ID: 1142054587

View in Genome Browser
Species Human (GRCh38)
Location 16:87985112-87985134
Sequence GCGCCAGCCACCAGCACACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 1, 2: 4, 3: 15, 4: 243}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142054587_1142054592 -3 Left 1142054587 16:87985112-87985134 CCGTGTGTGCTGGTGGCTGGCGC 0: 1
1: 1
2: 4
3: 15
4: 243
Right 1142054592 16:87985132-87985154 CGCTGGGTTAGGTGCTTTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 88
1142054587_1142054593 7 Left 1142054587 16:87985112-87985134 CCGTGTGTGCTGGTGGCTGGCGC 0: 1
1: 1
2: 4
3: 15
4: 243
Right 1142054593 16:87985142-87985164 GGTGCTTTGTGGGCCTCGCCAGG No data
1142054587_1142054603 26 Left 1142054587 16:87985112-87985134 CCGTGTGTGCTGGTGGCTGGCGC 0: 1
1: 1
2: 4
3: 15
4: 243
Right 1142054603 16:87985161-87985183 CAGGGGGTGTGGGAAGTCTGGGG 0: 1
1: 1
2: 3
3: 43
4: 404
1142054587_1142054604 27 Left 1142054587 16:87985112-87985134 CCGTGTGTGCTGGTGGCTGGCGC 0: 1
1: 1
2: 4
3: 15
4: 243
Right 1142054604 16:87985162-87985184 AGGGGGTGTGGGAAGTCTGGGGG 0: 1
1: 1
2: 2
3: 47
4: 476
1142054587_1142054597 15 Left 1142054587 16:87985112-87985134 CCGTGTGTGCTGGTGGCTGGCGC 0: 1
1: 1
2: 4
3: 15
4: 243
Right 1142054597 16:87985150-87985172 GTGGGCCTCGCCAGGGGGTGTGG 0: 1
1: 0
2: 2
3: 25
4: 331
1142054587_1142054596 10 Left 1142054587 16:87985112-87985134 CCGTGTGTGCTGGTGGCTGGCGC 0: 1
1: 1
2: 4
3: 15
4: 243
Right 1142054596 16:87985145-87985167 GCTTTGTGGGCCTCGCCAGGGGG No data
1142054587_1142054602 25 Left 1142054587 16:87985112-87985134 CCGTGTGTGCTGGTGGCTGGCGC 0: 1
1: 1
2: 4
3: 15
4: 243
Right 1142054602 16:87985160-87985182 CCAGGGGGTGTGGGAAGTCTGGG No data
1142054587_1142054600 24 Left 1142054587 16:87985112-87985134 CCGTGTGTGCTGGTGGCTGGCGC 0: 1
1: 1
2: 4
3: 15
4: 243
Right 1142054600 16:87985159-87985181 GCCAGGGGGTGTGGGAAGTCTGG 0: 1
1: 2
2: 4
3: 46
4: 508
1142054587_1142054591 -4 Left 1142054587 16:87985112-87985134 CCGTGTGTGCTGGTGGCTGGCGC 0: 1
1: 1
2: 4
3: 15
4: 243
Right 1142054591 16:87985131-87985153 GCGCTGGGTTAGGTGCTTTGTGG 0: 1
1: 1
2: 0
3: 10
4: 128
1142054587_1142054594 8 Left 1142054587 16:87985112-87985134 CCGTGTGTGCTGGTGGCTGGCGC 0: 1
1: 1
2: 4
3: 15
4: 243
Right 1142054594 16:87985143-87985165 GTGCTTTGTGGGCCTCGCCAGGG No data
1142054587_1142054598 16 Left 1142054587 16:87985112-87985134 CCGTGTGTGCTGGTGGCTGGCGC 0: 1
1: 1
2: 4
3: 15
4: 243
Right 1142054598 16:87985151-87985173 TGGGCCTCGCCAGGGGGTGTGGG 0: 1
1: 0
2: 1
3: 17
4: 223
1142054587_1142054595 9 Left 1142054587 16:87985112-87985134 CCGTGTGTGCTGGTGGCTGGCGC 0: 1
1: 1
2: 4
3: 15
4: 243
Right 1142054595 16:87985144-87985166 TGCTTTGTGGGCCTCGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142054587 Original CRISPR GCGCCAGCCACCAGCACACA CGG (reversed) Intronic
900206568 1:1434270-1434292 CCCCCAGCCCCCAGTACACAGGG - Intergenic
900225305 1:1530255-1530277 GCGTCAGCCACCACCATACCCGG - Intronic
900275331 1:1822446-1822468 GCGCCCACCACCACCACACCTGG + Intronic
900681863 1:3920747-3920769 GTGCATGCCACCACCACACATGG + Intergenic
901848499 1:11999949-11999971 GCGCCTGCCACCATCACACCCGG - Intronic
904092429 1:27954685-27954707 GCTCCAGATCCCAGCACACAGGG - Intronic
905120054 1:35674879-35674901 GTGCCCGCCACCACCACACCTGG - Intergenic
905401860 1:37709343-37709365 GCCCCAGGCACAGGCACACATGG - Exonic
905511830 1:38527886-38527908 CCTCCAGCCAACAGCCCACAAGG + Intergenic
905725623 1:40249431-40249453 GCGCGTGCCACCACCACACCCGG - Intronic
906144936 1:43554337-43554359 GCCCCAGCCCTCAGCTCACAGGG - Intronic
906302839 1:44696109-44696131 GGGCCAGGCAGCAGCCCACACGG - Intronic
909425208 1:75516369-75516391 GCGCCCGCCACCACCACGCCCGG - Intronic
910085192 1:83393550-83393572 TAGCCAGCCACCCACACACATGG + Intergenic
910914036 1:92270021-92270043 GAGACAGACACAAGCACACAGGG + Intronic
918011043 1:180586782-180586804 GCTCCAGCCACCTGCCCCCACGG - Intergenic
919733269 1:200928184-200928206 GTGCCAGGCACCAGAGCACACGG - Intergenic
923526529 1:234777073-234777095 GCTGCAGTGACCAGCACACATGG + Intergenic
923812239 1:237331646-237331668 GCTCCTGCCACCACCACACCTGG + Intronic
924224375 1:241908651-241908673 GCACCTGCCACCACCACACCTGG - Intergenic
1062910365 10:1208351-1208373 GCACCAGCCACACGCACCCAGGG - Intronic
1070531904 10:77344179-77344201 GCCTCGGCCACCAGCCCACAAGG + Intronic
1070676433 10:78414919-78414941 CCCTCAGCCCCCAGCACACAGGG - Intergenic
1073315654 10:102578913-102578935 GGGCCTGCCACCTACACACAAGG - Intronic
1073488790 10:103838957-103838979 GCCCCAGCTGCCAGCCCACAGGG + Intronic
1075264635 10:120990086-120990108 CCAACAGCCACAAGCACACATGG + Intergenic
1075506324 10:123025778-123025800 GCGTGAGCCACCACCACACTGGG - Intronic
1075729861 10:124629697-124629719 GTGCCAGCTTCCAGCACAAATGG - Intronic
1076047719 10:127307956-127307978 GAGCCAGCCACCAGCCCACAGGG - Intronic
1076637668 10:131892833-131892855 GCACCTGCCAGCAGCTCACAAGG + Intergenic
1076826703 10:132973118-132973140 GCCCCGTCCCCCAGCACACAAGG + Intergenic
1076861226 10:133139318-133139340 AGACCAGCCACCCGCACACAGGG - Intergenic
1077220637 11:1413961-1413983 GCGCCAGCCACTTCCTCACACGG + Intronic
1079104735 11:17563337-17563359 GCTCCAGCCCCCAGCACTGAGGG + Intronic
1080346213 11:31328663-31328685 GCACCTGCCACCACCACACCCGG - Intronic
1081456713 11:43230731-43230753 GCTTCAGCCACCACCACACCCGG - Intergenic
1082899169 11:58227283-58227305 GTGAGAGCCACCAGCACAGAGGG + Intergenic
1083475720 11:62914085-62914107 GCGCCTGCCACCACCACGCCCGG + Intronic
1084658135 11:70531318-70531340 CCACCAGCCCCCAGCACAGATGG - Intronic
1084897028 11:72280326-72280348 GCGCAAACCATCAGCAGACAGGG - Intergenic
1085098791 11:73782840-73782862 GCGTGAGCCACCACCACACCTGG + Intergenic
1085107097 11:73854427-73854449 GCACCCGCCACCACCACACCTGG + Intronic
1089543526 11:119205845-119205867 GCGCCAACCTCCCGCCCACAAGG + Intergenic
1089703469 11:120259951-120259973 CAGCCAGCCACCAGAACAAATGG - Intronic
1095749587 12:45696288-45696310 GCTCCAGGCACCAGCACAAGTGG + Intergenic
1096517632 12:52165865-52165887 CAGCCAGCCTGCAGCACACAGGG + Intergenic
1096526895 12:52215397-52215419 GGGCCAGCCACCACCACCCCTGG - Intergenic
1099099220 12:78416396-78416418 GCTCCAGCCACCAGTCAACAAGG - Intergenic
1100245266 12:92751341-92751363 TGGCCAGCCACCTGTACACAGGG + Intronic
1101177625 12:102171721-102171743 GCGCCCGCCACCACCACACCTGG - Intronic
1101760734 12:107656742-107656764 GCACCCCCCACCAGCACACCTGG - Intronic
1101915250 12:108890962-108890984 GTGCCTGCCACCACCACACCTGG + Intronic
1103702237 12:122853887-122853909 GGGGCAGCCACCAGCACATGAGG + Intronic
1104840950 12:131825346-131825368 GCCACAGCCAGCAGGACACATGG + Intergenic
1105702019 13:22940855-22940877 GCGCCAGCCACACGCACCCATGG - Intergenic
1105874574 13:24540971-24540993 CCGCCACCCACAAGCACACTTGG - Intergenic
1106000655 13:25719987-25720009 GACCCAGACACCAGCACAGAGGG - Intronic
1106234510 13:27850808-27850830 CCACCTGCCACCAGCACACATGG - Intergenic
1106822547 13:33481834-33481856 GCGCCCGCCACCACCACGCCCGG - Intergenic
1107786317 13:43961730-43961752 GTGCCTGCCACCATCACACCCGG + Intergenic
1108021874 13:46135967-46135989 GCTCCAGCACACAGCACACAAGG + Intronic
1109822042 13:67669711-67669733 GCGCCCACCACCACCACACCTGG + Intergenic
1112271489 13:97974450-97974472 GCGCCCACCACCACCACACCTGG + Intronic
1114672093 14:24416816-24416838 GGGCCAGCCCACAGCTCACAAGG - Exonic
1115213350 14:30990306-30990328 GTGCCCGCCACCAGCACACCCGG + Intronic
1117141010 14:52791369-52791391 GCCCCAGCCCCCAGGACACACGG + Intronic
1117420323 14:55538325-55538347 GCACCTGCCACCACCACACCTGG - Intergenic
1121079957 14:91099752-91099774 GGGCCAGCAGGCAGCACACATGG + Intronic
1121999011 14:98630608-98630630 TTGCCAGCCTGCAGCACACATGG + Intergenic
1122773774 14:104108326-104108348 GCGCCACCCACCCACACCCAAGG - Intronic
1124610266 15:31203311-31203333 GCGCCAGCATTCAGAACACAGGG - Intergenic
1126531771 15:49718759-49718781 GGGCATGCCACAAGCACACATGG + Intergenic
1127603429 15:60562087-60562109 GCGCCTGCCACCACCACATCCGG + Intronic
1129405872 15:75317281-75317303 GCGTGAGCCACCACCACACCTGG + Intergenic
1129445611 15:75615745-75615767 GCGCCTGCCACCACCACGCCTGG + Intronic
1129489965 15:75915111-75915133 GCGCCCGCCACCACCACACCTGG + Intronic
1129661225 15:77554202-77554224 GGGCCAGCCACCTCCACTCAGGG + Intergenic
1130334822 15:82949832-82949854 GTGGCAGCCACCAGCACATGTGG - Intronic
1132728111 16:1347494-1347516 GCGCTGACCACCAGCACCCAGGG + Intronic
1132797579 16:1732857-1732879 GCGCCAGCCATCCGCCCACCTGG + Intronic
1132891570 16:2207344-2207366 GCACCTGCCACCAGGACTCACGG - Exonic
1135855247 16:26003869-26003891 GCACCAGGCACCAGCACACAGGG - Intronic
1136265777 16:29117205-29117227 GCACCAGCCACCAGCACACATGG - Intergenic
1136265926 16:29118325-29118347 CAGCCGTCCACCAGCACACAAGG - Intergenic
1137379114 16:47981417-47981439 GAGCCAGCCAACAGCAAAGATGG - Intergenic
1138107544 16:54297072-54297094 GTGCCAGCCATCAGCACACAAGG - Intergenic
1139946464 16:70645598-70645620 GGAGCAGCCACCAGCCCACAGGG + Intronic
1141107000 16:81242130-81242152 GCGCCAGGCACAGGCACCCAGGG - Intronic
1142054587 16:87985112-87985134 GCGCCAGCCACCAGCACACACGG - Intronic
1143023727 17:3929377-3929399 GCCACAGCCACCAGCAGCCAGGG + Exonic
1143107021 17:4535042-4535064 GTGCAAGCAACCAGCACCCACGG - Intronic
1143589992 17:7878578-7878600 GCGCGTGCCACCACCACACCCGG - Intronic
1147198718 17:38785097-38785119 GTGCCAGCAGCCAGCAGACAGGG - Intronic
1150046068 17:61914555-61914577 GCGCCCGCCACCACCACGCCCGG - Intronic
1150237256 17:63603088-63603110 GCGCCCGCCACCACCACGCCTGG - Intronic
1150418336 17:65005834-65005856 GTGTGAGCCACCAGCACCCAGGG + Intergenic
1151933283 17:77246848-77246870 GCGGCCGCCACCGGCACACCTGG - Intergenic
1152257211 17:79247137-79247159 CAGCCAGCCTCCAGCACACTTGG - Intronic
1153422855 18:4927797-4927819 GCCTCAGCCACCACCACACCTGG - Intergenic
1155619756 18:27764702-27764724 GGGCCAGCCTCCACCACACTTGG + Intergenic
1157783993 18:50465716-50465738 GCAGCATCCACCATCACACATGG + Intergenic
1158058587 18:53312193-53312215 ACGCCCGCCACCACCACACCAGG - Intronic
1160242708 18:77134280-77134302 GCTCCAGAGCCCAGCACACAGGG - Intergenic
1160549043 18:79681296-79681318 GCCCCACCCACCAGCACGCAGGG - Intronic
1161438839 19:4279408-4279430 GCCCCAGCCACCCGCACAAAGGG - Exonic
1162053241 19:8047867-8047889 GCGCCCGCCACCACCACACCTGG - Intronic
1162790282 19:13059272-13059294 GACCCAGCCACCTGCCCACAGGG - Intronic
1162896198 19:13765909-13765931 GCACCAGCCACCAGGACCCGGGG - Intronic
1163968642 19:20771599-20771621 AATCCAGCCACCAGCACAGAAGG + Intronic
1165184360 19:34004022-34004044 GCACCAGCCACCAGCTGGCATGG - Intergenic
1165933501 19:39375398-39375420 GCTCAAGCCACCAGCACCCCTGG - Intronic
1165959173 19:39520194-39520216 GCCCCAGCCACCATCAGAAAAGG - Exonic
1167101055 19:47404512-47404534 GCCCCAGCCCCCTACACACAAGG - Intronic
1167387319 19:49171608-49171630 GAGCCAGCCACGAGGAGACATGG - Exonic
926054855 2:9768520-9768542 GCGGCAGCAGCCAGCACAGAGGG + Intergenic
926094388 2:10071742-10071764 GCTCCAGCCTCCTGCAGACAGGG + Intronic
926140690 2:10366104-10366126 AGGCCAGCCACCACCAGACAGGG - Intronic
926199243 2:10781330-10781352 GCGCCCGCCACCACCACGCCAGG - Intronic
926766564 2:16327447-16327469 GTGCCAGGCACCAGCTCACTTGG - Intergenic
927460439 2:23294032-23294054 ACGGCAGCGACCTGCACACAGGG + Intergenic
928175465 2:29030776-29030798 GCTCCAGCCACCAGCAAAGTTGG + Intronic
932419928 2:71595699-71595721 GATCCAGCCATGAGCACACAAGG - Intronic
932448976 2:71797646-71797668 GCGCCAGGTGCCAGCACTCAGGG + Intergenic
932595420 2:73090254-73090276 GAGACAGCCCCCAACACACATGG + Intronic
933385927 2:81610060-81610082 GCTCCAGCCACCTCAACACAGGG + Intergenic
936284474 2:111171620-111171642 CCCCCAGCCACCAGCACCCCGGG + Intergenic
942432361 2:175925942-175925964 GCGTGAGCCACCACCACACCTGG + Exonic
944114998 2:196176439-196176461 GCTCCAGCCACAAACACACCAGG + Intronic
944913130 2:204329478-204329500 GCGCCACCAACTAGCATACAAGG - Intergenic
945055343 2:205863759-205863781 GCGTAAGCCACCACCACACCCGG - Intergenic
946225164 2:218260683-218260705 GCCACTGCCACCATCACACACGG + Intronic
947808720 2:232986244-232986266 GTTCCTACCACCAGCACACAAGG - Intronic
947929264 2:233949979-233950001 GAGCCTTCCACCACCACACAAGG - Exonic
948150153 2:235738445-235738467 GCCCCAGGCACCAGCCCACCAGG - Intronic
948556244 2:238813472-238813494 TGCCCAGCCACCAGCACAAATGG - Intergenic
948884729 2:240877009-240877031 CCTCCAGCCACCAGCTCTCATGG - Intronic
949040550 2:241846791-241846813 GCGCCAGCATCCAGAACTCACGG - Intergenic
949040555 2:241846841-241846863 GCGCCAGCATCCAGAACTCAAGG - Intergenic
949040563 2:241846941-241846963 GCGCCAGCATCCAGAACTCACGG - Intergenic
949040568 2:241846991-241847013 GCGCCAGCATCCAGAACTCAAGG - Intergenic
949040572 2:241847041-241847063 GCGCCAGCATCCAGAACTCAAGG - Intergenic
949040580 2:241847141-241847163 GCGCCAGCATCCAGAACTCAAGG - Intergenic
949040585 2:241847191-241847213 GCGCCAGCATCCAGAACTCAAGG - Intergenic
949040589 2:241847241-241847263 GCGCCAGCATCCAGAACTCAAGG - Intergenic
949040597 2:241847341-241847363 GCGCCAGCATCCAGAACTCAAGG - Intergenic
949040609 2:241847491-241847513 GCGCCAGCATCCAGAACTCAAGG - Intergenic
949040621 2:241847641-241847663 GCGCCAGCATCCAGAACTCAAGG - Intergenic
949040630 2:241847741-241847763 GCGCCAGCATCCAGAACTCACGG - Intergenic
949040635 2:241847791-241847813 GCGCCAGCATCCAGAACTCAAGG - Intergenic
949040641 2:241847891-241847913 GCGCCAGCATCCAGAACTCACGG - Intergenic
949040646 2:241847941-241847963 GCGCCAGCATCCAGAACTCAAGG - Intergenic
949040650 2:241847991-241848013 GCGCCAGCATCCAGAACTCAAGG - Intergenic
949040658 2:241848091-241848113 GCGCCAGCATCCAGAACTCAAGG - Intergenic
949040663 2:241848141-241848163 GCGCCAGCATCCAGAACTCAAGG - Intergenic
949040667 2:241848191-241848213 GCGCCAGCATCCAGAACTCAAGG - Intergenic
949040672 2:241848241-241848263 GCGCCAGCATCCAGAACTCAAGG - Intergenic
949040677 2:241848291-241848313 GCGCCAGCATCCAGAACTCAAGG - Intergenic
949040681 2:241848341-241848363 GCGCCAGCATCCAGAACTCAAGG - Intergenic
949040686 2:241848391-241848413 GCGCCAGCATCCAGAACTCAAGG - Intergenic
949040694 2:241848491-241848513 GCGCCAGCATCCAGAACTCAAGG - Intergenic
949040699 2:241848541-241848563 GCGCCAGCATCCAGAACTCAAGG - Intergenic
949040706 2:241848641-241848663 GCGCCAGCATCCAGAACTCAAGG - Intergenic
949040715 2:241848741-241848763 GCGCCAGCATCCAGAACTCACGG - Intergenic
949040720 2:241848791-241848813 GCGCCAGCATCCAGAACTCAAGG - Intergenic
949040724 2:241848841-241848863 GCGCCAGCATCCAGAACTCACGG - Intergenic
949040729 2:241848891-241848913 GCGCCAGCATCCAGAACTCAAGG - Intergenic
1169729563 20:8772159-8772181 GCGTGAGCCACCAGCACACCAGG + Intronic
1171974668 20:31586985-31587007 GCGCCCGCCACCACCACGCCCGG + Intergenic
1172342301 20:34168047-34168069 GCGCCCGCCACCACCACGCTCGG + Intergenic
1172668356 20:36616474-36616496 GCGCCTGCCACCACCACGCCCGG + Intronic
1173528291 20:43749627-43749649 GAGACAGCCACCACCACACCCGG + Intergenic
1173726779 20:45303957-45303979 GCACCAACCCCCTGCACACACGG - Intronic
1174436114 20:50508296-50508318 GTGCCTGCCACAAGCACTCAAGG + Intergenic
1176409748 21:6442184-6442206 ACTTCAGCCTCCAGCACACATGG - Intergenic
1177914341 21:27069849-27069871 GCACCACACACCAGCACCCATGG - Intergenic
1178509205 21:33188646-33188668 GCGTGAGCCACCACCACACCTGG + Intergenic
1179580839 21:42343200-42343222 GGGCCATCAACCTGCACACATGG + Intergenic
1179685241 21:43050506-43050528 ACTTCAGCCTCCAGCACACATGG - Intergenic
1182018466 22:27060821-27060843 GAGGCAGCCACCAGGACCCACGG - Intergenic
1184131027 22:42516453-42516475 GCGCCCACCACCACCACACGTGG + Intronic
1184137814 22:42559557-42559579 GCGCCCGCCACCACCACGCTTGG - Intronic
950667991 3:14508956-14508978 GCCCCAGCAACCAGGACAGAGGG + Intronic
953905474 3:46866330-46866352 GTGCCAGCCTGCAGCACACTGGG - Intronic
954295177 3:49670486-49670508 GCTCCAGCCACCTTCACAGAGGG - Exonic
957629055 3:82695053-82695075 GCGCCAGCCACCACCATGCCTGG - Intergenic
958815144 3:98905912-98905934 GCACCCGCCACCACCACACCCGG - Intergenic
960943086 3:122947181-122947203 GTGACAGCCACCAGCACTCCAGG + Intronic
961450104 3:126998818-126998840 CCCCCAACCCCCAGCACACAGGG - Intronic
961533015 3:127551346-127551368 GCCCCAGCCACGTGCCCACATGG - Intergenic
966234307 3:177683758-177683780 ATGCCATCCACCACCACACAGGG - Intergenic
966381159 3:179346912-179346934 GCGCCCGCCACCACCACGCCCGG + Intergenic
966759635 3:183405994-183406016 GCGTGAGCCACCACCACACCTGG + Intronic
966917413 3:184592770-184592792 GCGCGAGCGGCCAGCCCACAGGG + Intronic
968872136 4:3247543-3247565 GTGCCAGCCCCCAGCACGGAGGG + Exonic
969461885 4:7333383-7333405 GCACCGGCCAACATCACACACGG - Intronic
969607135 4:8207952-8207974 GAGCCAGCGACCATGACACAGGG + Intronic
969841602 4:9887017-9887039 GCCCCAACCACCAGCTTACATGG - Intronic
970289338 4:14554511-14554533 GTGCCCGCCACCACCACACCTGG + Intergenic
973789315 4:54363863-54363885 GAGTCACCCACCAGAACACAGGG + Intergenic
978980119 4:114934406-114934428 GCGCCTGCCACCACCACGCCCGG - Intronic
980750046 4:137076860-137076882 GCTCCAGCTACCAGCAAAGAGGG + Intergenic
983500358 4:168492864-168492886 GCGTCAACCACCAGGAAACAAGG - Intronic
985979973 5:3454338-3454360 GCGTCACCCACTAACACACACGG + Intergenic
986097587 5:4574877-4574899 GTGCCAGGCACCATCATACAAGG + Intergenic
988694707 5:33609514-33609536 GCGCCCACCACCACCACACCTGG + Intronic
990492757 5:56318670-56318692 GCCCCAGCCACCACCCCACTTGG - Intergenic
997442651 5:133919435-133919457 GCACCAGCCAGCAGGACACAGGG + Intergenic
998205646 5:140155288-140155310 GCACCAGCCACCAGCACGTCAGG - Intergenic
998890996 5:146745677-146745699 GCGTGAGCCACCACCACACCTGG - Intronic
998955212 5:147431717-147431739 GCTCCTGCCACCAGCAGCCAAGG + Intronic
1000422682 5:161056399-161056421 GCACCAGTCACCATCACCCATGG - Intergenic
1002880115 6:1243398-1243420 GAACCAGCCCCCACCACACAGGG + Intergenic
1005467087 6:26125907-26125929 GCGCCCGCCACCAGTAGAAACGG + Intronic
1005749533 6:28870114-28870136 GAGTCACCCACTAGCACACATGG - Intergenic
1006291535 6:33141520-33141542 ACACCTGCCATCAGCACACAAGG - Intergenic
1006472040 6:34235121-34235143 CCTCCAGCCACCACCACTCACGG + Intergenic
1007366316 6:41396567-41396589 GCGCCAGCCACCAGGAATCTCGG + Intergenic
1013431700 6:110062014-110062036 GCGCCAGCCACCACCAGCCCAGG + Intergenic
1013503668 6:110777525-110777547 GCTCCTGCCAACAGTACACAAGG - Intronic
1018815118 6:167324879-167324901 GCCTCAGCGGCCAGCACACAGGG - Intergenic
1018938610 6:168291929-168291951 CTGCCAGCAACAAGCACACAGGG + Intergenic
1019301342 7:305627-305649 GCGCCAGGCACCCGCGCTCACGG + Intergenic
1019430825 7:998226-998248 GCCCCCACCACCAGCAGACAAGG - Intronic
1020806183 7:12793008-12793030 GCACCTGCCACCACCACACCTGG - Intergenic
1022505105 7:30904851-30904873 GCACCAGCCAGCAGCACACAGGG - Intergenic
1022588883 7:31642405-31642427 GCACAAGCCACCTGCACCCAAGG + Intronic
1023431035 7:40091200-40091222 GCGCCTGCCACCACCACGCCCGG - Intronic
1023679891 7:42674770-42674792 TCCCCAGCAAGCAGCACACAGGG + Intergenic
1027302066 7:76850016-76850038 TAGCCAGCCACCCACACACATGG + Intergenic
1030284040 7:107806701-107806723 GCGCCTGCCACCACCACGCCCGG - Intergenic
1032213405 7:129937047-129937069 GCGCGAGCCACCACCACACCTGG - Intronic
1035153070 7:156892126-156892148 ACTCCTGCCAACAGCACACATGG + Intronic
1036183009 8:6601044-6601066 AAGCCAGCCCCCAGCCCACAGGG - Intronic
1038385220 8:27137902-27137924 CAGGCAGCCACCACCACACATGG - Intergenic
1038782356 8:30579161-30579183 CTGCCACCCAGCAGCACACATGG + Intronic
1039843023 8:41307137-41307159 GTGCAAGCCAACAGAACACAAGG + Intronic
1041568922 8:59313630-59313652 GTAGCACCCACCAGCACACAGGG - Intergenic
1042090726 8:65156517-65156539 GCGACAGCCACAAGCAAAGAGGG + Intergenic
1047114140 8:121821584-121821606 TCTCCAGCTAACAGCACACATGG + Intergenic
1047286120 8:123488600-123488622 GAGCCAGCCACCTCCATACAGGG - Intergenic
1047686213 8:127307101-127307123 GCCCCAGCCAACAGCACAAGAGG + Intergenic
1049018617 8:139939072-139939094 GCGACAGGCACCAGGACACAAGG + Intronic
1053249258 9:36560714-36560736 GAGCCACCCACCAGCCCTCAGGG - Intergenic
1055149663 9:72981138-72981160 TCGCCTACCACCAGCACCCATGG - Intronic
1056572139 9:87825327-87825349 GCCCCAGCCACCTGCTCACGTGG - Intergenic
1056695359 9:88845838-88845860 GTGCCAGCCACCACCACACCTGG - Intergenic
1056825203 9:89872368-89872390 GGTCCAGGCCCCAGCACACAGGG - Intergenic
1057853205 9:98581121-98581143 GCACCAGCCACCATCCCCCACGG - Intronic
1058838036 9:108877009-108877031 GCGTGAGCCACCACCACACCTGG + Intronic
1059447608 9:114348626-114348648 CCTCCAGCCACCAGCACTGAGGG + Intronic
1059985909 9:119820404-119820426 GCTCCTGCCACAAGGACACATGG - Intergenic
1060693521 9:125686175-125686197 GCGCCCACCACCACCACACCTGG - Intronic
1061821986 9:133234017-133234039 GCGCCAGCCTCCAGGAGACGGGG - Intergenic
1062164819 9:135102338-135102360 GCCACTGTCACCAGCACACATGG + Intronic
1062237312 9:135516496-135516518 GCGCCAGCCTCCAGGAGACGGGG + Intergenic
1185460336 X:330355-330377 GCGCCCGCCACCACCACGCCCGG - Intergenic
1185491309 X:519196-519218 GCGCCCGCCACCACCACGCCCGG - Intergenic
1185690481 X:2151104-2151126 ACTCAAGACACCAGCACACATGG - Intergenic
1185692732 X:2169602-2169624 GCGCCTGCCACCACCACGCCCGG + Intergenic
1187258895 X:17667291-17667313 GCTCCAGCCAGAAGCACAAATGG + Intronic
1190765706 X:53473793-53473815 GCACCTGCCACCTGCACCCATGG - Intergenic
1191128251 X:56981216-56981238 GCGCCAGCCACCAACATGCCTGG - Intronic
1193253939 X:79324921-79324943 GCGCCTGCCACCACCACGCCCGG - Intergenic
1200763855 Y:7063857-7063879 GGGACAGCCATCAGCTCACAAGG - Intronic