ID: 1142056995

View in Genome Browser
Species Human (GRCh38)
Location 16:88004196-88004218
Sequence TTCAACACAGTCCACTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142056995_1142056998 19 Left 1142056995 16:88004196-88004218 CCCTGGGAGTGGACTGTGTTGAA 0: 1
1: 1
2: 1
3: 19
4: 156
Right 1142056998 16:88004238-88004260 CCATGAATGTTGTTGTTTTAAGG 0: 1
1: 0
2: 1
3: 19
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142056995 Original CRISPR TTCAACACAGTCCACTCCCA GGG (reversed) Intronic