ID: 1142054583

View in Genome Browser
Species Human (GRCh38)
Location 16:87985103-87985125
Sequence ACCAGCACACACGGGCAGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142054583_1142054594 17 Left 1142054583 16:87985103-87985125 CCTCGCTGCCCGTGTGTGCTGGT No data
Right 1142054594 16:87985143-87985165 GTGCTTTGTGGGCCTCGCCAGGG No data
1142054583_1142054589 -10 Left 1142054583 16:87985103-87985125 CCTCGCTGCCCGTGTGTGCTGGT No data
Right 1142054589 16:87985116-87985138 GTGTGCTGGTGGCTGGCGCTGGG 0: 1
1: 1
2: 1
3: 27
4: 297
1142054583_1142054596 19 Left 1142054583 16:87985103-87985125 CCTCGCTGCCCGTGTGTGCTGGT No data
Right 1142054596 16:87985145-87985167 GCTTTGTGGGCCTCGCCAGGGGG No data
1142054583_1142054591 5 Left 1142054583 16:87985103-87985125 CCTCGCTGCCCGTGTGTGCTGGT No data
Right 1142054591 16:87985131-87985153 GCGCTGGGTTAGGTGCTTTGTGG 0: 1
1: 1
2: 0
3: 10
4: 128
1142054583_1142054598 25 Left 1142054583 16:87985103-87985125 CCTCGCTGCCCGTGTGTGCTGGT No data
Right 1142054598 16:87985151-87985173 TGGGCCTCGCCAGGGGGTGTGGG 0: 1
1: 0
2: 1
3: 17
4: 223
1142054583_1142054592 6 Left 1142054583 16:87985103-87985125 CCTCGCTGCCCGTGTGTGCTGGT No data
Right 1142054592 16:87985132-87985154 CGCTGGGTTAGGTGCTTTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 88
1142054583_1142054593 16 Left 1142054583 16:87985103-87985125 CCTCGCTGCCCGTGTGTGCTGGT No data
Right 1142054593 16:87985142-87985164 GGTGCTTTGTGGGCCTCGCCAGG No data
1142054583_1142054597 24 Left 1142054583 16:87985103-87985125 CCTCGCTGCCCGTGTGTGCTGGT No data
Right 1142054597 16:87985150-87985172 GTGGGCCTCGCCAGGGGGTGTGG 0: 1
1: 0
2: 2
3: 25
4: 331
1142054583_1142054590 -5 Left 1142054583 16:87985103-87985125 CCTCGCTGCCCGTGTGTGCTGGT No data
Right 1142054590 16:87985121-87985143 CTGGTGGCTGGCGCTGGGTTAGG 0: 1
1: 1
2: 0
3: 39
4: 359
1142054583_1142054595 18 Left 1142054583 16:87985103-87985125 CCTCGCTGCCCGTGTGTGCTGGT No data
Right 1142054595 16:87985144-87985166 TGCTTTGTGGGCCTCGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142054583 Original CRISPR ACCAGCACACACGGGCAGCG AGG (reversed) Intronic
No off target data available for this crispr