ID: 1142064697

View in Genome Browser
Species Human (GRCh38)
Location 16:88054555-88054577
Sequence GTGATAGCACTGGGAGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 259}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142064697_1142064707 20 Left 1142064697 16:88054555-88054577 CCCACCACTCCCAGTGCTATCAC 0: 1
1: 0
2: 0
3: 23
4: 259
Right 1142064707 16:88054598-88054620 CCAGCACCAGCACCGTCAAGGGG 0: 1
1: 0
2: 0
3: 19
4: 142
1142064697_1142064704 18 Left 1142064697 16:88054555-88054577 CCCACCACTCCCAGTGCTATCAC 0: 1
1: 0
2: 0
3: 23
4: 259
Right 1142064704 16:88054596-88054618 CACCAGCACCAGCACCGTCAAGG 0: 1
1: 0
2: 2
3: 30
4: 346
1142064697_1142064705 19 Left 1142064697 16:88054555-88054577 CCCACCACTCCCAGTGCTATCAC 0: 1
1: 0
2: 0
3: 23
4: 259
Right 1142064705 16:88054597-88054619 ACCAGCACCAGCACCGTCAAGGG 0: 1
1: 0
2: 0
3: 11
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142064697 Original CRISPR GTGATAGCACTGGGAGTGGT GGG (reversed) Intronic
901132381 1:6970214-6970236 CTGAAATCACTGAGAGTGGTAGG - Intronic
901782539 1:11603235-11603257 GTGAGCGGACTGTGAGTGGTAGG + Intergenic
904592677 1:31623750-31623772 GTGAGAGCACGGGGTATGGTTGG + Intronic
904849677 1:33447868-33447890 GTGAGAGCACTGGCAGGAGTTGG - Intergenic
905276101 1:36819270-36819292 GTGGTGGCCCTGGGAGTGGAAGG - Intronic
905451869 1:38062206-38062228 GTGAAACCACAGGGAGTGTTCGG - Intergenic
906964991 1:50447570-50447592 CTGATAGCACTGTGAGTTGAAGG + Intronic
909704220 1:78562295-78562317 AAGATAGGGCTGGGAGTGGTGGG + Intergenic
910546377 1:88423396-88423418 ATGATAGCAATAGTAGTGGTGGG - Intergenic
911083467 1:93956724-93956746 GTGATGGCAATGGCAGTGGGAGG + Intergenic
911852738 1:102839380-102839402 GTGATTGGACTGGGAATGGTTGG - Intergenic
912791061 1:112651436-112651458 GTGGTAGCAGTGGGGGTGGTGGG + Intronic
913549763 1:119906380-119906402 GTGCTGGCAGTGGCAGTGGTGGG + Intergenic
915787315 1:158628325-158628347 GTGGGAGCAGTGGCAGTGGTGGG - Intronic
915870798 1:159557710-159557732 GCGATAGCCATGGGAGAGGTCGG - Intergenic
916889429 1:169102215-169102237 GTGTCATCAGTGGGAGTGGTAGG - Intergenic
917408434 1:174733919-174733941 GTGGGAGCAGTGGGAATGGTAGG + Intronic
919313528 1:195942771-195942793 GTGATAGCACTGGCAGGGTATGG + Intergenic
920602765 1:207346120-207346142 GTGATGGCAGTAGTAGTGGTGGG + Intronic
922722515 1:227906082-227906104 GTTCTAGCACTGGGAGTTGGCGG - Intergenic
922902652 1:229148554-229148576 CTGACAGCACTGGGAGTCCTGGG + Intergenic
924171272 1:241343678-241343700 GTGATTGCAATGGGACTGGTAGG + Intronic
1062957408 10:1549360-1549382 TTGAAAGCCCTGGGAGTGGATGG + Intronic
1063088958 10:2844523-2844545 GAGCTATCACTGGAAGTGGTGGG - Intergenic
1064277308 10:13917885-13917907 CTGATAGCACGGGGAGTATTAGG + Intronic
1064481507 10:15744866-15744888 CTGATCGCAATGGGAGTGGAGGG - Intergenic
1064717386 10:18190738-18190760 GTGGTAGCAGTAGGAGTGATGGG + Intronic
1067516137 10:46946424-46946446 GTGATGACAATGGGAGTGGGTGG + Intronic
1067646111 10:48105386-48105408 GTGATGACAATGGGAGTGGGTGG - Intergenic
1070437526 10:76408033-76408055 GAGATAACACTGGGAGGAGTAGG - Intronic
1070553947 10:77514000-77514022 GTGCTGGCACTGGGAGTGACAGG - Intronic
1072517729 10:96202381-96202403 GTGGAAGCAGTGAGAGTGGTTGG + Intronic
1072723056 10:97792523-97792545 GTGGTAGCCCTGGGAGTGCACGG + Intergenic
1073099753 10:101000272-101000294 GTGATTGCTCAGGGAGTGCTGGG + Exonic
1073338845 10:102729964-102729986 GTGATGGCCCCGGGAGTGGTGGG + Intronic
1073638257 10:105221380-105221402 GTGATGGCAGTGGTGGTGGTCGG + Intronic
1073645186 10:105294145-105294167 GTGATGGCAGTAGGAGCGGTGGG - Intergenic
1073645198 10:105294217-105294239 GTGATAGTAGTGGCAGTGTTGGG - Intergenic
1073706648 10:105990652-105990674 GTGCTGGCAGTGGCAGTGGTAGG - Intergenic
1073916548 10:108411424-108411446 GTGATAGCAATGGCTGTAGTGGG - Intergenic
1077091050 11:778415-778437 GTGAGACCACGTGGAGTGGTTGG + Intronic
1079824519 11:25174606-25174628 GTGATGGCAGTAGCAGTGGTGGG + Intergenic
1081244443 11:40746919-40746941 GTGATAACAGTGGCAGTGGCAGG - Intronic
1082191792 11:49254124-49254146 GTGAAAGGACTGGAAGTGTTCGG - Intergenic
1083226856 11:61290776-61290798 GTGAGACGCCTGGGAGTGGTGGG - Intronic
1083686109 11:64376296-64376318 GTGTAACCACAGGGAGTGGTGGG - Intergenic
1086123468 11:83326135-83326157 GTGATAGCAGTGGCTGTGATGGG + Intergenic
1086612922 11:88778467-88778489 TTGATCTCACTGGGACTGGTTGG - Intronic
1086674330 11:89586892-89586914 GTGAAAGGACTGGGAGTGTTAGG + Intergenic
1087481419 11:98705765-98705787 GTGACAGAACAGGGAGTGGCAGG + Intergenic
1087503674 11:98993397-98993419 GTGATAGCAGTAGTTGTGGTGGG + Intergenic
1089561342 11:119344805-119344827 TTGACAGGACTGGGAGTGGGTGG + Intronic
1089568761 11:119388251-119388273 GTGACAGCACAGACAGTGGTGGG - Intergenic
1093060640 12:14599206-14599228 GGGAAAGCACTGAGAGTGGATGG - Intergenic
1093750867 12:22798575-22798597 GTGATATCACTGGATCTGGTAGG - Intergenic
1094169712 12:27479266-27479288 GTGATGGCAGTGGGTGGGGTAGG + Intronic
1095180326 12:39140634-39140656 GTGATAGCTCTATAAGTGGTTGG - Intergenic
1095491815 12:42742961-42742983 CTGTTAGCTCTGGGAGGGGTGGG + Intergenic
1095910838 12:47424803-47424825 GTGATATCACTAGCAGTGGTGGG - Intergenic
1096245140 12:49980565-49980587 GTGATCACACTGGGAGAGTTGGG + Intronic
1098204564 12:68094308-68094330 GTGATAGCTGGGGTAGTGGTTGG + Intergenic
1098394902 12:70006694-70006716 GTGATGGCAATAGCAGTGGTAGG - Intergenic
1098404505 12:70109407-70109429 GTGATGGCATTAGCAGTGGTGGG - Intergenic
1099289327 12:80755967-80755989 GTGATAGCAGTGGAGGTGGTAGG - Intergenic
1101030719 12:100656168-100656190 GTGAAAGGACTGGGAGGGGATGG - Intergenic
1101301764 12:103489964-103489986 GTCATCTCACTGGGACTGGTTGG - Intronic
1102018120 12:109661941-109661963 GTGGTAGGAATGGTAGTGGTAGG - Intergenic
1105805557 13:23949991-23950013 CTCATAGCACTGGGGGTGCTGGG + Intergenic
1106525727 13:30539703-30539725 CTGATAGTACGGGGAGTGGTGGG + Intronic
1107257443 13:38445453-38445475 GTGATAGCTCTAGAGGTGGTGGG - Intergenic
1107599409 13:41997943-41997965 GTGATGGCAGTGGTGGTGGTAGG + Intergenic
1107671796 13:42753923-42753945 GAGATTGCACAGGGAGCGGTGGG - Intergenic
1108030269 13:46221918-46221940 GAGATTGTACTGGGAGTGGAAGG + Intronic
1108065695 13:46575398-46575420 GTGATAGAACTGGGCGTGGGAGG + Intronic
1108632895 13:52303347-52303369 GTGATGGCAGTGGGGCTGGTGGG + Intergenic
1108653802 13:52509250-52509272 GTGATGGCAGTGGGGCTGGTGGG - Intergenic
1109005446 13:56869743-56869765 GTGATAGCACTGAAAGTTCTGGG + Intergenic
1109386864 13:61641143-61641165 GAGAAAGGACTGGGAGAGGTTGG + Intergenic
1109548538 13:63860805-63860827 GTGGCAGCAGTGGGAGGGGTAGG - Intergenic
1111611201 13:90609830-90609852 GTGCCAGCACAGGGTGTGGTAGG - Intergenic
1111957717 13:94776357-94776379 GTTACAGCACTGGGTGTGGCAGG + Intergenic
1113082063 13:106530660-106530682 GTCATAGGAATGGGAGTGGCAGG - Intronic
1113425371 13:110203437-110203459 GTGAGAGCGCTGGGAGAGGAAGG - Intronic
1113536963 13:111075952-111075974 GTGCCAGCAGTGGGAGAGGTAGG + Intergenic
1113536981 13:111076025-111076047 GTGATGGCAGTAGCAGTGGTGGG + Intergenic
1115146620 14:30234104-30234126 GTGATAACAGAGGAAGTGGTAGG - Intergenic
1116944127 14:50820090-50820112 GTGATAGTCCTGAGAGTGGGGGG - Intronic
1117904672 14:60572129-60572151 GAAATAGCACTGGGACTGGTCGG - Intergenic
1118652574 14:67913175-67913197 GTGACAGCAGTGGAAATGGTAGG - Intronic
1120392359 14:83924688-83924710 GTGATGGCAGTAGGAGTGATGGG - Intergenic
1120740617 14:88105632-88105654 GTGCCAGCAATGGCAGTGGTGGG + Intergenic
1120763445 14:88306606-88306628 GTGATAGCAGTGGGGATGATGGG - Intronic
1202881894 14_KI270722v1_random:68000-68022 GTGTTAGCACTGGGACAGATGGG - Intergenic
1125239586 15:37558492-37558514 GGGAGGGCACTGGCAGTGGTGGG - Intergenic
1125920184 15:43520774-43520796 GTGGTAGCACTGGCAAGGGTGGG - Intronic
1127047514 15:55043000-55043022 GTGCCAGCAGTGGCAGTGGTGGG + Intergenic
1132022982 15:98380608-98380630 ATGTTAGCAGTGGGAGTGGTTGG + Intergenic
1133153755 16:3857103-3857125 CTGATAGCTCTGAGAGTGGCAGG - Intronic
1134306477 16:13037630-13037652 GTGATAACAGTGTGAGTGGAAGG - Intronic
1136994850 16:35182481-35182503 GTGCTAGCCCTTGGAGAGGTGGG - Intergenic
1138582034 16:57947987-57948009 AGGATAGCACTGTGAGTGTTAGG - Intronic
1138660921 16:58516344-58516366 GTGAGAGCCTTGGGAGGGGTTGG + Intronic
1140031936 16:71345788-71345810 TTGATAGCACTGGGAGGTCTGGG - Intergenic
1140616922 16:76676317-76676339 CTGAAAGCTCTTGGAGTGGTAGG + Intergenic
1142064697 16:88054555-88054577 GTGATAGCACTGGGAGTGGTGGG - Intronic
1143372672 17:6449986-6450008 TTGATGCCACTGGGTGTGGTGGG - Intronic
1144261343 17:13524727-13524749 GTGATAACATTGGGAGAGGCTGG + Intronic
1147048405 17:37771992-37772014 GTGGTAGGAGTGGCAGTGGTAGG - Intergenic
1147743851 17:42683382-42683404 GTGCTAGCACTGGCTGAGGTTGG + Intronic
1149644167 17:58227742-58227764 GTGTTGGCACTAGGAGTGGCTGG - Intronic
1150218582 17:63483576-63483598 GTGACAGTACTGGGGGTGGGTGG - Intergenic
1151582663 17:74988899-74988921 ATGACATCACTGGGAGTGGGGGG + Intronic
1151765018 17:76128923-76128945 GTGAAAGAACTGAAAGTGGTTGG + Intergenic
1152634685 17:81425970-81425992 GTGATAGTGGTGGGTGTGGTTGG + Intronic
1153056207 18:949354-949376 GTGCTGGCAGTGGCAGTGGTGGG + Intergenic
1159420746 18:68216381-68216403 GGGGTGGGACTGGGAGTGGTTGG + Intergenic
1159860828 18:73647305-73647327 GTGCTAGTAGTGGGAGTAGTGGG + Intergenic
1161381077 19:3965200-3965222 GGCATAGCCCTGGGAGGGGTGGG - Intronic
1161836606 19:6651796-6651818 GAGAGACAACTGGGAGTGGTGGG + Intergenic
1163576629 19:18114699-18114721 GTGATAGCATTGGGGGTTGGGGG + Intronic
1164403786 19:27923728-27923750 GTGATAGCTCGTGGAGTGGGTGG + Intergenic
1165036858 19:33040011-33040033 GTGAGACAACAGGGAGTGGTGGG - Intronic
1165730880 19:38143884-38143906 CTGAGGGCTCTGGGAGTGGTGGG - Intronic
1167788382 19:51654864-51654886 TTGATGGCAATGGAAGTGGTGGG + Intergenic
1202657507 1_KI270708v1_random:37099-37121 GTGTTAGCACTGGGACAGATGGG - Intergenic
925421066 2:3712262-3712284 GTGATGCCACTGGGAGTGACGGG - Intronic
926906032 2:17806532-17806554 GGGAAAGCACTAGAAGTGGTAGG + Intergenic
928067122 2:28175728-28175750 GTGCCAGCAGTGGCAGTGGTAGG - Intronic
930903633 2:56539077-56539099 CTTATAGCACTGGAAGTTGTAGG - Intergenic
931085052 2:58820665-58820687 GTTATAGCTCTGGGCCTGGTGGG + Intergenic
931521776 2:63105955-63105977 ATGCTGGCACTGGCAGTGGTAGG + Intergenic
931521794 2:63106028-63106050 GTGATGGTAGTGGCAGTGGTGGG + Intergenic
933771764 2:85749145-85749167 GTGCTAGCACTGTGAATGGGAGG + Intergenic
934028328 2:88018897-88018919 GTGCCAGCACTTGGAGTGGCTGG - Intergenic
935391568 2:102558636-102558658 GTGATTGCACTGGGCCTGCTTGG - Intergenic
936051451 2:109227146-109227168 CTGATGGCAGTGGCAGTGGTTGG + Intronic
936995425 2:118409387-118409409 TTGATCTCACTGGGACTGGTTGG + Intergenic
937429388 2:121825695-121825717 GAGATTGCACAGGAAGTGGTGGG + Intergenic
937889917 2:126930981-126931003 GTGATGGCAGTAGCAGTGGTAGG + Intergenic
939232947 2:139454416-139454438 GTGATTGCATTGGCAATGGTGGG + Intergenic
939376490 2:141375375-141375397 AAGCTAGCAGTGGGAGTGGTGGG + Intronic
939580571 2:143941282-143941304 GTAAGACCACAGGGAGTGGTGGG + Exonic
939794101 2:146619682-146619704 GTGATTGCAGTGGGATTGCTGGG - Intergenic
940362621 2:152812888-152812910 GTGATGGCAGTAGCAGTGGTGGG + Intergenic
940653203 2:156457834-156457856 GTATTAGCAGTGGGAGTTGTTGG + Intronic
942362428 2:175186139-175186161 TTGATAGATCTGGGAGTGTTAGG - Intergenic
942530915 2:176909379-176909401 GTGAGAGCACAGGTAATGGTGGG - Intergenic
942601613 2:177646200-177646222 ATGATAGAGTTGGGAGTGGTGGG + Intronic
942926600 2:181440476-181440498 GTCATAGAACAGGGAGTGGTGGG - Intergenic
943476177 2:188358345-188358367 GGGATAGGATAGGGAGTGGTTGG + Intronic
943815495 2:192249279-192249301 GTGGTAGCAATGGATGTGGTGGG - Intergenic
947125001 2:226859585-226859607 GTGGTAGCTCTGGGTGTTGTTGG + Intronic
949045510 2:241871062-241871084 GGGAGAGCACTGGGAGGGATTGG - Intronic
1169654160 20:7903793-7903815 GTGATAGCAGTGGTGGTGGGTGG + Intronic
1171428319 20:25062521-25062543 CTGAGTGCACAGGGAGTGGTTGG - Intergenic
1172790148 20:37498216-37498238 GGGATATCTCTGGGAGTGATTGG - Intronic
1175319387 20:58074606-58074628 TTGATGGCAGGGGGAGTGGTGGG + Intergenic
1175803653 20:61815150-61815172 GAGATAGGACTGGGGGAGGTGGG + Intronic
1176289807 21:5037939-5037961 GGGACAGCATGGGGAGTGGTGGG - Intronic
1176597388 21:8759444-8759466 GTGTTAGCACTGGGACAGATGGG - Intergenic
1176735957 21:10547445-10547467 GTGATGGCAGTGGGGCTGGTGGG - Intronic
1177204372 21:17994678-17994700 GTGACAGCAGTGGCAGTGGCAGG + Intronic
1178758180 21:35373285-35373307 GTGAGAGCACAGGGGGTGGGGGG - Intronic
1179152293 21:38819407-38819429 ATGATTGCACTGGTAGTGGTTGG + Intronic
1179867423 21:44225648-44225670 GGGACAGCATGGGGAGTGGTGGG + Intronic
1180235249 21:46455203-46455225 GTGATAGCACTGGGGATGATAGG - Intergenic
1180369719 22:11973810-11973832 GTGTTAGCACTGGGACAGATGGG + Intergenic
1180376520 22:12098295-12098317 GTGTTAGCACTGGGACAGATGGG - Intergenic
1180421053 22:12815390-12815412 GTGTTAGCACTGGGACAGATGGG + Intergenic
1182685040 22:32115956-32115978 GTGATAGACTTGGGATTGGTTGG - Intergenic
1183641598 22:39096245-39096267 CAGATAGCACTGGGAGGGGAGGG - Intergenic
1183758988 22:39798801-39798823 GTGATGGCAGTAGCAGTGGTGGG + Intronic
1184001534 22:41677925-41677947 GGGATAGGAATGGCAGTGGTGGG - Intronic
951483884 3:23190896-23190918 GTGATATCTATGGGAGTGGAAGG + Intergenic
951650396 3:24945436-24945458 GTGATAGCAGTGGGAGTTTGAGG + Intergenic
953146318 3:40279059-40279081 GTGCTCACACTGGCAGTGGTTGG + Intergenic
955067309 3:55544400-55544422 GTGATAGAGCTGGGGGTGGGAGG - Intronic
955961619 3:64346551-64346573 GTGGTAGCAATGGAAGTGGTGGG + Intronic
956280121 3:67547097-67547119 GTGATAGTACTGGGAGGTGGGGG + Intronic
956782821 3:72617794-72617816 GAGAGAGCACTGGGAGAAGTGGG - Intergenic
957671814 3:83314865-83314887 GTGATAGCACTAGGACTAGAAGG - Intergenic
958257522 3:91341558-91341580 TTGATCTCACTGGGACTGGTGGG - Intergenic
959247721 3:103896457-103896479 GTAATACCATTGGGAATGGTAGG + Intergenic
960346468 3:116539126-116539148 GTGTTTGCACTGGCAGTAGTGGG - Intronic
960784457 3:121356704-121356726 TTCATCTCACTGGGAGTGGTTGG - Intronic
961448630 3:126992508-126992530 GTAGTTGCCCTGGGAGTGGTGGG + Intronic
961469481 3:127102248-127102270 GTGAGACTACAGGGAGTGGTGGG + Intergenic
962316091 3:134360372-134360394 GTGGTAGCAGTGGCAGTGGTGGG - Exonic
962781843 3:138726495-138726517 GTGGTAGCAGTGGCAGTGGCAGG - Intronic
963976236 3:151483616-151483638 GTCATCTCACTGGGACTGGTTGG + Intergenic
964704193 3:159601222-159601244 GTGATAGCAGTAGCAGTGGTGGG + Intronic
964885053 3:161472472-161472494 GCGCTAGCATTGGAAGTGGTTGG + Intergenic
965427121 3:168540842-168540864 GAGAGAGGAATGGGAGTGGTGGG - Intergenic
965635508 3:170776344-170776366 GTTATAGCACTGAGAATGGAAGG - Intronic
966091449 3:176143479-176143501 CTGATAGCAGTGGGGGTGATAGG - Intergenic
966694561 3:182777161-182777183 GTGATGGCAGTAGCAGTGGTGGG + Intergenic
967944921 3:194797028-194797050 GTGCTGGCAGTGGCAGTGGTGGG + Intergenic
968869062 4:3232160-3232182 GGGATAGCACAGGGTGAGGTGGG + Intronic
968904192 4:3444096-3444118 GTGATAGGACTGGGGGTCCTGGG - Exonic
970493890 4:16606034-16606056 GTGAAGGCACTGAGATTGGTGGG - Intronic
973360688 4:49161663-49161685 GTGTTAGCACTGGGACAGATGGG - Intergenic
973555948 4:52083160-52083182 GTGATGGAACTGGTAGTGCTTGG + Intronic
977008879 4:91610558-91610580 GTGATAGCAGGGAGAGTGTTAGG + Intergenic
977901968 4:102432801-102432823 GAGATAGCATTGGGGGTGGAAGG + Intergenic
978096118 4:104780385-104780407 GTGCCAGCAATGGTAGTGGTGGG + Intergenic
979320358 4:119316067-119316089 GTGATAGCAGTGGAAGTGATGGG + Intergenic
980798034 4:137711046-137711068 GTGATAGCAATAGCAGTGGTGGG + Intergenic
983191623 4:164760392-164760414 GTGGTTGCAATGGAAGTGGTGGG + Intergenic
1202758121 4_GL000008v2_random:83728-83750 GTGTTAGCACTGGGAGAGATGGG - Intergenic
987901066 5:24012881-24012903 GTGATGGCACTAACAGTGGTGGG + Intronic
988524252 5:31972785-31972807 GTGGTACAACAGGGAGTGGTGGG - Intronic
988618040 5:32794136-32794158 CTGCTAGCACTGGGAGTAGGAGG - Intergenic
989175543 5:38521682-38521704 GTGATGGCAGTAGCAGTGGTAGG + Intronic
989211968 5:38865752-38865774 GTGCCAGCAGTGGCAGTGGTAGG + Intronic
989390480 5:40895478-40895500 TTCATATCACTGGGATTGGTTGG + Intergenic
992556522 5:77908996-77909018 GTGACAGCACTTCAAGTGGTGGG + Intergenic
995480267 5:112586138-112586160 GTCATCTCACTGGGACTGGTTGG + Intergenic
996789505 5:127277620-127277642 GCTGTGGCACTGGGAGTGGTTGG + Intergenic
997842751 5:137257080-137257102 GCAGTAACACTGGGAGTGGTGGG - Intronic
998423328 5:142006725-142006747 GGGGTAGAACTGGGAGTGGATGG - Intronic
1003719118 6:8680811-8680833 GTGATAGCACAGGGAATGTATGG + Intergenic
1005798191 6:29390782-29390804 GTGATGGCAGTAGCAGTGGTGGG + Intronic
1006009495 6:31030593-31030615 CTGATTGCAATGGAAGTGGTGGG - Intronic
1007783403 6:44266746-44266768 CTGATAGCACTTGGAATAGTGGG - Intergenic
1009408788 6:63341349-63341371 GTGTAGGCACTGGCAGTGGTGGG + Intergenic
1009505098 6:64468022-64468044 GTGCTGGCAGTGGCAGTGGTGGG - Intronic
1009866551 6:69405273-69405295 GTGATTGTACTAGGAATGGTGGG - Intergenic
1013809516 6:114028572-114028594 TTGTTAGAACTGGGAGTGGAAGG - Intergenic
1014860695 6:126464433-126464455 GTCAGTGCACTGGGAGAGGTAGG + Intergenic
1014960604 6:127679490-127679512 GAGAAGGCACTGAGAGTGGTTGG - Intergenic
1016026052 6:139288172-139288194 GAGATAAAACTGGGACTGGTTGG + Intronic
1016856090 6:148671730-148671752 TTCATTGCACTGGGACTGGTTGG - Intergenic
1017256604 6:152340509-152340531 TTGTTACAACTGGGAGTGGTGGG - Intronic
1017983385 6:159422006-159422028 GTGACAGAGCTGGGAGTGGCTGG - Intergenic
1018106279 6:160490265-160490287 GAGATAGCACTGGGGGCGGTTGG - Intergenic
1019223254 6:170491519-170491541 GTTATAGCAGTGGTGGTGGTAGG - Intergenic
1022549933 7:31228819-31228841 GTGATGTCAGTGGTAGTGGTGGG + Intergenic
1023651254 7:42371456-42371478 TTGATCTCACTGGGACTGGTTGG - Intergenic
1024223525 7:47305988-47306010 GTGATAGTCCTGTGAGTTGTAGG - Intronic
1024262013 7:47580508-47580530 GTGGTAGCACAGGGGGTGGGGGG - Intronic
1024611597 7:51069433-51069455 GTGTTAGCTGTGGGATTGGTGGG + Intronic
1026451971 7:70537295-70537317 GTTGTAGTACTGGGAGTGGATGG - Intronic
1027338750 7:77182888-77182910 GTGGGAGGCCTGGGAGTGGTGGG - Intronic
1029021046 7:97364835-97364857 GTGATGGCAGTAGCAGTGGTGGG - Intergenic
1030359101 7:108576639-108576661 GTGGCAGCAGTGGAAGTGGTAGG + Intergenic
1033659751 7:143395245-143395267 GTGAAACCACTGGAAGTGGAGGG - Intronic
1034433578 7:151052578-151052600 GTGACGGCACAGGGAGGGGTGGG - Exonic
1036509007 8:9383295-9383317 GTGGAAGCAGTGGAAGTGGTGGG - Intergenic
1040290607 8:46122173-46122195 GCGAGATCACTGGGAGTGCTGGG - Intergenic
1040345153 8:46485328-46485350 GTGATTGGGCTGGGAATGGTAGG + Intergenic
1040585646 8:48738494-48738516 GAGTTGCCACTGGGAGTGGTTGG - Intergenic
1041394206 8:57374877-57374899 GTGATCTGGCTGGGAGTGGTGGG - Intergenic
1041471388 8:58212656-58212678 GTGCTAGAAATGGCAGTGGTGGG - Intergenic
1041715041 8:60924706-60924728 GGGATAGGACTGGGAGGGGCTGG - Intergenic
1044822654 8:96165847-96165869 ATGACAGCACTGAGATTGGTAGG + Intergenic
1045760776 8:105604297-105604319 AGGATAGCTCTGGAAGTGGTGGG - Intronic
1047448285 8:124939040-124939062 GCGATGGCCCTGGGAGGGGTGGG - Intergenic
1047830206 8:128621229-128621251 GTGGTAGGATCGGGAGTGGTAGG + Intergenic
1048187835 8:132260574-132260596 GTGAAGGCATTGGGAGTGGGTGG + Intronic
1048624298 8:136167752-136167774 GGGATAGCACTGGGAGATGATGG + Intergenic
1049856521 8:144865355-144865377 GTGATGGCAGTTGGGGTGGTAGG + Intergenic
1055430084 9:76234379-76234401 GTGAGACAACTGGGAATGGTGGG - Intronic
1060200359 9:121648864-121648886 GTGGTAGCAATGGTGGTGGTGGG + Intronic
1061049325 9:128185310-128185332 ATGATAGTACTGGTAGTGTTTGG + Intronic
1061988275 9:134143062-134143084 GGAAGGGCACTGGGAGTGGTGGG + Intronic
1203538910 Un_KI270743v1:68600-68622 GTGTTAGCACTGGGACAGATGGG - Intergenic
1203555905 Un_KI270743v1:207913-207935 GTGTTAGCACTGGGACAGATGGG + Intergenic
1185997321 X:4966138-4966160 ATGAGAGCAATGGGAGTGGCTGG - Intergenic
1188711563 X:33406593-33406615 GAGATAGCACTGGGGGGAGTGGG + Intergenic
1188722917 X:33544581-33544603 GTGTCAGCAGTGGCAGTGGTAGG - Intergenic
1189609792 X:42720073-42720095 GACATATCACTGGGAGTGGCTGG + Intergenic
1189698212 X:43687883-43687905 GGGATAGCAGTGGAAGTGGTGGG - Intronic
1190534898 X:51416796-51416818 CAGATGGCACTGGGAGTAGTTGG - Intergenic
1190892972 X:54587024-54587046 GTGATAGCAATCGAAGTGGTGGG - Intergenic
1190970607 X:55343787-55343809 GTCATCTCACTGGGACTGGTTGG + Intergenic
1192491184 X:71578695-71578717 GTGGTAGCATTGGGGGAGGTGGG + Intronic
1192545412 X:72008797-72008819 GTGATAGCAGTGGAGGTGGCAGG - Intergenic
1193406637 X:81108799-81108821 GTGTTACCATTGGCAGTGGTGGG + Intergenic
1194254889 X:91623750-91623772 GTGATGGCAGTAGTAGTGGTGGG + Intergenic
1198299141 X:135317540-135317562 GTGATGGCAGTGGTGGTGGTGGG + Intronic
1199640625 X:149858009-149858031 GGGAAAGCACTGAGAGTGGATGG + Intergenic
1200573674 Y:4863353-4863375 GTGATGGCAGTAGTAGTGGTGGG + Intergenic
1202594245 Y:26520603-26520625 GTGATGGCAGTGGGGCTGGTGGG - Intergenic