ID: 1142053825

View in Genome Browser
Species Human (GRCh38)
Location 16:87979206-87979228
Sequence CAATGTATGTAACACGTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 1, 2: 15, 3: 9, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142053824_1142053825 -1 Left 1142053824 16:87979184-87979206 CCTGTTAAGATCTTCGGAATGTC No data
Right 1142053825 16:87979206-87979228 CAATGTATGTAACACGTCTGAGG 0: 1
1: 1
2: 15
3: 9
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142053825 Original CRISPR CAATGTATGTAACACGTCTG AGG Intronic
904920998 1:34008161-34008183 TAAAGTATGGAGCACGTCTGTGG - Intronic
918421818 1:184371901-184371923 CACTGTATGTAACTCCTTTGAGG - Intergenic
921995065 1:221409247-221409269 CAATGAATGTATCAAATCTGGGG - Intergenic
1065632379 10:27693731-27693753 CAATGAATGTAATACTTCTGGGG + Intronic
1077073973 11:691533-691555 CAATGTCTTCACCACGTCTGTGG - Exonic
1081135980 11:39441135-39441157 CAATGTATTAATGACGTCTGTGG - Intergenic
1087866421 11:103232948-103232970 CAATGTTTGTAATATGACTGAGG + Intronic
1092317552 12:7434189-7434211 GAATGTATTTAAAACATCTGAGG - Intronic
1099596837 12:84677598-84677620 AAATGAATGTAACTCATCTGTGG - Intergenic
1101182386 12:102233339-102233361 CAAGGCATGTAAGACGTCTGAGG + Intergenic
1106109476 13:26763672-26763694 CAATAAATGTCACACTTCTGAGG - Intergenic
1107962532 13:45571191-45571213 CAAAGTATGTCACAGGGCTGAGG - Intronic
1108992807 13:56684146-56684168 CAATGTGTGTAACATTTCTGAGG - Intergenic
1111290243 13:86157250-86157272 CAATGTAAGTAACAGATCAGTGG + Intergenic
1113765852 13:112880799-112880821 CCAGGTAAGTAACACGCCTGAGG + Intronic
1120699088 14:87678264-87678286 CAATGGATGAAACAAGCCTGTGG + Intergenic
1120753800 14:88222804-88222826 CAATGTGAGTGACAAGTCTGAGG + Intronic
1128479581 15:68025687-68025709 CACTCTATGTAATATGTCTGGGG - Intergenic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1129540726 15:76345744-76345766 CAATGTATACAACACATTTGGGG + Intergenic
1130337060 15:82965601-82965623 GAAGTTAGGTAACACGTCTGAGG - Intronic
1132296987 15:100745439-100745461 CAATGTATGTTACAACTCTAGGG - Intergenic
1134291572 16:12905927-12905949 CAACGTATGTAACTTTTCTGTGG + Intronic
1134447733 16:14343546-14343568 CAGTGTCTCCAACACGTCTGAGG + Intergenic
1136265029 16:29111231-29111253 CAATCTATGTAACACGTCTGAGG + Intergenic
1138075060 16:54034002-54034024 CTATGTAAGTATCACTTCTGAGG + Intronic
1142053825 16:87979206-87979228 CAATGTATGTAACACGTCTGAGG + Intronic
1143329312 17:6121810-6121832 CAATGTATGCTACACATCTTGGG + Exonic
1144559622 17:16311390-16311412 CAAGTTATATAACATGTCTGTGG - Intronic
1153741593 18:8135440-8135462 GAATCTATGTAACACTTTTGGGG - Intronic
1156074951 18:33263655-33263677 CTCTGTCTGTAACACGTTTGTGG - Intronic
1160700613 19:505206-505228 CAATGTATGTAAAAAGTACGTGG - Exonic
926170023 2:10547310-10547332 CAAGGTATGTAGCACACCTGGGG + Intergenic
935567067 2:104620383-104620405 CAATGGAAGTAACATGTCTTAGG - Intergenic
936861532 2:117026176-117026198 TAATTTCTGTAACAGGTCTGAGG + Intergenic
936869466 2:117117613-117117635 CAAGGTAAGTAAAACCTCTGGGG + Intergenic
939395259 2:141621126-141621148 CAATGTATGTAAAACATATGAGG - Intronic
942940688 2:181612110-181612132 GAATGTAAGTAACTTGTCTGTGG + Intronic
945891007 2:215431143-215431165 CTATGTATGTATCTAGTCTGTGG + Intronic
947822817 2:233083782-233083804 CCATTTATGCGACACGTCTGAGG - Intronic
1169313070 20:4564111-4564133 TAATGTATTTCACAGGTCTGAGG + Intergenic
1170620365 20:17990587-17990609 CAATGTATGAAACAAGTTTTAGG - Exonic
1180749208 22:18112590-18112612 CATTGTCAGAAACACGTCTGTGG - Intronic
951962679 3:28347365-28347387 AAATCTATGTAATACCTCTGAGG + Intronic
956904133 3:73748136-73748158 CAATGCAGTTAACACCTCTGTGG + Intergenic
956935065 3:74091006-74091028 CAATGTTTGGATCACTTCTGGGG + Intergenic
960856159 3:122104194-122104216 AAATGAATGTAAGACATCTGAGG - Intronic
970212825 4:13729037-13729059 CAATGGTTGTAACACTTCTGCGG - Intergenic
973142781 4:46789884-46789906 CAATGTAGGTGACACTTCTTAGG + Intronic
975585995 4:75949852-75949874 AAATGGATGTAGCACGCCTGTGG + Intronic
975609017 4:76185672-76185694 CAATTTATCAAACACCTCTGAGG - Intronic
977799302 4:101206754-101206776 CAATTTATTTAATACTTCTGTGG + Intronic
978433539 4:108658804-108658826 CATTGTCTGTAACACACCTGGGG + Intronic
978566976 4:110093779-110093801 CACTGTATGTATTACTTCTGTGG - Intronic
979921219 4:126498960-126498982 GAATATATGAAACATGTCTGGGG - Intergenic
984478155 4:180264053-180264075 AAATGTAAGTAAAATGTCTGTGG + Intergenic
986589265 5:9352077-9352099 TAATGAATGTAACAGGTCGGGGG + Intronic
993713437 5:91250649-91250671 CAATGTCTTTAAAACTTCTGAGG + Intergenic
996967898 5:129327502-129327524 TAATATATGTAACAAATCTGTGG - Intergenic
997446441 5:133943660-133943682 TAATGCATATAACACATCTGGGG + Intergenic
1004266082 6:14149757-14149779 CAATGTATGTAACTGTTCTTTGG + Intergenic
1004734176 6:18388383-18388405 CAATGTATCTAACATTTCTGAGG + Intronic
1007518942 6:42436525-42436547 CAATACATGTAAAACATCTGGGG - Intronic
1008127857 6:47689174-47689196 TAATGTATGTAACACTTTTTAGG - Intronic
1008618720 6:53250770-53250792 TAATTTATGTATCACTTCTGAGG - Intergenic
1009197743 6:60707485-60707507 CAATGTATTAGACACCTCTGGGG + Intergenic
1009478394 6:64124404-64124426 CAATATATTTAACACTTCTCAGG - Intronic
1013634520 6:112016416-112016438 CAATGTCTGTGACAGATCTGGGG + Intergenic
1014540235 6:122667146-122667168 CTATGTATGTAACAATACTGGGG + Intronic
1015062573 6:128984326-128984348 CAATATGTGTAACTCTTCTGAGG + Intronic
1017103715 6:150868666-150868688 CATTATATATAAAACGTCTGTGG - Intronic
1017192116 6:151665709-151665731 CATTGTATGTAAGTCATCTGAGG - Intronic
1018942215 6:168316264-168316286 CCATGTGTGTAACACGTCTGTGG + Intronic
1018942223 6:168316373-168316395 CCATGTGTGTAACACGTCTGTGG + Intronic
1018942232 6:168316485-168316507 TCACGTGTGTAACACGTCTGTGG + Intronic
1018942241 6:168316594-168316616 CCATGTGTGTAACACGTCTGTGG + Intronic
1018942250 6:168316703-168316725 CCATGTGTGTAACACGTCTGTGG + Intronic
1018942259 6:168316812-168316834 CCATGTGTGTAACACGTCTGTGG + Intronic
1018942268 6:168316921-168316943 CCATGTGTGTAACACGTCTGTGG + Intronic
1018942277 6:168317030-168317052 CCATGTGTGTAACACGTCTGTGG + Intronic
1018942286 6:168317139-168317161 CCATGTGTGTAACACGTCTGTGG + Intronic
1018942295 6:168317248-168317270 CCATGTGTGTAACACGTCTGTGG + Intronic
1018942304 6:168317357-168317379 CCATGTGTGTAACACGTCTGTGG + Intronic
1018942312 6:168317466-168317488 CCATGTGTGTAACACGTCTGTGG + Intronic
1018942319 6:168317543-168317565 CCATGTGTGTAACACGTCTGTGG + Intronic
1018942328 6:168317652-168317674 CCATGTGTGTAACACGTCTGTGG + Intronic
1018942337 6:168317761-168317783 CCATGTGTGTAACACGTCTGTGG + Intronic
1018942346 6:168317870-168317892 CCATGTGTGTAACACGTCTGTGG + Intronic
1018942355 6:168317984-168318006 ACATGTGTGTAACACGTCTGTGG + Intronic
1018942363 6:168318095-168318117 ACATATGTGTAACACGTCTGTGG + Intronic
1021965027 7:25909132-25909154 CAATGTAAATAACACATCTTTGG - Intergenic
1022284578 7:28943231-28943253 CAATTTATGTAACACATGTATGG - Intergenic
1022603626 7:31786206-31786228 CAATCTATATAAAACGTCAGTGG - Intronic
1025265976 7:57457278-57457300 CACTGTCTGTAGCACGTCTGTGG + Intronic
1027436939 7:78174444-78174466 CAATTTTTGTATCACTTCTGTGG - Intronic
1032342125 7:131083862-131083884 AAATGTATAAAACACATCTGAGG + Intergenic
1035649224 8:1252580-1252602 CAATTGATGTAACACAACTGTGG - Intergenic
1035858180 8:2999525-2999547 AAATGTATGCAACACGGATGAGG + Intronic
1036080305 8:5548013-5548035 AAATGAATGTAACAAGTCTGGGG - Intergenic
1036748719 8:11429504-11429526 CAATCTATGTCAAACGTGTGCGG - Intronic
1036908769 8:12733322-12733344 CAATAAATGTAACATTTCTGGGG + Intronic
1040422820 8:47256291-47256313 CAAGTTATATAACATGTCTGTGG + Intergenic
1052583987 9:30400676-30400698 CAATTTATATAACCAGTCTGAGG - Intergenic
1052673809 9:31593593-31593615 CAATTTATGTAACAAGCCTAAGG - Intergenic
1056622925 9:88229163-88229185 CCCTGTATGTAACAAGCCTGTGG + Intergenic
1057281466 9:93715056-93715078 CAATGTTTGTAAAAGGTATGAGG + Intergenic
1190786407 X:53654432-53654454 CAATGTTTGCAACACATCTCAGG + Intronic
1192794001 X:74411888-74411910 CAAGTTATATAACATGTCTGTGG - Intergenic
1195228288 X:102820520-102820542 GGAAGTATGTAACACATCTGAGG - Intergenic
1199477486 X:148261104-148261126 AAATGTATTTAACCCCTCTGTGG + Intergenic