567 16:87935472-87935494 CAGTGTGTCCCGTGCGAACACGG + Intronic
1151324758 17:73372271-73372293 CAGTGTGCCCCATGGGAACCAGG - Intronic
1162099806 19:8333041-8333063 CAGTGTGTCCCACGGGAACCTGG - Exonic
927218488 2:20684169-20684191 CAGTGTCTCCAGTACAAACAAGG + Intronic
929780252 2:44952669-44952691 CAGTGTGTCCCGGGCGAGGTAGG - Intergenic
930356031 2:50321356-50321378 CAGTATGTCCCATTAGAACAAGG + Intronic
1170912862 20:20592299-20592321 CAGTATGTCCCGTGAGATCAAGG - Intronic
1174182045 20:48681089-48681111 CAGTGTGGCCCGCAGGAACATGG - Intronic
1174453860 20:50636247-50636269 CAGTTTGTCACCTGCGACCAAGG + Intronic
1175388809 20:58613761-58613783 CACTGTGTCCCGGGAGAACCAGG - Intergenic
1181887233 22:26031039-26031061 CAGTGTGTCGCATGCGTTCAGGG - Exonic
1182215316 22:28712138-28712160 CACTGTGTCCTCTGCAAACAGGG - Intronic
950461617 3:13125535-13125557 CAGTGTGGCGCTTGAGAACAAGG + Intergenic
951107538 3:18762462-18762484 CAGTCTGTCTCCTGAGAACACGG - Intergenic
954417747 3:50402197-50402219 AAATGTGTCCAGTGTGAACAGGG + Intronic
963792913 3:149602617-149602639 CAGTGTGGCCAGTGTAAACAAGG - Intronic
966226433 3:177603037-177603059 CATTGTTTCCAGTGCCAACAAGG - Intergenic
968840886 4:3004943-3004965 CAGTGTGCCTCGTGTGTACATGG - Intronic
968947083 4:3670778-3670800 CAGTGTGTCCGGAGCGTGCAGGG + Intergenic
969556051 4:7911046-7911068 CTGTGTGTCCCGTGCGTTTATGG - Intronic
971118880 4:23681537-23681559 CAGTGTGTCCAGTGGGTCCAAGG - Intergenic
993666138 5:90698898-90698920 CAGTGTGTCTCATACTAACATGG + Intronic
1001754221 5:174155614-174155636 GAGTGTGTCCCATGCATACATGG + Intronic
1019102682 6:169644321-169644343 CAGTGTGACTCGTGTGAACTAGG - Intronic
1023022203 7:36020243-36020265 CAGCTTGTCCCGGGCAAACAGGG - Intergenic
1023297897 7:38735679-38735701 CAGTATGTTCTGTGCTAACAGGG - Intronic
1032497758 7:132375579-132375601 CAGTGTGATCCATGCCAACATGG + Intronic
1045664788 8:104472542-104472564 CAGTGTGTCCCCTGAGAATCAGG - Intergenic
1048418292 8:134251064-134251086 CAGTGTGTCCATTGGGCACAAGG + Intergenic
1049416614 8:142498334-142498356 GAGTGTGCCCCGTGTTAACAGGG + Intronic
1051149624 9:14066335-14066357 CAGTTTTTCCTGTGTGAACATGG + Intergenic
1061923895 9:133796730-133796752 CAGTGTGGCCAGTGCAGACACGG - Intronic
1062167430 9:135114912-135114934 CACTGTGCCGCGTGCGAAGAGGG - Intronic