ID: 1142058663

View in Genome Browser
Species Human (GRCh38)
Location 16:88015972-88015994
Sequence GAGTCCGGGGACCTTGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 82}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142058658_1142058663 -8 Left 1142058658 16:88015957-88015979 CCAGTCTGGGTTTGGGAGTCCGG 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1142058663 16:88015972-88015994 GAGTCCGGGGACCTTGCAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 82
1142058655_1142058663 -1 Left 1142058655 16:88015950-88015972 CCTGCGCCCAGTCTGGGTTTGGG 0: 1
1: 0
2: 0
3: 31
4: 158
Right 1142058663 16:88015972-88015994 GAGTCCGGGGACCTTGCAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 82
1142058651_1142058663 5 Left 1142058651 16:88015944-88015966 CCCTGGCCTGCGCCCAGTCTGGG 0: 1
1: 0
2: 0
3: 22
4: 276
Right 1142058663 16:88015972-88015994 GAGTCCGGGGACCTTGCAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 82
1142058657_1142058663 -7 Left 1142058657 16:88015956-88015978 CCCAGTCTGGGTTTGGGAGTCCG 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1142058663 16:88015972-88015994 GAGTCCGGGGACCTTGCAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 82
1142058653_1142058663 4 Left 1142058653 16:88015945-88015967 CCTGGCCTGCGCCCAGTCTGGGT No data
Right 1142058663 16:88015972-88015994 GAGTCCGGGGACCTTGCAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142058663 Original CRISPR GAGTCCGGGGACCTTGCAGT GGG Intronic
900686149 1:3948951-3948973 GAGGCTGGGGACCTTCCTGTGGG - Intergenic
902688617 1:18095555-18095577 GACTCTGGGGACCTGGCAGATGG + Intergenic
902883028 1:19385413-19385435 GAGCACGGGGACCTTGGACTTGG - Intronic
903137172 1:21317283-21317305 GAGTCCCGGGAGCTAACAGTGGG - Intronic
904399713 1:30248099-30248121 AAATCCGGGCCCCTTGCAGTGGG - Intergenic
904727452 1:32560311-32560333 GAGTCCTGGGACAGTGCAGAAGG - Intronic
904966857 1:34380798-34380820 GAGTGCTGGGGCCTTGCAGCCGG + Intergenic
907482391 1:54754214-54754236 GAGGGCGGGGACCTTGCTGGGGG + Intergenic
922338525 1:224637286-224637308 GTGTGCGGGGACCTCGCAGATGG - Intronic
1074169691 10:110919864-110919886 GAGTGCGGGGCCCTTGGAGCCGG + Intronic
1074430536 10:113390551-113390573 GAGTCAGGGGCCCTAGCAGCAGG - Intergenic
1075452777 10:122563857-122563879 GATACCTGGGACCTGGCAGTGGG + Intronic
1076786460 10:132752231-132752253 GTCTCCGGGGACCTTGCACAGGG + Intronic
1083787551 11:64960957-64960979 CCCTCCGGGGACTTTGCAGTTGG - Intronic
1084442599 11:69183502-69183524 AATTCCTGGGCCCTTGCAGTGGG - Intergenic
1084548934 11:69829174-69829196 GTGGGCGGGGACCTTGCCGTGGG - Intergenic
1088816609 11:113425454-113425476 GAGTCTGGGGAGGTTGCAATAGG + Intronic
1090205071 11:124879499-124879521 GAGCACGGGGTCCTTGAAGTGGG - Exonic
1095404567 12:41853822-41853844 GAGTTTGGGGACCCTGCGGTTGG - Intergenic
1101944410 12:109125389-109125411 GAGTCCTGGTTCCTTTCAGTGGG + Intronic
1104639260 12:130457065-130457087 CAGCCCGGGCACTTTGCAGTTGG + Intronic
1104809094 12:131609879-131609901 GACTCTGGGGACCTCGCTGTGGG + Intergenic
1104966509 12:132510804-132510826 GAGGGCGGGGACCTTGCTGGGGG + Intronic
1113847541 13:113401301-113401323 CAGTCCTGGGAGCCTGCAGTTGG - Intergenic
1124639956 15:31391351-31391373 GAGTGCGGGGACCTGGGTGTGGG + Intronic
1125721046 15:41845339-41845361 GAGACCTGTGCCCTTGCAGTTGG + Intronic
1128213112 15:65916059-65916081 GAGTGAGTGGACCTTGAAGTGGG + Intronic
1131003853 15:88959934-88959956 GAGTCCGGGGACCTGGCTGCAGG + Intergenic
1132805814 16:1774583-1774605 GAGGCCGGGGTCCGGGCAGTAGG + Intronic
1132815846 16:1826305-1826327 GAGACCGCGGTCCTTGCAGCGGG + Intronic
1132927262 16:2437355-2437377 GTGTCCTGGGACCCTGCAGGTGG - Intronic
1138376706 16:56569222-56569244 GAGTCATAGGACCTTGCAGTAGG - Intergenic
1141882701 16:86870315-86870337 GGGTCCGGGGACCTTGACGACGG - Intergenic
1142058663 16:88015972-88015994 GAGTCCGGGGACCTTGCAGTGGG + Intronic
1148556352 17:48581150-48581172 CAGTCCTGGGACCTTGCAGGTGG + Intronic
1151680231 17:75619223-75619245 GGGTCCAGGGACCATGGAGTTGG + Intergenic
1152425902 17:80218540-80218562 GAGGCTGGGCACCTTCCAGTTGG + Intronic
1153907923 18:9679338-9679360 GGGTCCGGGGGCCTGGCTGTGGG - Intergenic
1159471574 18:68863974-68863996 GAGTCCAGGGTTCTTTCAGTGGG + Intronic
1161312002 19:3600045-3600067 GAGTCCGGGGACGTGGCCTTCGG - Exonic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1161475083 19:4480304-4480326 GAGTCAGGGGATCTGGGAGTTGG - Intronic
1163618682 19:18344639-18344661 GGGTCCCGGGACCCTGCAGATGG + Intronic
1165144215 19:33721190-33721212 GACTCCGAGGACCCTGCAATAGG - Intronic
925190282 2:1876681-1876703 CAGTCCGGAGCCCTGGCAGTGGG - Intronic
925365658 2:3310087-3310109 GAGTGTGGTGACCTTGCCGTGGG - Intronic
928825197 2:35412445-35412467 GAGTCAGGGGAAGTGGCAGTAGG - Intergenic
930022787 2:47011607-47011629 GAGTCAGGGGACCCTGCCATTGG - Intronic
942971435 2:181962282-181962304 GGGTCCGGGGACCTGGCCGCGGG - Intronic
943703742 2:191013946-191013968 GAGTCCTCGGGCCGTGCAGTTGG - Intronic
948840014 2:240644294-240644316 GAGGCAGGGGACCTTGGGGTTGG - Intergenic
949040019 2:241843878-241843900 GAGCCCGGGGTCCTTGGAATTGG - Intergenic
1169148101 20:3267412-3267434 GAGTCCTGGTACCTTGTAGTGGG + Intronic
1171483223 20:25468961-25468983 GAGTCAGGGGACAGGGCAGTGGG - Intronic
1171483256 20:25469072-25469094 GAGTCAGGGGACAGGGCAGTGGG - Intronic
1171483267 20:25469109-25469131 GAGTCAGGGGACAGGGCAGTGGG - Intronic
1171483322 20:25469293-25469315 GAGTCGGGGGACAGGGCAGTGGG - Intronic
1171483365 20:25469433-25469455 GAGTCAGGGGACAGGGCAGTGGG - Intronic
1174349523 20:49956917-49956939 GGGTCCGGGGACCTGGCCGGGGG + Intergenic
1176144418 20:63559213-63559235 CAGTCCTGGCACCTTGCAGGTGG + Exonic
1185041036 22:48504515-48504537 GAGTCCGGGCACCTTGCTGGGGG + Intronic
952319079 3:32259126-32259148 GGGTCCGGGGACCTGGCCGCAGG + Intronic
962271592 3:133981407-133981429 TAGTCCAGTTACCTTGCAGTTGG - Intronic
964660896 3:159119173-159119195 GAACCAGGGGACATTGCAGTAGG - Intronic
969525970 4:7704287-7704309 GAGTGCGGGGACCGGGGAGTGGG + Intronic
970628044 4:17911848-17911870 AGGTCCGGGGACCTGGCCGTGGG + Intronic
984634038 4:182091982-182092004 CAGTCCTGTGACCTGGCAGTTGG + Intergenic
985788041 5:1910202-1910224 GAGGCCGGGGACCCTGCATCGGG + Intergenic
996224096 5:120969285-120969307 GAGTCTGGGGCCCATGCAATGGG + Intergenic
996451994 5:123636284-123636306 GAGTCCGGGGGCCTGGCCGCGGG + Intergenic
1002454789 5:179339789-179339811 GGGTCCTGGGACTGTGCAGTGGG - Intronic
1003243066 6:4361273-4361295 AAGTTCCGGGAGCTTGCAGTGGG - Intergenic
1005974794 6:30789856-30789878 GAGTCTGGGGACCTTGCCAGAGG - Intergenic
1007992374 6:46270288-46270310 GAGTGCCGGGACCTTGCTGAGGG + Intronic
1020788384 7:12595388-12595410 AAGTCTGGTGACCTTGCTGTAGG + Intronic
1021170263 7:17390971-17390993 CAGGCTGGGGATCTTGCAGTGGG - Intergenic
1027235445 7:76295044-76295066 GACTCCCTGGACCTTGCAGTGGG + Intergenic
1029300757 7:99580676-99580698 GAGTCTGGGGACCTCTCCGTGGG - Intronic
1034182307 7:149148009-149148031 GAGACCCGGGGCCCTGCAGTTGG + Intronic
1037581770 8:20249681-20249703 GAGTCTGGGGACCTGGCACTGGG - Exonic
1038736462 8:30174116-30174138 GAGTCCGAGGACTTTGGCGTGGG - Intronic
1040545900 8:48397476-48397498 GAGTCTGGGGTCCTAGCAGATGG + Intergenic
1047743160 8:127823597-127823619 GAGTCCCGGGACATTGCTGAGGG - Intergenic
1049783298 8:144438798-144438820 GAGTTTGGGGAGCTTGCAGCAGG - Intronic
1051506580 9:17833702-17833724 GAGTGTGGAGACCTTCCAGTGGG - Intergenic
1052613059 9:30800556-30800578 GGGTCCGGGGACCTGGCCGCGGG - Intergenic
1053198122 9:36135931-36135953 GGGTCAGGGCACCTGGCAGTTGG + Intergenic
1058430207 9:104911721-104911743 GAGTTAGGGGGCCTTGCAGAAGG + Intronic
1059660111 9:116391885-116391907 GAGTCAGGGAATCTGGCAGTTGG + Intronic
1060752558 9:126182923-126182945 GACCCCTGGGACCTGGCAGTTGG + Intergenic