ID: 1142060563

View in Genome Browser
Species Human (GRCh38)
Location 16:88026692-88026714
Sequence TCCAAACTGTGTTTATGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 2, 2: 2, 3: 16, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142060559_1142060563 27 Left 1142060559 16:88026642-88026664 CCAAACTGTGTTTGTGAGGGGGA 0: 2
1: 1
2: 4
3: 12
4: 163
Right 1142060563 16:88026692-88026714 TCCAAACTGTGTTTATGAGGGGG 0: 1
1: 2
2: 2
3: 16
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142060563 Original CRISPR TCCAAACTGTGTTTATGAGG GGG Intronic
900459715 1:2797074-2797096 TCCATACTGTGCTTCTGGGGAGG - Intronic
903820951 1:26102186-26102208 TCCAAACTGTGCTTCTGTGGAGG - Intergenic
905641897 1:39595707-39595729 TCCAAACTGAGGTGATAAGGTGG + Intergenic
907576841 1:55534388-55534410 TCCAACCTGTGTTCATGAATTGG + Intergenic
908888736 1:68818636-68818658 TCCACACTGCCTTTATGAGCTGG + Intergenic
911444742 1:97977846-97977868 ACCAAACTGTGTTGATCTGGTGG - Intergenic
916405504 1:164494367-164494389 TTCAGGCTGTTTTTATGAGGTGG + Intergenic
917176287 1:172239327-172239349 ACCATACTGTGTTTATGGGTGGG + Intronic
918284863 1:183042404-183042426 CCTCTACTGTGTTTATGAGGTGG - Intronic
918436905 1:184524125-184524147 TCTAAAATGTGTTTATAAGCTGG + Intronic
919025280 1:192161145-192161167 TTAAAACTGTGTTTATGGAGCGG - Intronic
919752913 1:201049217-201049239 TTCCAACTGTGTTTAGGAAGTGG + Intronic
921075542 1:211697638-211697660 TCCACACTGTGTTTCTCAGCAGG - Intergenic
921729136 1:218557278-218557300 TCAAACCTGTGTTTATGGAGAGG + Intergenic
923819560 1:237423073-237423095 TCCTAACTGTTTTCATTAGGTGG + Exonic
1064778421 10:18806076-18806098 TCCAAACTGATTTTATCATGAGG + Intergenic
1071367684 10:84916520-84916542 TCCAAGGTGGGTTTTTGAGGGGG + Intergenic
1071737764 10:88320478-88320500 GCCAATCTGTGTTTCTCAGGTGG - Intronic
1072048539 10:91681155-91681177 TCCAAACTGTGTTTTTAAATTGG - Intergenic
1072910617 10:99497672-99497694 TCAAGGCTGTGTTTATGAGAAGG - Intergenic
1073058404 10:100716756-100716778 TCCAAGGTGTGTTTATAAAGAGG + Intergenic
1075952770 10:126496357-126496379 TGGAAACCGTGTTTATGATGAGG + Intronic
1078626210 11:12961221-12961243 TTCAAACTCTGTTTCTCAGGTGG + Intergenic
1083121273 11:60514867-60514889 TTAAAACAGTGTTTATGAAGAGG - Intergenic
1084330882 11:68429509-68429531 TCCAGGCTGTGGTTCTGAGGTGG + Intronic
1085806230 11:79639045-79639067 TCCAAACTGTTTTAATTATGAGG - Intergenic
1093220577 12:16415761-16415783 TTCCAACTGTGTGTATGTGGAGG + Intronic
1096468160 12:51859507-51859529 TCCTAACTGTCTTTATGACATGG + Intergenic
1100961697 12:99969167-99969189 TCCACACTGGGTTTTTGTGGGGG + Intronic
1102221285 12:111196417-111196439 GCCAAACTGTTTTTCTGAAGTGG + Intronic
1102601391 12:114033305-114033327 CTCAAACTGTGTCTCTGAGGGGG - Intergenic
1103440601 12:120960031-120960053 TAAAAACTGTCGTTATGAGGCGG + Intergenic
1108400945 13:50042506-50042528 TACAAACAGTGTTTAAGTGGGGG - Intergenic
1110039823 13:70739681-70739703 TCCAAACTGTATTTATAAAAGGG - Intergenic
1110221978 13:73083632-73083654 TCCAAAGTGTGTTTTTGTTGGGG - Intergenic
1112220816 13:97487977-97487999 TCCAAACTTTTTTTTTGAGATGG + Intergenic
1113056932 13:106278279-106278301 CCCAATGTGTGTTTTTGAGGTGG - Intergenic
1114148182 14:20003009-20003031 TCCGAAGTGTGTAGATGAGGGGG - Intergenic
1114256137 14:21002793-21002815 TGTAAACTGGGCTTATGAGGAGG - Intergenic
1116194700 14:41708848-41708870 TTCCAACTGTTTTTATCAGGAGG + Intronic
1117469866 14:56032408-56032430 TGCAAAATGTGTGTTTGAGGAGG + Intergenic
1118660534 14:68004796-68004818 TCTAAACTGTGTATTTTAGGGGG + Intronic
1118798567 14:69167918-69167940 TCAAAACTGTGTATAGGAGGGGG + Intergenic
1118989316 14:70783523-70783545 TCCAAATTCTCTTTGTGAGGTGG + Intronic
1119023698 14:71136270-71136292 TCAAAAATGTGTTGATGAGAGGG - Intergenic
1120526220 14:85579740-85579762 TCAAGACTGTATTTATGAGATGG + Intronic
1120632176 14:86904885-86904907 TCCACACTGCCTTTATGAGCTGG - Intergenic
1121642706 14:95496466-95496488 TCCAAAATGTGTCTGTGAGCTGG + Intergenic
1123104888 14:105836773-105836795 ACCAAAGTGTGTTTATGGGGAGG + Intergenic
1127470216 15:59283291-59283313 TCCACAGTGTGTGTGTGAGGTGG + Intronic
1127713866 15:61628042-61628064 ACCAAATTGTGTCTCTGAGGTGG + Intergenic
1128834478 15:70798098-70798120 TTTAAACTGTGTTTCTAAGGTGG - Intergenic
1130720530 15:86381980-86382002 TCCAAAAGGTATTTAGGAGGTGG + Intronic
1136298879 16:29320090-29320112 TCCAAACTGTGTTTGTGAGGGGG + Intergenic
1136298899 16:29320288-29320310 TCGAAACTGTGTTTGTAAGGGGG + Intergenic
1140543036 16:75777330-75777352 TCCAAACTCATTCTATGAGGTGG + Intergenic
1142060558 16:88026641-88026663 TCCAAACTGTGTTTGTGAGGGGG + Intronic
1142060563 16:88026692-88026714 TCCAAACTGTGTTTATGAGGGGG + Intronic
1142060579 16:88026843-88026865 TCGAAACTGTGTTTGTGAGGGGG + Intronic
1144538123 17:16111814-16111836 TGTTAACTGTGTTTCTGAGGAGG + Intronic
1145746387 17:27323344-27323366 GCCATACTGTGATTATGAGGAGG - Intergenic
1149426116 17:56556589-56556611 TCAAAACTGTGTTTCTGAGGGGG - Intergenic
1149976412 17:61270499-61270521 TGCAAACTGTGTATCTGATGAGG - Intronic
1162649142 19:12072545-12072567 TCCAAACTTTATATTTGAGGTGG + Intronic
1164464808 19:28478519-28478541 TCCATCCTGTGTTGATGAGATGG - Intergenic
926258904 2:11238308-11238330 TCCAATCCGTGTACATGAGGTGG - Intronic
928735885 2:34288684-34288706 TACAAACTGTGATTAAGAAGTGG - Intergenic
935096582 2:99950163-99950185 TCCAAACTGAGTTGATGCAGTGG - Intronic
935374671 2:102382706-102382728 CCCCAACTGTGGTTATAAGGTGG - Intronic
935806540 2:106754259-106754281 TCCCATCTGTGTCTATGAGGAGG - Intergenic
937191734 2:120108314-120108336 TCAAACCTGTTTTTATGAGGAGG - Intronic
938579265 2:132631730-132631752 TCCAGATTCTGTTTATGGGGAGG + Intronic
938984161 2:136557073-136557095 TCCAATCTGTGTTTGTGATTTGG + Intergenic
941181964 2:162270319-162270341 TTTAAACTGTGTTTATGACATGG + Intronic
944927654 2:204481360-204481382 TGCAAACTTTGTTTTTAAGGGGG - Intergenic
945616223 2:212071326-212071348 TTTAAACTGTGTTTCTGAGTGGG - Intronic
945999161 2:216466235-216466257 ACCAAAGTTTATTTATGAGGTGG - Intronic
947582778 2:231332000-231332022 ACCATACTGTATTTATGAGAAGG + Intronic
948201779 2:236134426-236134448 TTCAAACTGTGTTTATCACATGG + Intergenic
1169314879 20:4582171-4582193 TCGAAAGTGTGTTAATGAGTTGG - Intergenic
1169692890 20:8352978-8353000 TCCAAACTGGGTTCTTGAAGAGG + Intronic
1170314101 20:15024899-15024921 TACAAATTCTATTTATGAGGAGG - Intronic
1170948749 20:20914958-20914980 TCTAAAGTGTGTTTTTGAGATGG - Intergenic
1176226168 20:64000904-64000926 TCCCAAGTGTGGTTATAAGGGGG + Intronic
1179917621 21:44487968-44487990 TCCCAACTCTGTTTCTGATGGGG + Intergenic
1184755517 22:46513722-46513744 TCCAACCAGTATTTATTAGGAGG - Intronic
949761024 3:7471101-7471123 TTCAAAGTGTTCTTATGAGGTGG - Intronic
950788447 3:15454228-15454250 CCCACACTGGCTTTATGAGGTGG - Intronic
952993733 3:38856255-38856277 TCCATACTGTGTTCCTGTGGGGG - Intronic
954055355 3:48018843-48018865 TACAAACTGTGTTTAGAAAGTGG - Intronic
955041850 3:55325060-55325082 TTTATACTGTGTTTATGGGGTGG + Intergenic
955320708 3:57972340-57972362 TCCAAACTGGGATTTTGAGGGGG - Intergenic
956883193 3:73532004-73532026 TCCAAACTTTTTTTTTGAGACGG + Intronic
962079212 3:132119237-132119259 CCCAAAGTGTGTTTATAAGTAGG - Intronic
962528752 3:136259035-136259057 TCCTAACTGTCTTTTTGAGGGGG + Intronic
962546148 3:136437926-136437948 TCCAAACAATGTTTATGAAAGGG + Intronic
963462217 3:145630477-145630499 TACATTCTGTGTTTATGAGTTGG + Intergenic
965512026 3:169578925-169578947 TTCAGTCTGTGTTTATTAGGAGG - Intronic
967227074 3:187302233-187302255 ACCAAAGTCTGTTTATTAGGGGG + Intergenic
967644341 3:191902948-191902970 TCCACACAGTGTTTATTATGTGG + Intergenic
974146114 4:57949493-57949515 TACAAATTGTATTTATCAGGTGG - Intergenic
974249501 4:59366230-59366252 TACAAACTTTGATGATGAGGTGG - Intergenic
979723237 4:123928304-123928326 ACCTAACTGTGTTTTTGTGGAGG - Intergenic
982491323 4:156033157-156033179 TCCAAACTGTCTTTCTAAAGTGG + Intergenic
985910875 5:2880943-2880965 TCCAAACTCATTTTATGAGATGG + Intergenic
990238809 5:53796720-53796742 TCCACACTGTGGGTATGGGGAGG - Intergenic
990533807 5:56700207-56700229 TCTAAACTCTGTTGATGCGGTGG - Intergenic
991590999 5:68251359-68251381 TATAAACTGTGTTGATGAGTTGG + Intronic
991976412 5:72187616-72187638 TTAAAACTGTCTTTCTGAGGTGG + Intronic
992090766 5:73314154-73314176 TCCCAACTGTGTGGATGTGGAGG - Intergenic
992825139 5:80542085-80542107 TCAAAACTATTTTTATGAAGGGG - Exonic
993339435 5:86705000-86705022 TCCAAATTGTGTTTAGGAATTGG + Intergenic
995616934 5:113975122-113975144 TGCAAACTGTGTTGTTGAGGTGG - Intergenic
996103185 5:119466311-119466333 TCCAAACTCATTCTATGAGGTGG - Intronic
996598537 5:125233373-125233395 TCCATAATGAATTTATGAGGAGG + Intergenic
997410382 5:133686535-133686557 TCCATGCTGTGTTAATGGGGTGG - Intergenic
997697446 5:135872805-135872827 GGCAAACTGTGATGATGAGGAGG - Intronic
998049779 5:139022748-139022770 CCCAAACTGTTCTTATGAAGAGG + Intronic
1000314636 5:160077556-160077578 TCCAAATTGTGTTTGTGGGGTGG + Intronic
1000848981 5:166316722-166316744 ACCAAAATGTGGTTATGTGGTGG + Intergenic
1000977134 5:167777463-167777485 TCCAATCAGTGTTTGGGAGGTGG + Intronic
1003086671 6:3065681-3065703 GCCAAAGTGTGAATATGAGGGGG - Intronic
1004144156 6:13048843-13048865 TTCAAACTGTGTTCATAAGTTGG + Intronic
1008207448 6:48680106-48680128 TCCAAAATGTGTATCTGAGATGG - Intergenic
1008723319 6:54385630-54385652 TCCAAACTCATTTTATGAAGCGG + Intronic
1013432835 6:110070508-110070530 TCCAAACTGTGTGAGTTAGGAGG + Intergenic
1014869246 6:126571324-126571346 TACAAATTGAGTTTATGAGGAGG - Intergenic
1015669650 6:135673941-135673963 GTCAAACTGTGTTTCTTAGGGGG + Intergenic
1020594601 7:10190252-10190274 TCTAAACTGTTTTCTTGAGGTGG - Intergenic
1022190442 7:28012570-28012592 TCCTATCTGTCTTTAAGAGGAGG - Intronic
1032548672 7:132764364-132764386 CCCAAACTGTTTTTTTGAAGCGG - Intergenic
1034198537 7:149266258-149266280 TCCGAAGTGTGTTTTTGAGGTGG + Intronic
1034260839 7:149754278-149754300 TGTAAACTGTGTTTATGTGTCGG - Intergenic
1034597718 7:152214551-152214573 TAGAAACTGTGGTTAAGAGGGGG - Intronic
1037345838 8:17900418-17900440 TCCACAATGTGTCTCTGAGGGGG - Intronic
1040113962 8:43593100-43593122 TCCAAAATGTGTTTTTGAAGAGG - Intergenic
1041220506 8:55646781-55646803 TCCTAAATGTGTTTTTGTGGTGG + Intergenic
1043603484 8:81970623-81970645 TCCAAAATGTGATTGTAAGGAGG - Intergenic
1044290356 8:90461775-90461797 TCCACAATGTCTCTATGAGGTGG + Intergenic
1046621349 8:116531923-116531945 TCCACACTGCTTTTATGAGCTGG + Intergenic
1047974271 8:130113673-130113695 TCCAAACTGTCTTTACTAGCTGG + Intronic
1048469301 8:134693097-134693119 TCCTAGCTGTGTTTCTGAGAGGG + Intronic
1053235054 9:36446017-36446039 CCAAAACTTTGTTTAAGAGGCGG - Intronic
1056057835 9:82846554-82846576 TACAAAATGTGCTTATGATGAGG - Intergenic
1058786652 9:108394551-108394573 TCCACACTGCTTTTATGAGCTGG + Intergenic
1059793191 9:117662979-117663001 TACAAACTAGGTTTCTGAGGAGG + Intergenic
1187488251 X:19725034-19725056 TTCTAACTTTGTTTATGAGATGG - Intronic
1189283122 X:39833098-39833120 TCCAAAGTGTGTGTATGTGGTGG - Intergenic
1190251540 X:48730657-48730679 TGAAAACTGTGCTTATGAGACGG - Intergenic
1194663530 X:96652765-96652787 ACCAAACTGTTTTTCTGATGTGG + Intergenic
1200121964 X:153795319-153795341 TCCAGAGTGTGTTTAGGAGGTGG + Intronic