ID: 1142054586

View in Genome Browser
Species Human (GRCh38)
Location 16:87985111-87985133
Sequence CGCCAGCCACCAGCACACAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 245}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142054586_1142054594 9 Left 1142054586 16:87985111-87985133 CCCGTGTGTGCTGGTGGCTGGCG 0: 1
1: 0
2: 1
3: 27
4: 245
Right 1142054594 16:87985143-87985165 GTGCTTTGTGGGCCTCGCCAGGG No data
1142054586_1142054603 27 Left 1142054586 16:87985111-87985133 CCCGTGTGTGCTGGTGGCTGGCG 0: 1
1: 0
2: 1
3: 27
4: 245
Right 1142054603 16:87985161-87985183 CAGGGGGTGTGGGAAGTCTGGGG 0: 1
1: 1
2: 3
3: 43
4: 404
1142054586_1142054600 25 Left 1142054586 16:87985111-87985133 CCCGTGTGTGCTGGTGGCTGGCG 0: 1
1: 0
2: 1
3: 27
4: 245
Right 1142054600 16:87985159-87985181 GCCAGGGGGTGTGGGAAGTCTGG 0: 1
1: 2
2: 4
3: 46
4: 508
1142054586_1142054595 10 Left 1142054586 16:87985111-87985133 CCCGTGTGTGCTGGTGGCTGGCG 0: 1
1: 0
2: 1
3: 27
4: 245
Right 1142054595 16:87985144-87985166 TGCTTTGTGGGCCTCGCCAGGGG No data
1142054586_1142054597 16 Left 1142054586 16:87985111-87985133 CCCGTGTGTGCTGGTGGCTGGCG 0: 1
1: 0
2: 1
3: 27
4: 245
Right 1142054597 16:87985150-87985172 GTGGGCCTCGCCAGGGGGTGTGG 0: 1
1: 0
2: 2
3: 25
4: 331
1142054586_1142054593 8 Left 1142054586 16:87985111-87985133 CCCGTGTGTGCTGGTGGCTGGCG 0: 1
1: 0
2: 1
3: 27
4: 245
Right 1142054593 16:87985142-87985164 GGTGCTTTGTGGGCCTCGCCAGG No data
1142054586_1142054602 26 Left 1142054586 16:87985111-87985133 CCCGTGTGTGCTGGTGGCTGGCG 0: 1
1: 0
2: 1
3: 27
4: 245
Right 1142054602 16:87985160-87985182 CCAGGGGGTGTGGGAAGTCTGGG No data
1142054586_1142054596 11 Left 1142054586 16:87985111-87985133 CCCGTGTGTGCTGGTGGCTGGCG 0: 1
1: 0
2: 1
3: 27
4: 245
Right 1142054596 16:87985145-87985167 GCTTTGTGGGCCTCGCCAGGGGG No data
1142054586_1142054592 -2 Left 1142054586 16:87985111-87985133 CCCGTGTGTGCTGGTGGCTGGCG 0: 1
1: 0
2: 1
3: 27
4: 245
Right 1142054592 16:87985132-87985154 CGCTGGGTTAGGTGCTTTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 88
1142054586_1142054591 -3 Left 1142054586 16:87985111-87985133 CCCGTGTGTGCTGGTGGCTGGCG 0: 1
1: 0
2: 1
3: 27
4: 245
Right 1142054591 16:87985131-87985153 GCGCTGGGTTAGGTGCTTTGTGG 0: 1
1: 1
2: 0
3: 10
4: 128
1142054586_1142054604 28 Left 1142054586 16:87985111-87985133 CCCGTGTGTGCTGGTGGCTGGCG 0: 1
1: 0
2: 1
3: 27
4: 245
Right 1142054604 16:87985162-87985184 AGGGGGTGTGGGAAGTCTGGGGG 0: 1
1: 1
2: 2
3: 47
4: 476
1142054586_1142054598 17 Left 1142054586 16:87985111-87985133 CCCGTGTGTGCTGGTGGCTGGCG 0: 1
1: 0
2: 1
3: 27
4: 245
Right 1142054598 16:87985151-87985173 TGGGCCTCGCCAGGGGGTGTGGG 0: 1
1: 0
2: 1
3: 17
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142054586 Original CRISPR CGCCAGCCACCAGCACACAC GGG (reversed) Intronic
900206566 1:1434269-1434291 CCCCAGCCCCCAGTACACAGGGG - Intergenic
900361901 1:2293153-2293175 CCCCAACCCCCAGCTCACACTGG - Intronic
900430743 1:2602026-2602048 TGCCTGCCACAGGCACACACAGG + Intronic
900457826 1:2785969-2785991 CGCCTGCCTCCAGCCCACCCTGG - Exonic
900623707 1:3598752-3598774 CTGCAGCCACCAGCTCACAGTGG + Intronic
900928828 1:5723001-5723023 AGCCAGCCATAAGCACACACTGG + Intergenic
902211003 1:14904558-14904580 CTCCAGGCAGCAGCACAGACAGG + Intronic
903069930 1:20722050-20722072 CACCAGCCACCCGCTCCCACAGG + Intronic
904475165 1:30760173-30760195 CACCAGGCTCCAGCACACACTGG + Intergenic
908605631 1:65793685-65793707 CCCCAGCCACCAGGGCACGCAGG - Intronic
910085193 1:83393551-83393573 AGCCAGCCACCCACACACATGGG + Intergenic
911099725 1:94085699-94085721 AGCCAGGCACCAGCTCACAGAGG - Intronic
913962222 1:143349217-143349239 TGCCAGCAACCAGCAGAAACTGG + Intergenic
914056578 1:144174791-144174813 TGCCAGCAACCAGCAGAAACTGG + Intergenic
914122568 1:144791571-144791593 TGCCAGCAACCAGCAGAAACTGG - Intergenic
915022021 1:152787976-152787998 CAGCAGCCACCAGCAGACACAGG - Exonic
915022982 1:152798459-152798481 CAGCAGCCACCAGCAGACACAGG - Intronic
917554229 1:176067468-176067490 TGACAGGCACCAGCAGACACCGG + Intronic
918011042 1:180586781-180586803 CTCCAGCCACCTGCCCCCACGGG - Intergenic
919817065 1:201448311-201448333 CGGCAGCTCCCAGCACACACAGG + Intergenic
919912154 1:202118236-202118258 CTCCAGCCAAGAGCACACTCTGG - Intergenic
919924120 1:202183472-202183494 CTCCTGCCCCCAGCACTCACAGG - Intergenic
921732709 1:218595504-218595526 CGCCACACACCAGCAAAGACAGG - Intergenic
922538358 1:226400392-226400414 CACCACACATCAGCACACACCGG + Intronic
1062808502 10:443617-443639 CGGGAGCCACCAGCTCATACTGG + Intronic
1062841651 10:678023-678045 GCCCAGCCTCCTGCACACACTGG + Intronic
1065856023 10:29830968-29830990 CTCCAGTCACCAGCACACTCAGG + Intergenic
1065860367 10:29867433-29867455 CTCCAGTCACCAGCACATGCAGG - Intergenic
1073044741 10:100630244-100630266 CGCCAGACACACACACACACAGG - Intergenic
1073540748 10:104314912-104314934 CCCCAGCCTCCAGCACAGACTGG - Exonic
1074096487 10:110318033-110318055 CGACAGACACCAGCAGACGCTGG + Intergenic
1074108661 10:110407482-110407504 AGTCAGGCACCATCACACACTGG - Intergenic
1075847444 10:125556059-125556081 CGCCAGCCATTTGCACTCACAGG + Intergenic
1076047718 10:127307955-127307977 AGCCAGCCACCAGCCCACAGGGG - Intronic
1076471037 10:130718459-130718481 CTCCAGCCATCAGCACCCAAAGG - Intergenic
1076657588 10:132035312-132035334 CACCAGACATGAGCACACACAGG + Intergenic
1076768375 10:132650019-132650041 CAGTAGCCACCAGCACACACAGG - Intronic
1077332329 11:1989114-1989136 TGCCTGCCACCACGACACACCGG - Intergenic
1077507992 11:2941022-2941044 CCCCACCCACCAGGAGACACTGG - Intergenic
1077535916 11:3124008-3124030 GACCAGCCACCAGCACGCAGAGG + Intronic
1077554045 11:3217550-3217572 AGCCAGCCACCAGCCCACAGTGG - Intergenic
1081700644 11:45150475-45150497 CCCCAGCCCTCAGCACACAGTGG - Intronic
1084331108 11:68431199-68431221 CTACAGACAGCAGCACACACTGG + Intronic
1084613006 11:70215937-70215959 CGCCACACACCAGCAAAGACAGG - Intergenic
1085134967 11:74078442-74078464 GGCCAGCAAGCAGCACACAATGG + Exonic
1085197636 11:74682107-74682129 AGCCAGCCATCTGCAGACACAGG + Intergenic
1085528437 11:77177368-77177390 CCACAGCCACCAGGACAGACAGG - Intronic
1089806898 11:121098461-121098483 TGCAAAGCACCAGCACACACTGG - Intergenic
1090407582 11:126486349-126486371 AGCCACCCAGCACCACACACTGG - Intronic
1202815311 11_KI270721v1_random:44290-44312 TGCCTGCCACCACGACACACCGG - Intergenic
1094361717 12:29638298-29638320 CGACAGACCCCAGCAGACACTGG + Intronic
1095559999 12:43552669-43552691 CGGCAACTCCCAGCACACACAGG - Intergenic
1098029197 12:66236877-66236899 CTCCAGCCACCTGCCCACTCTGG + Intronic
1099055410 12:77833914-77833936 CGACAGGCACCTGCAGACACCGG - Intronic
1100245267 12:92751342-92751364 GGCCAGCCACCTGTACACAGGGG + Intronic
1101100358 12:101385319-101385341 CTCCAGCCACCACCTCACCCAGG - Intronic
1101853906 12:108426404-108426426 CTGAAGCCACCAGCACACTCGGG - Intergenic
1103446891 12:121000530-121000552 TGCCAGCCCCCCGCAGACACGGG - Intronic
1104005011 12:124885676-124885698 AGCCAGGCACCACCACACCCAGG - Intergenic
1105900273 13:24746837-24746859 CGAAAGCCAACAGCACCCACTGG - Intergenic
1110385608 13:74907001-74907023 GGACAGACACCAGCAGACACTGG - Intergenic
1110459942 13:75733901-75733923 AGCCAGCAAACAGCGCACACAGG - Intronic
1110484290 13:76019896-76019918 CGACAGGCACCAGCAGACGCCGG - Intergenic
1113778441 13:112962399-112962421 CGCAACCCACCAGCACATGCAGG - Intronic
1113925700 13:113940311-113940333 AGCCAGCCTGCAGCACACACTGG + Intergenic
1113931648 13:113971953-113971975 CCCCAGGCACCAGCACCCTCAGG - Intergenic
1114591294 14:23867057-23867079 AACCAGCCACCAGAACCCACAGG - Intergenic
1116682640 14:47994156-47994178 CCCCAGCACCAAGCACACACAGG + Intergenic
1117108062 14:52419135-52419157 CTGCAGCAACCATCACACACAGG + Intergenic
1118331955 14:64822097-64822119 CACCAGTCAGCAGCCCACACTGG - Intronic
1121634283 14:95443199-95443221 CCCCAACCACCAGCACAAAATGG - Exonic
1122120253 14:99549462-99549484 AGCCACCCACCAGCACACAGAGG + Intronic
1122235619 14:100329369-100329391 CCCCGGCCACCAGCACGCCCGGG - Exonic
1122805967 14:104257142-104257164 CCCCAGCCACCGGCACAGCCTGG - Intergenic
1123043395 14:105499704-105499726 CGCCCCCCACCAGCAGACACAGG + Intergenic
1123081811 14:105699134-105699156 AGCCACCCTACAGCACACACAGG - Intergenic
1123474970 15:20582811-20582833 CGGCTGCTACCTGCACACACAGG + Intergenic
1123643041 15:22417546-22417568 CGGCTGCTACCTGCACACACAGG - Intergenic
1123984241 15:25630885-25630907 CACCTGCCACCAGCACTCCCTGG - Intergenic
1124405245 15:29385921-29385943 CAACAGACACCAGCAGACACTGG + Intronic
1127027657 15:54825133-54825155 TGACAGACACCAGCAGACACTGG - Intergenic
1127211892 15:56781986-56782008 AGCCAGCCAGCAGCCCACAATGG + Intronic
1127962388 15:63899342-63899364 TGCCAGGCACCAGCACACTGTGG + Intergenic
1129343329 15:74900503-74900525 AGCCACCTCCCAGCACACACTGG + Exonic
1130923104 15:88365571-88365593 TGCAAGCCTCCAGGACACACTGG + Intergenic
1132110196 15:99097228-99097250 CCTGAGCCACCAGAACACACTGG + Intergenic
1132681553 16:1144524-1144546 CGCCAGCCTCCAGGACACAATGG + Intergenic
1133270398 16:4608502-4608524 GCCCGGCCTCCAGCACACACTGG - Intergenic
1134609147 16:15593884-15593906 CCCCTGCCACCAGCACCCTCTGG - Intronic
1135855246 16:26003868-26003890 CACCAGGCACCAGCACACAGGGG - Intronic
1136022095 16:27446817-27446839 CACCACCCGCCAGCACCCACAGG + Intronic
1136265776 16:29117204-29117226 CACCAGCCACCAGCACACATGGG - Intergenic
1137619180 16:49865248-49865270 TTCCAGTCACCAGCACTCACTGG - Intergenic
1137837357 16:51605621-51605643 AGCCAGCCAGCATCACATACTGG - Intergenic
1138073332 16:54015826-54015848 GGACAGCCTCCAGCAAACACAGG + Intronic
1140218264 16:73025269-73025291 CGGCAGCCACCAGCCCATGCAGG + Intronic
1141064304 16:80901509-80901531 TGCCAGCCACCACCAGACACTGG + Intergenic
1141604959 16:85147363-85147385 GGTCAGCCACCAGCCCAGACTGG - Intergenic
1141646520 16:85370743-85370765 AGTCATCCAGCAGCACACACTGG - Intergenic
1141677223 16:85524162-85524184 AGCCAGCCACCTGCAGCCACAGG - Intergenic
1141772833 16:86101438-86101460 GGCCAGGAAGCAGCACACACAGG + Intergenic
1142054586 16:87985111-87985133 CGCCAGCCACCAGCACACACGGG - Intronic
1143107020 17:4535041-4535063 TGCAAGCAACCAGCACCCACGGG - Intronic
1143153042 17:4818821-4818843 CCCCAGCCCCCAGCACTCACTGG - Exonic
1144320869 17:14118062-14118084 CGACAGACACCAGCAGACACTGG - Intronic
1150461823 17:65360094-65360116 CACCTGCCACCAGCCCAGACAGG - Intergenic
1151389884 17:73779171-73779193 CGCCAGCAACCACCTCACTCAGG + Intergenic
1151667106 17:75551259-75551281 GGCCACCCTGCAGCACACACAGG - Intronic
1151958187 17:77391071-77391093 CATCAGCCATCAGCTCACACAGG - Intronic
1152025213 17:77804567-77804589 CGCCACCCACACACACACACCGG + Intergenic
1152193683 17:78903654-78903676 CGTCAACCACCTGCCCACACAGG + Intronic
1152636396 17:81432284-81432306 CACCAGCCAGCCCCACACACAGG - Intronic
1152657540 17:81527044-81527066 TGCCAGGCACCTGCAGACACAGG - Intergenic
1153567497 18:6433244-6433266 AGGCACCCACCACCACACACAGG + Intergenic
1153922332 18:9803060-9803082 CACCAGCCAGCAGCACAGCCCGG + Intronic
1156439290 18:37167581-37167603 CAACAGGCACCAGCAGACACTGG - Intronic
1160015792 18:75139488-75139510 CCTCAGCCATCAGCACACACTGG + Intergenic
1160549041 18:79681295-79681317 CCCCACCCACCAGCACGCAGGGG - Intronic
1160744576 19:704563-704585 CTCCCGACTCCAGCACACACAGG - Intergenic
1161232595 19:3182093-3182115 CGCCGGCCACCAGCAGGAACTGG - Intergenic
1161968353 19:7561407-7561429 AGCCAGCACCCAGCACACACAGG - Intronic
1162375657 19:10303765-10303787 CACAGGCCACCAGCACTCACAGG - Intergenic
1163124532 19:15237887-15237909 CGCCCGCCTCCAGCCCACGCAGG + Exonic
1163124597 19:15238153-15238175 CGCCACCCACCACCCCTCACAGG - Exonic
1163328312 19:16619509-16619531 GGGCAGCCCCCTGCACACACTGG - Intronic
1164457296 19:28419367-28419389 CGCCTGCCACCAACCCACGCTGG - Intergenic
1165029187 19:32985143-32985165 CGCCCGCCACCACCACGCCCAGG + Intronic
1166115903 19:40654245-40654267 AGCCATCCACAAGCACACACTGG + Intergenic
1166716641 19:44972851-44972873 TGCCAGCTACCCCCACACACTGG + Intronic
1167431762 19:49459208-49459230 CGACTGCCTCCAGCACATACTGG - Intronic
1202696059 1_KI270712v1_random:127476-127498 TGCCAGCAACCAGCAGAAACTGG + Intergenic
925011705 2:490417-490439 CGTCAGCCACCAGCACCGCCAGG + Intergenic
925020550 2:564592-564614 CGCCAGGCCCCAGCTCACCCTGG - Intergenic
925092492 2:1166843-1166865 TGACAGGCACCAGCAGACACTGG + Intronic
925273956 2:2635991-2636013 CGCCAGCCCCCAGCACCGGCAGG - Intergenic
925529648 2:4845115-4845137 TGCCAGCCAGCAGCAAACCCGGG - Intergenic
927865109 2:26583170-26583192 CCCCACCAACCAGTACACACAGG + Intronic
928033043 2:27797671-27797693 CTCCTGCCACAAGCACACAGAGG - Intronic
928703339 2:33921532-33921554 CCCGAGCTACCAGCACACATAGG + Intergenic
932304512 2:70692414-70692436 CATCATCCACCTGCACACACCGG - Exonic
932407130 2:71520871-71520893 CCCCAGGCCCCAGCACACAAAGG - Exonic
933163988 2:79055382-79055404 CGCCACACACCAGCAAAGACAGG + Intergenic
933759016 2:85661750-85661772 CCCACCCCACCAGCACACACTGG + Intronic
933900568 2:86846729-86846751 CGCCAGCCACCAGCAGGCCAAGG + Exonic
935598196 2:104896304-104896326 CCCCAGCCACCTGCACCCCCAGG + Intergenic
935779980 2:106502496-106502518 CGCCAGCCACCAGCAGGCCAAGG - Intergenic
936284476 2:111171621-111171643 CCCCAGCCACCAGCACCCCGGGG + Intergenic
937988857 2:127651197-127651219 CCACAGCCACCACCACCCACAGG - Exonic
939602772 2:144213904-144213926 CTCCACCCACCAACACACCCAGG + Intronic
941779279 2:169426922-169426944 GGCCATCTACCAGGACACACTGG + Intergenic
945649106 2:212537947-212537969 CGGTCGCCAGCAGCACACACAGG + Intronic
946338763 2:219055518-219055540 CCCCAGCCACCAGCACGTACTGG + Exonic
947968584 2:234302754-234302776 GGCCAGATCCCAGCACACACTGG - Intergenic
948726661 2:239938390-239938412 GGGCAGCCACCGACACACACGGG + Intronic
948971226 2:241428799-241428821 CGCCAGCCCCCAGCAACCACTGG + Intronic
949057531 2:241936679-241936701 CTCCAGCCACCTGCGCTCACCGG + Intergenic
1169197043 20:3688946-3688968 AGCCAGCCGCCAGCTGACACAGG + Intronic
1171055287 20:21900643-21900665 CAGCAGCGAACAGCACACACAGG + Intergenic
1171174276 20:23039759-23039781 CATCAGCCAGCAGCACACCCTGG + Intergenic
1171462173 20:25304273-25304295 CTCCTGCCAGCAGCACAGACAGG - Intronic
1172643230 20:36454511-36454533 AGACAAACACCAGCACACACAGG + Intronic
1172935295 20:38615875-38615897 CCCCAGCCACCTTCAGACACAGG - Intronic
1173781987 20:45763668-45763690 CGCCACACACCAGCAAAGACAGG + Intronic
1174200870 20:48805584-48805606 GGGCAGCCAGCACCACACACAGG + Intronic
1174267634 20:49343514-49343536 CGCCCCAGACCAGCACACACAGG - Intergenic
1174590778 20:51642959-51642981 CCCCAGCCCCCAGCCCCCACAGG + Intronic
1175776117 20:61654804-61654826 CTCCATGCACCAGCACAGACTGG + Intronic
1175865836 20:62175960-62175982 GACCAGCGCCCAGCACACACTGG - Intronic
1176240596 20:64074118-64074140 CGCCAGACACCAGAACAGGCCGG - Intronic
1177042868 21:16134347-16134369 AGCCAGCCACCAAAACACAATGG + Intergenic
1178704834 21:34864573-34864595 CGACTTCCAGCAGCACACACAGG - Intronic
1180035572 21:45246426-45246448 TAACAGCCACCAGCACCCACAGG + Intergenic
1182106511 22:27693721-27693743 CCCCAGCAACCAGCACCCGCAGG + Intergenic
1182426006 22:30273059-30273081 CCCCAGCCCCCAGCAGCCACTGG - Intergenic
1182520121 22:30880426-30880448 CTCCAGCCATTAGCACACACAGG - Intronic
1183193243 22:36335390-36335412 TGCCAGCCGTCAGCACACAAAGG - Intronic
1183521566 22:38298699-38298721 CTCCCGCCACCAGCTCACTCTGG + Intronic
1184916095 22:47569980-47570002 CGCCAGCCTCCAGCCACCACTGG - Intergenic
951576697 3:24121801-24121823 CTCCAGCCATCAGGACACAAAGG + Exonic
954708697 3:52494511-52494533 CACCAGCCACCAGCTGACATTGG - Intergenic
955343543 3:58143944-58143966 CCCAAGCCTCCAGCCCACACAGG - Intronic
956287848 3:67629339-67629361 GGCAGGCCACCTGCACACACAGG + Intronic
957029302 3:75221539-75221561 GGACAGACACCAGCAGACACCGG - Intergenic
958970970 3:100609880-100609902 CGACAGCCACCAGCACCCTAAGG - Exonic
960501635 3:118445187-118445209 TGACAGACACCAGCAGACACTGG - Intergenic
960606735 3:119513675-119513697 CACCAGCCACCAGGCCACGCAGG - Exonic
962979041 3:140471204-140471226 GCCCAGCTGCCAGCACACACAGG + Intronic
964340514 3:155704303-155704325 CGGCAGCCACACGCTCACACTGG + Intronic
967829473 3:193906345-193906367 CCCCAGCCATCAGCACAAGCGGG + Intergenic
968621431 4:1605041-1605063 CTCCCGCCACCTGCAGACACCGG + Intergenic
968648236 4:1750297-1750319 AGGCAGCCCCCAGCCCACACAGG - Intergenic
968812913 4:2808204-2808226 CGCCGGCCACCAGCAGAAGCTGG - Intronic
968946946 4:3669833-3669855 CGCCAGCCACACACTCACACCGG - Intergenic
969461884 4:7333382-7333404 CACCGGCCAACATCACACACGGG - Intronic
969488672 4:7486372-7486394 TTCCAGCCTCCACCACACACGGG + Intronic
978400099 4:108322031-108322053 CTCCATCCACCACCACTCACAGG - Intergenic
983066767 4:163219321-163219343 CGCCAGCATCCAACACACAGAGG + Intergenic
984701647 4:182822318-182822340 CGCACGCCAGCAGCACACATCGG + Intergenic
984943159 4:184951837-184951859 CACCAGGCACCAACACGCACGGG - Intergenic
985838258 5:2286645-2286667 TTCCAGCCACCACCACACCCTGG + Intergenic
985923573 5:2998494-2998516 CATCTGCCTCCAGCACACACAGG + Intergenic
986811505 5:11364716-11364738 CCTCTGCCGCCAGCACACACCGG - Exonic
987090167 5:14503287-14503309 CTCCAGCCAGCAGCACCCTCTGG + Intronic
987121207 5:14769005-14769027 CCCCTGCCACCACCATACACAGG + Exonic
988805925 5:34740622-34740644 CCCCAGCCCCCAGAAGACACAGG - Intronic
992626375 5:78639114-78639136 CCCCAGCCACCTGTCCACACAGG + Intronic
992904596 5:81333983-81334005 TGCCAGACACCAGCAGACGCTGG + Intronic
995861414 5:116644709-116644731 CGAGAGCCTCCAGCACTCACTGG + Intergenic
996202995 5:120699292-120699314 CGCCACACACCAGCAAAGACAGG - Intergenic
996566792 5:124888346-124888368 CCCCGGCCCCCAGCAGACACAGG + Intergenic
996703164 5:126470164-126470186 GGCCAGCCAACTGCACACAGAGG + Intronic
998446977 5:142205992-142206014 AGCCAGACGGCAGCACACACAGG + Intergenic
1000318932 5:160118776-160118798 CGCCCGCCCCCAGCACCCTCCGG - Intronic
1002196483 5:177504252-177504274 GGCTGGCCTCCAGCACACACAGG + Exonic
1004925760 6:20413633-20413655 CGCCAGGCACCAGCACCAGCTGG + Intronic
1006137098 6:31901897-31901919 CGGCAGCGACCCCCACACACGGG + Exonic
1006670663 6:35728040-35728062 CGCAAGCCGCGAGCACAAACAGG + Intronic
1007366317 6:41396568-41396590 CGCCAGCCACCAGGAATCTCGGG + Intergenic
1010249190 6:73691097-73691119 CCCCGGCCACCAGAACCCACAGG + Intergenic
1016788295 6:148037472-148037494 TCCCAGCCCCCAGGACACACTGG - Intergenic
1018039520 6:159909680-159909702 GGCCAGCACACAGCACACACAGG - Exonic
1019383204 7:739048-739070 AGCCAGCCCCCAGCCCAAACAGG - Intronic
1019383219 7:739117-739139 AGCCAGCCCCCAGCCCAAACAGG - Intronic
1019383234 7:739186-739208 AGCCAGCCCCCAGCCCAAACAGG - Intronic
1019712900 7:2525474-2525496 GGCCAGCTACCCGCACACGCGGG + Exonic
1020119595 7:5495600-5495622 CGCCAGCCACCTGCTGCCACTGG - Intronic
1021809286 7:24387488-24387510 CTGCAGCCACCATCAAACACTGG - Intergenic
1021820736 7:24495074-24495096 CAGCAGACACCAGCAGACACCGG - Intergenic
1022911651 7:34904672-34904694 ACCAAGACACCAGCACACACTGG + Intergenic
1024326940 7:48116238-48116260 CACCAGTGACCAGCCCACACAGG - Intergenic
1024326957 7:48116322-48116344 CACCAGTGACCAGCCCACACAGG - Intergenic
1024326998 7:48116537-48116559 CACCAGTGACCAGCCCACACAGG - Intergenic
1024327025 7:48116666-48116688 CACCAGTGACCAGCCCACACAGG - Intergenic
1025004900 7:55345623-55345645 CGCCAGCCCCCAGGGCCCACTGG + Intergenic
1026441303 7:70446735-70446757 CGCCTGCCTGAAGCACACACTGG - Intronic
1027302067 7:76850017-76850039 AGCCAGCCACCCACACACATGGG + Intergenic
1029147747 7:98458720-98458742 CGCCAGCTCCCAGCCCATACAGG - Intergenic
1029544110 7:101201353-101201375 CGCCATGCACAAACACACACAGG + Intergenic
1032281600 7:130507435-130507457 CCCCAGCTCCCAGCATACACTGG - Intronic
1033266999 7:139895267-139895289 GGCCAGTCATCATCACACACTGG + Intronic
1033635742 7:143209881-143209903 TGACAGACACCAGCAGACACCGG - Intergenic
1034763568 7:153696343-153696365 CGACAGGCACCAGCAGACTCTGG + Intergenic
1038516628 8:28193112-28193134 ACACAGCCACCAGCTCACACTGG - Intergenic
1038542769 8:28402752-28402774 CTCCTGCCTCCTGCACACACAGG + Intronic
1038782357 8:30579162-30579184 TGCCACCCAGCAGCACACATGGG + Intronic
1041201371 8:55453942-55453964 CGTCCTCCACCAGCCCACACTGG + Intronic
1041740331 8:61150775-61150797 CTCCAGGAACCAGCTCACACTGG - Intronic
1042453829 8:68977175-68977197 CGCCAGACACCAGCAAAGGCAGG + Intergenic
1044206178 8:89494195-89494217 CTACAGACACCAGCAGACACTGG + Intergenic
1048623415 8:136159254-136159276 CGACAAACACCAGCAGACACTGG - Intergenic
1049018618 8:139939073-139939095 CGACAGGCACCAGGACACAAGGG + Intronic
1049453327 8:142674643-142674665 AGCCAGCCCCCAGGAGACACTGG - Intronic
1049743181 8:144250675-144250697 CCCCAGGCTCCAGCACACACTGG + Intronic
1053533147 9:38901367-38901389 CGGCAGTCACCAGGACACCCTGG - Intergenic
1054205373 9:62125796-62125818 CGGCAGTCACCAGGACACCCTGG - Intergenic
1054632988 9:67462574-67462596 CGGCAGTCACCAGGACACCCTGG + Intergenic
1055149662 9:72981137-72981159 CGCCTACCACCAGCACCCATGGG - Intronic
1056871879 9:90289502-90289524 TGACAGACACCAGCACACACTGG + Intergenic
1057039014 9:91833944-91833966 CCCCAGCCTCAAGCACCCACAGG + Intronic
1057702411 9:97373480-97373502 CCCCAGCCACCCTGACACACAGG - Intronic
1057853204 9:98581120-98581142 CACCAGCCACCATCCCCCACGGG - Intronic
1059368697 9:113807649-113807671 CCCCAACCCCCAGCACACCCCGG + Intergenic
1059612355 9:115912167-115912189 CGCCACTCCCCAGTACACACTGG - Intergenic
1060180001 9:121527435-121527457 CCCCAGCCCCCAGCCCCCACTGG - Intergenic
1061495860 9:130973835-130973857 CTCCAGCCACCACCGCCCACAGG - Intergenic
1062044880 9:134420344-134420366 CCACAGCCCCCAGCACTCACAGG - Intronic
1062077741 9:134601062-134601084 CCACAGCCAGCAGCACACCCCGG - Intergenic
1062481274 9:136753694-136753716 CGCCAGCCCCCAGCACGGCCGGG - Intergenic
1062601661 9:137321095-137321117 GGCCAGGCACCTGTACACACAGG - Intronic
1190062385 X:47219461-47219483 CTCCTTCCACAAGCACACACGGG - Intronic
1190600791 X:52089849-52089871 CGACAGACACCAGCAGACACCGG + Intergenic
1193322012 X:80133938-80133960 CAACAGACACCAGCAGACACTGG + Intergenic
1199972775 X:152872944-152872966 AGCCAGCCACACACACACACAGG - Intergenic
1200267661 X:154654407-154654429 AGCCAGCACCCAGCAGACACAGG - Intergenic