ID: 1142053825

View in Genome Browser
Species Human (GRCh38)
Location 16:87979206-87979228
Sequence CAATGTATGTAACACGTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 1, 2: 15, 3: 9, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142053824_1142053825 -1 Left 1142053824 16:87979184-87979206 CCTGTTAAGATCTTCGGAATGTC No data
Right 1142053825 16:87979206-87979228 CAATGTATGTAACACGTCTGAGG 0: 1
1: 1
2: 15
3: 9
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142053825 Original CRISPR CAATGTATGTAACACGTCTG AGG Intronic