ID: 1142054594

View in Genome Browser
Species Human (GRCh38)
Location 16:87985143-87985165
Sequence GTGCTTTGTGGGCCTCGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142054587_1142054594 8 Left 1142054587 16:87985112-87985134 CCGTGTGTGCTGGTGGCTGGCGC 0: 1
1: 1
2: 4
3: 15
4: 243
Right 1142054594 16:87985143-87985165 GTGCTTTGTGGGCCTCGCCAGGG No data
1142054586_1142054594 9 Left 1142054586 16:87985111-87985133 CCCGTGTGTGCTGGTGGCTGGCG 0: 1
1: 0
2: 1
3: 27
4: 245
Right 1142054594 16:87985143-87985165 GTGCTTTGTGGGCCTCGCCAGGG No data
1142054583_1142054594 17 Left 1142054583 16:87985103-87985125 CCTCGCTGCCCGTGTGTGCTGGT No data
Right 1142054594 16:87985143-87985165 GTGCTTTGTGGGCCTCGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142054594 Original CRISPR GTGCTTTGTGGGCCTCGCCA GGG Intronic
No off target data available for this crispr