ID: 1142049499

View in Genome Browser
Species Human (GRCh38)
Location 16:87949077-87949099
Sequence GTTGAAGGCCACTGCTGACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142049499_1142049503 3 Left 1142049499 16:87949077-87949099 CCTAGTCAGCAGTGGCCTTCAAC No data
Right 1142049503 16:87949103-87949125 CCTCACTGTAGCTTGTTGGATGG No data
1142049499_1142049504 13 Left 1142049499 16:87949077-87949099 CCTAGTCAGCAGTGGCCTTCAAC No data
Right 1142049504 16:87949113-87949135 GCTTGTTGGATGGTCACAGATGG No data
1142049499_1142049501 -1 Left 1142049499 16:87949077-87949099 CCTAGTCAGCAGTGGCCTTCAAC No data
Right 1142049501 16:87949099-87949121 CAAACCTCACTGTAGCTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142049499 Original CRISPR GTTGAAGGCCACTGCTGACT AGG (reversed) Intergenic
No off target data available for this crispr