ID: 1142060474

View in Genome Browser
Species Human (GRCh38)
Location 16:88026130-88026152
Sequence AGAGCTCTCCGTAGCGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 2, 1: 0, 2: 0, 3: 6, 4: 61}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142060469_1142060474 22 Left 1142060469 16:88026085-88026107 CCTGTTGAATACAGGGCATCTCT 0: 2
1: 0
2: 0
3: 4
4: 103
Right 1142060474 16:88026130-88026152 AGAGCTCTCCGTAGCGCAGGTGG 0: 2
1: 0
2: 0
3: 6
4: 61
1142060468_1142060474 23 Left 1142060468 16:88026084-88026106 CCCTGTTGAATACAGGGCATCTC 0: 2
1: 0
2: 0
3: 7
4: 101
Right 1142060474 16:88026130-88026152 AGAGCTCTCCGTAGCGCAGGTGG 0: 2
1: 0
2: 0
3: 6
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142060474 Original CRISPR AGAGCTCTCCGTAGCGCAGG TGG Intronic
900653250 1:3741729-3741751 TGAGCTCTCCAGAGCACAGGTGG - Intergenic
923063447 1:230497569-230497591 AGAGCTCTCCCTGGGGGAGGAGG + Intergenic
1076270467 10:129148054-129148076 ACAGCTTTCCGTAGTGCAGTTGG - Intergenic
1082919803 11:58480936-58480958 AGAGCTCTCCCCAATGCAGGTGG + Intergenic
1083780088 11:64913274-64913296 GGAGCTCCTCGTAGTGCAGGCGG + Exonic
1084517367 11:69644105-69644127 AGAGCGCTCTCCAGCGCAGGAGG - Intronic
1084662218 11:70552677-70552699 AGGGTTCTCCGTGGCGCAGGGGG + Intronic
1088196377 11:107278392-107278414 AGAGGTCTCGGTAGGGTAGGGGG + Intergenic
1089738100 11:120563779-120563801 AGAGCCCTGGGTAGCTCAGGAGG - Intronic
1092216864 12:6689449-6689471 AGAGCTCTGCGGAGAGAAGGCGG + Exonic
1102277905 12:111597973-111597995 AGACCTCTCCGGCGCGCGGGTGG - Intronic
1103973254 12:124685657-124685679 TGTGCCCTCCGTAGAGCAGGGGG + Intergenic
1104890377 12:132136628-132136650 AGAGCTCTCCGTTGCAGAGGGGG + Exonic
1104921744 12:132294203-132294225 AGAGCTGTCCCTGGAGCAGGTGG + Intronic
1127391171 15:58506187-58506209 GGGGCTCTCCTTAGCCCAGGAGG + Intronic
1129327223 15:74807154-74807176 AGAGCCTTCCTTAGAGCAGGGGG + Intergenic
1131833080 15:96366578-96366600 AGAGCTCTCCGGTGCGCCTGGGG + Intergenic
1132261944 15:100433568-100433590 AGAGCTCTCTGTAGGGTTGGTGG + Intronic
1134609101 16:15593571-15593593 AGACCTGTCCGTAGCAGAGGGGG - Intronic
1136298805 16:29319632-29319654 AGAGCTCTCCGTAGCGCAGGTGG + Intergenic
1138096688 16:54217488-54217510 AGAGCCTTCAGTGGCGCAGGGGG - Intergenic
1142060474 16:88026130-88026152 AGAGCTCTCCGTAGCGCAGGTGG + Intronic
1144658228 17:17051670-17051692 AGAGCTCTGGGTAGGGCATGGGG - Intronic
1147015508 17:37489191-37489213 GGGGTTCTCCGGAGCGCAGGCGG - Intergenic
1152389401 17:79993745-79993767 AGAGCTCTCAGAAGCTCACGTGG + Intronic
1160562434 18:79766994-79767016 AGAGCTCTGCTCATCGCAGGAGG + Intergenic
1161401319 19:4067193-4067215 AGAGCTCCCCGGGGCGCGGGGGG + Intergenic
1164840504 19:31389262-31389284 AGAGCTCTCCCTAGCGATAGTGG - Intergenic
1167347270 19:48954591-48954613 TGAGCTCTCCCCAGCGCAGAAGG - Intergenic
926549820 2:14288116-14288138 AGAGCTCTCCCTAGTGCCTGGGG - Intergenic
929262830 2:39885220-39885242 AGAGCTTTCCATATCGAAGGTGG + Intergenic
933750522 2:85599983-85600005 GGAGCTGCCCGTAGCGCAGGAGG + Exonic
934474795 2:94586904-94586926 ACAGCTCTCCCCAGCGCTGGGGG + Intergenic
934937260 2:98474442-98474464 AGGGCTCTTCGTAGCACAGGTGG - Intronic
1173383657 20:42568682-42568704 ACAGCTCTCTGTAGGCCAGGAGG - Intronic
1176224053 20:63984833-63984855 AGAGATCTCCGTTTCGCTGGTGG + Intronic
1181742118 22:24929486-24929508 TGAGATCTCAGTAGCCCAGGGGG + Intergenic
1183707350 22:39482369-39482391 AGATCCCTCTGTAGTGCAGGTGG - Intronic
1185175300 22:49322991-49323013 AGAGCTCCCCGTCTCGGAGGAGG - Intergenic
956647087 3:71466766-71466788 AGAGCACTGCCTAGGGCAGGGGG + Intronic
960666169 3:120111104-120111126 AGAGCCCTTCATAACGCAGGAGG + Intergenic
963046823 3:141108698-141108720 AGGGCTCTGGGTAGTGCAGGAGG + Intronic
966928535 3:184660963-184660985 AGAGCTCTCTGGAGCTGAGGAGG + Intronic
968940382 4:3634529-3634551 AGAGCTCGCCGTGGCGCTGGAGG + Intergenic
969255293 4:5997174-5997196 AGACCACTCCGTAGCGCAGAAGG + Intergenic
978351599 4:107825301-107825323 AGAGTCCTCCGAAGCGCGGGAGG + Intronic
981002386 4:139840275-139840297 AGAGCTCTCCACAGAGCAGTTGG + Intronic
999205608 5:149845859-149845881 GGAGCCCTCCGTAGCTCAGCTGG - Exonic
1002164555 5:177336363-177336385 AGAGCTCTGCGCAGAGCAGCAGG + Intronic
1002409079 5:179060265-179060287 AGAGCTCTCGTTGGCGGAGGCGG + Intergenic
1004746005 6:18509878-18509900 AGGGCTCTCCTTAGCTGAGGTGG + Intergenic
1009677648 6:66846864-66846886 AGAGTTTTCTGTAGCGGAGGTGG - Intergenic
1019923444 7:4177424-4177446 AGAGAACTCCTTAGGGCAGGGGG - Intronic
1028260680 7:88660552-88660574 AGAGCTCTCCATAGCCAAGATGG - Intergenic
1030073854 7:105720175-105720197 ACAGCTTTCCCTAGTGCAGGTGG + Intronic
1030995568 7:116354896-116354918 AGAGGTCTCTGTTGCCCAGGAGG - Intronic
1032542285 7:132713137-132713159 AGGGCTCTCCTTTGAGCAGGAGG + Intronic
1036615929 8:10387578-10387600 AGAGTTCTTCTTAGCGCTGGTGG + Intronic
1037660078 8:20918836-20918858 AGAGCTCTTCCTAGGGCAGAGGG + Intergenic
1040038679 8:42896169-42896191 AGAACTCTCCTTAATGCAGGAGG - Intronic
1040521152 8:48177151-48177173 AGAGGTCTCCCTAGCACAGCAGG - Intergenic
1052855255 9:33402855-33402877 ACAGCTCTCCCCAGCGCTGGGGG - Intergenic
1053431474 9:38044508-38044530 AAAGCTCTCCATAGAGGAGGTGG + Intronic
1053933248 9:43127513-43127535 ACAGCTCTCCCCAGCGCTGGGGG - Intergenic
1054186054 9:61953040-61953062 AAAGCTCTCCCCAGCGGAGGGGG + Intergenic
1054353690 9:64042431-64042453 ATAGCTGTCCGTATTGCAGGTGG - Intergenic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1061727405 9:132589397-132589419 AGAGGTCTCTGGAGAGCAGGCGG - Exonic
1198197779 X:134382071-134382093 AGAGGGCTCAGTAGAGCAGGAGG + Intronic