ID: 1142066389

View in Genome Browser
Species Human (GRCh38)
Location 16:88065364-88065386
Sequence GAGACTCCTCCCAGCCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 305}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142066389_1142066391 8 Left 1142066389 16:88065364-88065386 CCTCTGTGGCTGGGAGGAGTCTC 0: 1
1: 0
2: 2
3: 33
4: 305
Right 1142066391 16:88065395-88065417 AAGACCCCCGCGATGACACTGGG 0: 1
1: 0
2: 0
3: 14
4: 84
1142066389_1142066396 17 Left 1142066389 16:88065364-88065386 CCTCTGTGGCTGGGAGGAGTCTC 0: 1
1: 0
2: 2
3: 33
4: 305
Right 1142066396 16:88065404-88065426 GCGATGACACTGGGCCCACCTGG 0: 2
1: 3
2: 49
3: 202
4: 494
1142066389_1142066390 7 Left 1142066389 16:88065364-88065386 CCTCTGTGGCTGGGAGGAGTCTC 0: 1
1: 0
2: 2
3: 33
4: 305
Right 1142066390 16:88065394-88065416 AAAGACCCCCGCGATGACACTGG 0: 1
1: 0
2: 2
3: 17
4: 89
1142066389_1142066397 26 Left 1142066389 16:88065364-88065386 CCTCTGTGGCTGGGAGGAGTCTC 0: 1
1: 0
2: 2
3: 33
4: 305
Right 1142066397 16:88065413-88065435 CTGGGCCCACCTGGCCATCCAGG 0: 1
1: 0
2: 7
3: 44
4: 469
1142066389_1142066398 27 Left 1142066389 16:88065364-88065386 CCTCTGTGGCTGGGAGGAGTCTC 0: 1
1: 0
2: 2
3: 33
4: 305
Right 1142066398 16:88065414-88065436 TGGGCCCACCTGGCCATCCAGGG 0: 1
1: 0
2: 2
3: 22
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142066389 Original CRISPR GAGACTCCTCCCAGCCACAG AGG (reversed) Intronic
900001081 1:15219-15241 GAGCCACCTCCCAGCCACCTCGG + Intergenic
900020796 1:185740-185762 GAGCCACCTCCCAGCCACCTCGG + Intergenic
900109738 1:1000397-1000419 GAGACTCCGCCCAGCCCCGGGGG - Intergenic
900209921 1:1450405-1450427 GAGCCTCCTCCCGTCCACATGGG + Exonic
900343334 1:2199033-2199055 CAGCCTCCTCACAGCCTCAGTGG + Intronic
900426254 1:2580764-2580786 CAGCATCCTCTCAGCCACAGTGG + Intergenic
900660376 1:3779106-3779128 GAGTCCCCTCCCTCCCACAGTGG + Exonic
900759565 1:4461866-4461888 GAGCCTCCTGCCAGCTGCAGTGG - Intergenic
901000053 1:6144432-6144454 GGGATTCATCCCTGCCACAGAGG - Intronic
901161075 1:7177124-7177146 GAGGCTCCTCCCACACACCGAGG + Intronic
902821904 1:18948588-18948610 GAGTGTCCTCCCACCCACACTGG - Intronic
902920534 1:19664209-19664231 GAGACTCTTCTCAGCCAGAGGGG + Intergenic
903031197 1:20465540-20465562 GAGACTTCTCAGAGCCAGAGGGG + Intergenic
903684789 1:25122949-25122971 GAGAGTCCTCTCTGCCAGAGAGG + Intergenic
904605990 1:31697978-31698000 CAGCCTCCTCCCAGCCTCTGGGG - Exonic
907516417 1:54996112-54996134 GAGAAACCTCCTAGGCACAGAGG - Intergenic
907549571 1:55292808-55292830 CACACTCCTCCCACCAACAGAGG - Intergenic
908758832 1:67493394-67493416 GAGACCCATCCCAGCCTCAAAGG + Intergenic
909764195 1:79334321-79334343 CAGTCTCCTCCCAGTCACACAGG - Intergenic
911747280 1:101453735-101453757 GACACTCCTCCCAGCCTCTTGGG + Intergenic
912463834 1:109855675-109855697 GATACTTCTCCCAGCCACTAAGG - Intergenic
912624385 1:111195496-111195518 GAGTCTCCACCCATGCACAGGGG - Intronic
913191087 1:116413587-116413609 GAGCCTCCTCCCAACCCCTGAGG - Intergenic
915039253 1:152954052-152954074 GAAACTCCTCCCAGTCACTTTGG + Intergenic
916912690 1:169367853-169367875 GAGATTACTCCCAGCCACTAAGG - Exonic
917296322 1:173523082-173523104 GGGACTTCTGCCAGGCACAGTGG + Intronic
917668202 1:177246193-177246215 GGGATCTCTCCCAGCCACAGTGG + Intronic
918172829 1:182013976-182013998 GGGATTCCTACCAGCCAAAGTGG + Intergenic
919806003 1:201381407-201381429 GGGCCTGCTCCCAGCCACTGAGG - Exonic
922243937 1:223776678-223776700 GAGGCCCCTCCCATCCGCAGAGG + Intergenic
923543737 1:234908866-234908888 GAGACACGTAACAGCCACAGTGG - Intergenic
924384709 1:243490300-243490322 GAGACTGCTCCCAGGGACTGTGG + Intronic
924466561 1:244303960-244303982 ATGATTCCTCTCAGCCACAGTGG + Intergenic
924778665 1:247128544-247128566 GAGACTCCTCTCGGTCCCAGGGG - Intronic
924782989 1:247169875-247169897 GAGACTCCTCTCGGTCCCAGGGG + Intronic
1062897458 10:1115109-1115131 GAGCCACCTGCCACCCACAGAGG - Intronic
1065033456 10:21612067-21612089 AAGACTCTTCCCAGGCACTGAGG - Intronic
1066153807 10:32653243-32653265 GAGACTCACCCCAGCCCCAAGGG - Intronic
1066199809 10:33133979-33134001 GAGAATCCTAACAGCCAGAGAGG - Intergenic
1068083462 10:52347213-52347235 GAGACTCACCCCTGCCTCAGAGG + Intergenic
1069638262 10:69938571-69938593 GCGACTCCTTCCAGCCACTCAGG + Intronic
1069841556 10:71342681-71342703 CAGTGTCCTCCCAGCCTCAGAGG + Intronic
1069870511 10:71529984-71530006 GAGTCTCCATCCAGCCCCAGAGG - Intronic
1069870957 10:71532585-71532607 GAGTCTCCATCCAGCCCCAGAGG - Intronic
1070733148 10:78845529-78845551 GAGACTCCTGCCATCCTCTGAGG + Intergenic
1073141076 10:101248189-101248211 AAGGCCCCTCCCAGGCACAGTGG - Intergenic
1073328803 10:102657680-102657702 GAGGTTCCTTCCAGCCACGGGGG - Exonic
1073481130 10:103786816-103786838 GAGAGTCCCCCCAGCCTGAGGGG + Intronic
1073546442 10:104353583-104353605 GGGACTCCTCCCAGCCTCTCAGG + Intergenic
1074213439 10:111360408-111360430 GTGCCTCCTACCAGCCAGAGGGG - Intergenic
1074586789 10:114775431-114775453 GAGACACCATCCAGCAACAGAGG - Intergenic
1075077421 10:119360449-119360471 CAGACTCCTCCCACTCACACAGG - Intronic
1075282722 10:121154214-121154236 GAGACTCCTGCTAGAGACAGAGG - Intergenic
1075411530 10:122232015-122232037 GAGACCCCTCCCAGAGACAGTGG + Intronic
1076424645 10:130358987-130359009 GAGAAACCTCCCAGTGACAGAGG + Intergenic
1081592729 11:44436134-44436156 TAGTCACCTCCCAGACACAGTGG + Intergenic
1081603309 11:44510633-44510655 GTGGCTCCACCCAGCCACAAGGG + Intergenic
1083093516 11:60224454-60224476 TAGACTCCTCCCAGCTACAGAGG + Intronic
1083100301 11:60297817-60297839 TAGACTCCTCCCAGCTACAGAGG - Intronic
1083205892 11:61148950-61148972 GAGATTCCTCCCACCCACCAGGG + Intronic
1083324980 11:61868728-61868750 TAGACTCTTCCCAGCCTCTGGGG - Intergenic
1085254355 11:75164104-75164126 CAGGCCCCACCCAGCCACAGGGG + Intronic
1085419742 11:76345764-76345786 GAGACACCTCACAGCCACACAGG + Intergenic
1085718460 11:78893165-78893187 GAAGCTCCTCCCAGGCACTGGGG - Intronic
1085927444 11:81038618-81038640 GAAAAACCTCCCAGCCAAAGTGG - Intergenic
1088633510 11:111797135-111797157 GACACTCCTCCCATCAACAGGGG + Intronic
1088770965 11:113036029-113036051 GAGACTTCTCCCAGGCACCCAGG - Intronic
1089329356 11:117679020-117679042 GGGGCTCCTCCCAGGCTCAGCGG + Intronic
1089343140 11:117773185-117773207 GAGCCAGCTCCCATCCACAGGGG + Intronic
1091374170 12:15334-15356 GAGCCACCTCCCAGCCACCTCGG + Intergenic
1091541986 12:1470266-1470288 AAGTTTCCCCCCAGCCACAGTGG - Intronic
1092236699 12:6815015-6815037 CAGTCTCCTCCCTGCCCCAGGGG + Intronic
1092999650 12:13982178-13982200 GCGCCTCCTCCCGGCCGCAGCGG + Intergenic
1094848390 12:34371471-34371493 GAGGTTCCCCCCAGCCACGGGGG - Intergenic
1104413351 12:128577756-128577778 GAGACTCATCCCAGGCCCTGGGG - Intronic
1104851460 12:131876969-131876991 GATACTTCTCCCAGCCACTAAGG - Intergenic
1107126026 13:36847887-36847909 GAGACTCCTGCTTTCCACAGAGG - Exonic
1107281067 13:38735901-38735923 ATGACTCCTCACAGTCACAGAGG + Intronic
1110775493 13:79404570-79404592 AAGGCTCTTTCCAGCCACAGTGG + Intronic
1110776089 13:79409662-79409684 GATACTGCTATCAGCCACAGTGG - Intergenic
1113838595 13:113346183-113346205 GGGTCTGCTCTCAGCCACAGAGG - Intronic
1113838845 13:113347253-113347275 GGGTCTGCTCTCAGCCACAGAGG - Intronic
1113838887 13:113347431-113347453 GGGTCTGCTCTCAGCCACAGAGG - Intronic
1114066320 14:19062214-19062236 GAGCCTCTGCCCAGCCCCAGGGG - Intergenic
1114095948 14:19337810-19337832 GAGCCTCTGCCCAGCCCCAGGGG + Intergenic
1114559143 14:23578282-23578304 GAGACTGCTCCAACCCAGAGAGG + Exonic
1115690951 14:35843617-35843639 GAGACACCTCCCAGCCGGGGTGG - Intronic
1115721024 14:36161657-36161679 GAGACACCTCCCAGCCGGGGTGG - Intergenic
1116341874 14:43733522-43733544 GACACTGCTCCTACCCACAGGGG + Intergenic
1117162485 14:53002786-53002808 GCCACTCCTCCCTGCCAGAGGGG + Intergenic
1117993413 14:61457084-61457106 GAGACTGCTCCCAGCCAATAAGG + Intronic
1118461149 14:65988476-65988498 GAAACTCCTCCCAGGCCCACAGG + Intronic
1118639114 14:67775978-67776000 GAGAGTCTGCACAGCCACAGTGG + Exonic
1120975558 14:90244944-90244966 GAGATTTCACCCAGGCACAGTGG - Intergenic
1122178732 14:99939419-99939441 GCGACTGCTGCCAGCCACAAAGG + Intronic
1124022956 15:25940437-25940459 GAGATTTCTCCCAGCCCCAGAGG + Intergenic
1124031943 15:26019708-26019730 AGGACACCTCCCAACCACAGTGG - Intergenic
1124119544 15:26876885-26876907 GTTCCTCCTCCCAGCCACACTGG - Intronic
1126242112 15:46456778-46456800 GGCACTGCTCCCAGCCACTGAGG + Intergenic
1128234947 15:66060898-66060920 CAGACTGCTTCAAGCCACAGAGG - Intronic
1128459327 15:67854453-67854475 GTGACTTCCCCCAGCCCCAGTGG - Intergenic
1129690734 15:77711981-77712003 CAGATTCCTCCCATCTACAGTGG + Intronic
1130839984 15:87689340-87689362 GAGTCTCCACCCACCCACATTGG + Intergenic
1131369734 15:91869735-91869757 GACACCCCAGCCAGCCACAGGGG + Intronic
1132452428 15:101975721-101975743 GAGCCACCTCCCAGCCACCTCGG - Intergenic
1132454468 16:14901-14923 GAGCCACCTCCCAGCCACCTCGG + Intronic
1132748211 16:1445684-1445706 CAGACTCCTGCCGGCCTCAGAGG - Exonic
1132999272 16:2840986-2841008 GAGCCTCCTCACAGCCACCAAGG + Intergenic
1133165424 16:3943602-3943624 GGGACTGCTCCCTGCCACACAGG + Intergenic
1136694357 16:32064111-32064133 GTGTCTCTTCCCAGCCACAGTGG + Intergenic
1136748326 16:32611917-32611939 GACACTCCTTCCAGTCACACAGG - Intergenic
1136748609 16:32613927-32613949 AGGATTCCTGCCAGCCACAGAGG - Intergenic
1136794856 16:33007374-33007396 GTGTCTCTTCCCAGCCACAGTGG + Intergenic
1136875053 16:33847011-33847033 GTGTCTCTTCCCAGCCACAGTGG - Intergenic
1137669904 16:50272824-50272846 GCTCCTCCTCCCAGCCAGAGGGG - Intronic
1138195390 16:55048108-55048130 GGGACTCCTCCCTACCCCAGTGG - Intergenic
1138257572 16:55580079-55580101 GAGTCTCCATCCAGCCTCAGGGG - Intronic
1138827081 16:60333624-60333646 GAGACTCCAGCCAGGCGCAGTGG - Intergenic
1139396414 16:66643205-66643227 GCCACTGCACCCAGCCACAGTGG + Intronic
1140253828 16:73318011-73318033 GGGAATCCTCCCAGCTACAGAGG + Intergenic
1140406259 16:74713574-74713596 GGGACTCCTGCCAGCCACCCTGG + Exonic
1141362394 16:83408035-83408057 GTGTCTCCTCCCAGCAGCAGTGG + Intronic
1141642073 16:85347210-85347232 GGGACCCCTCCCAGCCCCAGAGG - Intergenic
1142066389 16:88065364-88065386 GAGACTCCTCCCAGCCACAGAGG - Intronic
1142192649 16:88725043-88725065 GGGGCTCCTCCCCGCCACGGAGG - Exonic
1142413991 16:89931466-89931488 GACACTGCTCCCAGACGCAGCGG + Intronic
1203050461 16_KI270728v1_random:871122-871144 GACACTCCTTCCAGTCACACAGG - Intergenic
1203050742 16_KI270728v1_random:873141-873163 AGGATTCCTGCCAGCCACAGAGG - Intergenic
1203097117 16_KI270728v1_random:1269025-1269047 GTGTCTCTTCCCAGCCACAGTGG + Intergenic
1143048354 17:4101017-4101039 GAGGCTCCTGCCATCCAAAGTGG - Intronic
1143181015 17:4984235-4984257 GAAACTCCTGCCAGGCACAGTGG - Intronic
1145788782 17:27611319-27611341 GAGGCTCCTCCCAGCCCTAGAGG - Intronic
1148395516 17:47304988-47305010 GAGGGCCCTTCCAGCCACAGCGG - Intronic
1148484147 17:47979819-47979841 GAGGCTCCTCCCAGCCTCAAGGG + Intronic
1148536149 17:48440683-48440705 GAGGATCCTCCCACCCTCAGTGG + Intergenic
1148826942 17:50400761-50400783 GATACTTCTCCCAGCCACTAAGG - Intergenic
1148830495 17:50427600-50427622 CAGAGTCCTCCCAGCCTGAGGGG - Intronic
1148981101 17:51575413-51575435 GAGACACCTCCCAGCAGGAGTGG + Intergenic
1149186302 17:54001715-54001737 TAGCCTCCCTCCAGCCACAGTGG + Intergenic
1150863590 17:68826124-68826146 GAGACTCCTCCCTTCAAGAGAGG - Intergenic
1152585163 17:81186032-81186054 GAGACCCCTCCAAGCCCCTGAGG + Intergenic
1152658336 17:81530308-81530330 GAGGCACCTCCCTGCCCCAGTGG + Intronic
1153517560 18:5918393-5918415 GAGACTCCTCCCTACCCAAGTGG - Intergenic
1154189218 18:12214845-12214867 GAGACTCCTCCATGCCTCATAGG - Intergenic
1158745616 18:60196393-60196415 GAGACCCCCCCCAGTAACAGAGG + Intergenic
1160575360 18:79849866-79849888 GAGACTCCACCCAGGCTGAGTGG + Intergenic
1160575380 18:79849927-79849949 GAGACCCCACCCAGGCTCAGTGG + Intergenic
1161236882 19:3202579-3202601 GAGAAACGTCTCAGCCACAGTGG - Intronic
1161416936 19:4152616-4152638 GAGACACCTCTCAGCCACCCGGG + Intergenic
1162477779 19:10911398-10911420 GAGCCTCCTCCTGGCCACTGAGG + Intronic
1162763674 19:12904465-12904487 CAGACTCCACCCAGCGAGAGGGG - Intronic
1162967735 19:14164012-14164034 GACACTCCTGACACCCACAGTGG - Intronic
1164419373 19:28075354-28075376 GGGAGGCCTCCCAGTCACAGTGG + Intergenic
1166851902 19:45765289-45765311 GAGAGGCCTCCCATCCAAAGGGG + Exonic
1167172724 19:47843905-47843927 GAGAATGCTCCCTGCCTCAGTGG + Intergenic
1167556266 19:50197870-50197892 CAGACTTCACCCAGACACAGAGG - Intronic
1168643106 19:58042861-58042883 GAGGATCCTCTCAGCCACAGCGG - Intronic
925403887 2:3592829-3592851 GAGACTCACCCCAAGCACAGTGG - Intergenic
926118221 2:10226539-10226561 GGGAGTCCTGGCAGCCACAGCGG + Intergenic
926234104 2:11026482-11026504 CAGACTCCTCCCATCCACATCGG + Intergenic
926980114 2:18560039-18560061 TGGACTCCTCTCAGCCTCAGCGG + Intronic
927523618 2:23718321-23718343 TAGCCTCCTCACAGCAACAGTGG + Intergenic
927645494 2:24874491-24874513 GAGCCTCCCCCAAGTCACAGAGG - Intronic
929091202 2:38218774-38218796 GAGGTTCCTCCAAGCCCCAGGGG - Intergenic
929281827 2:40088095-40088117 TAGACCATTCCCAGCCACAGAGG - Intergenic
930020391 2:46998320-46998342 GAAACCATTCCCAGCCACAGAGG - Intronic
930776001 2:55171078-55171100 GAGACCCCCCACAGCCACAGTGG + Intergenic
932673555 2:73758545-73758567 GAGACCCTTCCTAGCCACATTGG + Intergenic
932795827 2:74695229-74695251 GAGTCTGCTCCCAGCTACACGGG - Intergenic
934755612 2:96822595-96822617 GAGACTGCGGCCAGGCACAGTGG - Intronic
935574831 2:104698411-104698433 GATACTCCTCTCAGCCTCATTGG - Intergenic
935612692 2:105042231-105042253 CAGACTCTCCCCACCCACAGTGG - Intronic
936380871 2:111984841-111984863 CAGGCTCCTGCCAGCTACAGAGG + Intronic
936568641 2:113598195-113598217 GAGCCACCTCCCAGCCACCTCGG - Intergenic
938119338 2:128622827-128622849 CAGACTCCTGCTAGCCACTGGGG + Intergenic
940723603 2:157309163-157309185 GAGACTCTTCCCATCCCCTGTGG + Intronic
947243484 2:228021046-228021068 GAGACTTGTCCCAGGGACAGTGG + Intronic
947531848 2:230914223-230914245 GAGACTCATCCCAGCACCTGAGG - Intronic
947555865 2:231092734-231092756 GACAGACCTCCCAGCCAAAGTGG + Intronic
948144397 2:235697515-235697537 GTCACCCCTCCCAGGCACAGGGG - Intronic
948263549 2:236621739-236621761 TGGACTCTTCCCAGCTACAGAGG - Intergenic
948477052 2:238227065-238227087 GAGACTCCTCCTGGTTACAGGGG + Intronic
948570220 2:238913137-238913159 GAGACTGTTCCGAGCCCCAGGGG + Intergenic
1170274491 20:14569131-14569153 GAGACACCTCCAAGACACTGAGG - Intronic
1170957916 20:20998207-20998229 GAGACTGTTCTCAGCCTCAGTGG + Intergenic
1172161295 20:32870259-32870281 TGGAGTCCTCCCAGACACAGTGG - Intronic
1173600267 20:44289992-44290014 GCCAATCCTCCCAGCCACTGGGG - Intergenic
1174760261 20:53200231-53200253 GCCTCTCCTCCCTGCCACAGTGG + Intronic
1175824740 20:61930802-61930824 GAGACACCTCCCAACCTCTGTGG - Intronic
1175916061 20:62426574-62426596 GAGTCTCCTCCCACCCTCTGTGG + Intronic
1175920873 20:62450177-62450199 GAGACTTCTGCCACGCACAGGGG - Intergenic
1180079102 21:45478162-45478184 GAGCCTCCTCACACCCACAAGGG - Intronic
1180129384 21:45817302-45817324 GGGACTGCTCACAGCCACAGTGG - Intronic
1180150206 21:45943408-45943430 GAGCCTCCTCCCAGGGGCAGAGG - Intergenic
1180260816 21:46667596-46667618 GAGCCTCCGCCCACCCCCAGAGG - Intergenic
1180484798 22:15784805-15784827 GAGCCTCTGCCCAGCCCCAGGGG - Intergenic
1180994046 22:19955713-19955735 GAGGCACGTCCAAGCCACAGTGG + Intronic
1181108062 22:20586250-20586272 GAGACTGCCCCCTGCCACCGTGG - Intronic
1182275761 22:29187825-29187847 CTGACTGCACCCAGCCACAGAGG + Intergenic
1182479416 22:30597136-30597158 GAGTCTCCTCCCTGCCGCTGTGG + Intronic
1183443554 22:37837845-37837867 GAGACTGCACCCGGCCACACCGG - Intronic
1183673939 22:39289554-39289576 AGGGCTCCTCCCAGCCCCAGTGG - Intergenic
1183954153 22:41369116-41369138 GAGAATCCTCCCTGCCCCACTGG - Intronic
1184112668 22:42404361-42404383 GAGGCTCCCTCCAGGCACAGAGG - Intronic
1184352958 22:43956765-43956787 AAGACTCCTCCCCGCAACAGAGG - Intronic
1184533167 22:45069967-45069989 TTGACTCCTCCCAGGCAGAGAGG + Intergenic
1184739535 22:46419403-46419425 GAGATGCCTCCCACCCATAGAGG - Intronic
1185078169 22:48694476-48694498 GAGACTCCTCCCAGAAACACGGG + Intronic
1185273412 22:49938923-49938945 GGGACTGCTCCCAGCCCCTGTGG + Intergenic
951375993 3:21917770-21917792 GAGACTCCACTTAGCCACTGAGG - Intronic
951525566 3:23649657-23649679 GGGACTCCTGCCTGCCACGGGGG - Intergenic
953990898 3:47482622-47482644 GTTAATTCTCCCAGCCACAGAGG - Intergenic
955564068 3:60225191-60225213 GAGACTCAGGCCTGCCACAGAGG - Intronic
956353427 3:68364090-68364112 GTCACTCCTCCCAGCCCCAGAGG - Intronic
956808253 3:72838775-72838797 GCCACTGCACCCAGCCACAGTGG + Intronic
959196564 3:103190337-103190359 GATACTACTCCCAGCAAGAGAGG - Intergenic
960596879 3:119414978-119415000 GAGGCTCCTCCCAACCAGAAGGG + Exonic
960612744 3:119569973-119569995 GAAACACCTCAAAGCCACAGAGG - Intergenic
961184745 3:124904948-124904970 GATCCTGCTCCCAGCTACAGAGG - Intergenic
961210420 3:125120884-125120906 GAGCCTCCTCCAACCCACAAAGG - Intronic
961432024 3:126890158-126890180 AAGACTCCTCTCAGCCGCACAGG - Intronic
961513529 3:127419187-127419209 GATCCTCCTCCCTGCCACGGAGG - Intergenic
961866542 3:129957456-129957478 GATTCTCCTCCCAGCAGCAGCGG + Intergenic
962251073 3:133836484-133836506 GACACTCCTCTGAGCCACACAGG + Intronic
964977788 3:162640343-162640365 GAGTCTCCTCCCCCCCACCGTGG + Intergenic
965616084 3:170593868-170593890 GAAATTCCTCCAAGCCACATGGG - Intronic
966854143 3:184182708-184182730 GAAACTCCTCCAAGCCCCAATGG + Intronic
967003530 3:185360736-185360758 GAGACTACTCCCATCCATAGTGG + Intronic
967259893 3:187631665-187631687 GAGAGTCCTCACAGACACTGCGG + Intergenic
967929878 3:194683228-194683250 TAGACTCCTCCCTGCCTCTGTGG + Intergenic
968438949 4:611939-611961 GAGCCTTCCCCCAGCCACAGAGG - Intergenic
968744566 4:2353009-2353031 GGGACTCTCCCCACCCACAGAGG + Intronic
968771729 4:2511804-2511826 CACCCTCCTCCCACCCACAGAGG - Intronic
969111399 4:4846514-4846536 GTTAGTCCTCCCAGCCACATGGG - Intergenic
969503132 4:7566649-7566671 GTGTCTCCTCCAAGCCAAAGGGG - Intronic
969605698 4:8201333-8201355 GAGAGGCCTCCCAGACACCGGGG + Intronic
969909115 4:10427505-10427527 GAGACACCTCCCAGTCAGGGAGG - Intergenic
972271174 4:37511861-37511883 AAGAGCACTCCCAGCCACAGTGG + Intronic
974549012 4:63348861-63348883 GAGCCTGCAGCCAGCCACAGAGG + Intergenic
975541246 4:75514365-75514387 CACACCCCTCCCAGCCCCAGCGG + Exonic
980722408 4:136716169-136716191 CAGGCTCCTCCCAGCTGCAGAGG - Intergenic
981006289 4:139878789-139878811 AAGACTGCTCTCAGGCACAGAGG - Intronic
981321786 4:143400228-143400250 GAGACTCAGGCCAGGCACAGTGG - Intronic
981732272 4:147912250-147912272 GAAATTCCTTCCAGGCACAGTGG + Intronic
983003287 4:162447744-162447766 TAAACTCCTCACACCCACAGTGG - Intergenic
984550057 4:181148813-181148835 GACACTCTTCCCTGCCAAAGGGG - Intergenic
985151705 4:186954049-186954071 CAGACTCCTCCCGGGCACCGAGG - Intergenic
985488990 5:168094-168116 GAGACTTCGGGCAGCCACAGAGG + Intronic
986493140 5:8314300-8314322 GCGTCTCCTTCCAGCCACTGTGG - Intergenic
986710037 5:10481941-10481963 GAGAGTCAGGCCAGCCACAGTGG + Intergenic
987616059 5:20276272-20276294 GAGACTCCTCCCTTCAACTGAGG + Intronic
988512177 5:31874013-31874035 AAGACTGCACCCAGGCACAGTGG - Intronic
989775350 5:45200266-45200288 GCCACTGCACCCAGCCACAGGGG - Intergenic
991584990 5:68192883-68192905 GATACTCCTCCCATCTAGAGAGG - Intronic
993707499 5:91187782-91187804 GAGACTGTTGCCAGGCACAGTGG + Intergenic
994387883 5:99153432-99153454 GATATTCCTGCCAGGCACAGTGG - Intergenic
994817446 5:104602032-104602054 CAGAATTCTCCCAACCACAGTGG + Intergenic
995437117 5:112149187-112149209 GAGACTCTGGCCAGGCACAGTGG + Intronic
995478468 5:112571525-112571547 GACTCTACTCCCAGCCACAGGGG - Intergenic
995808641 5:116080883-116080905 GAGACACCTCCCAGCAGCGGTGG + Intergenic
997469162 5:134107217-134107239 GGGACTGCTCACAGCCTCAGAGG + Intergenic
998465402 5:142339866-142339888 GGAACTCCTACTAGCCACAGTGG + Intergenic
1001449382 5:171812509-171812531 GGCACTCCTCCCCTCCACAGTGG + Intergenic
1001600829 5:172927017-172927039 CAGACTCCTCCCATCGATAGTGG + Intronic
1001990483 5:176112302-176112324 AGGATTCCTGCCAGCCACAGAGG - Intronic
1002044582 5:176534750-176534772 GTGAGTCCTCCCAGCAACACTGG + Intronic
1002082977 5:176748467-176748489 GAGGCTACACCCAGCCCCAGAGG + Intergenic
1002226389 5:177725838-177725860 AGGATTCCTGCCAGCCACAGAGG + Intronic
1002267458 5:178045375-178045397 AGGATTCCTGCCAGCCACAGAGG - Intronic
1002758055 6:179867-179889 GAGCCTCCCCCCAGCCGCCGTGG + Intergenic
1004297653 6:14428470-14428492 AGGGCTCCACCCAGCCACAGGGG - Intergenic
1005151482 6:22756833-22756855 GACACTCCTCACAGACACATGGG + Intergenic
1006035043 6:31204800-31204822 GAGACTCCTCTGAGTCTCAGAGG + Intergenic
1007060554 6:38936660-38936682 GTGACTCCTCCCAGCCATTTGGG + Intronic
1012134755 6:95542169-95542191 TATACTCCTACCAGCCACATAGG - Intergenic
1012588458 6:100950570-100950592 GAGACACCTCCCAGCTAAAGTGG - Intergenic
1015717249 6:136205471-136205493 GAGCCTCCTCCCATCTGCAGGGG - Intergenic
1017377512 6:153787870-153787892 GAGACTGTTCCCTGCCACAATGG - Intergenic
1018557057 6:165060804-165060826 AGGCCTCCACCCAGCCACAGAGG + Intergenic
1018576412 6:165264458-165264480 GAGAGCTTTCCCAGCCACAGAGG + Intergenic
1018747821 6:166776035-166776057 GTGCCTCTCCCCAGCCACAGCGG + Intronic
1018798512 6:167205560-167205582 GAGCCTCCTCCGAGTCACTGGGG - Intergenic
1018814196 6:167318605-167318627 GAGCCTCCTCCGAGTCACTGGGG + Intergenic
1018858170 6:167690303-167690325 GATACTGCGCCCAGCCGCAGAGG - Intergenic
1019121150 6:169805127-169805149 GAGACTCTCCACAGACACAGAGG + Intergenic
1019147512 6:169984645-169984667 GACACTGCTCCCAGTCTCAGGGG - Intergenic
1019708753 7:2508843-2508865 GAGACTCCTCTCAGCCTCCCTGG - Intergenic
1020137651 7:5595693-5595715 AAGCTTCCTCCCAGCCACACTGG - Intronic
1021510529 7:21428135-21428157 CAGCCTCCTCCGAGCCACCGCGG + Exonic
1023041690 7:36178400-36178422 CAGACTCCTCTCGGCCACGGGGG + Intronic
1024891544 7:54210165-54210187 CACCCACCTCCCAGCCACAGTGG + Intergenic
1024985859 7:55192606-55192628 GCGCCTCCTCCCGGCAACAGGGG - Intronic
1026368487 7:69674095-69674117 GAGGCTTGTCCCAGACACAGTGG - Intronic
1026523290 7:71134074-71134096 GAGGCTCCACCCATCCACAGAGG + Intronic
1034489904 7:151387560-151387582 GAGACTCCTCAGAGCCGCCGTGG - Intronic
1035157628 7:156927098-156927120 CACACTCGTCCAAGCCACAGAGG + Intergenic
1035286630 7:157810876-157810898 GAGACCCTCCCCAGCCACATCGG + Intronic
1035455621 7:159006802-159006824 GCGACTCCTTCCCGCCACAGAGG + Intergenic
1035472072 7:159116776-159116798 GTGACACCTTCCAGCCAAAGGGG + Intronic
1035629425 8:1096863-1096885 GAGACCTCTCCATGCCACAGAGG - Intergenic
1035629631 8:1097673-1097695 GAGACCTCTCCATGCCACAGAGG - Intergenic
1036550415 8:9810641-9810663 GACAGACCTCCCAGCCAAAGTGG - Intergenic
1037380209 8:18277136-18277158 GAGACTCTTCGCACCCACAGTGG + Intergenic
1037807737 8:22067716-22067738 GAGGCCCCCCCCAGCCACACTGG + Intronic
1039305388 8:36256359-36256381 AAGACTCTTGCCAGGCACAGTGG - Intergenic
1039581635 8:38671494-38671516 GGAACTCATCCAAGCCACAGGGG - Intergenic
1040625504 8:49144954-49144976 TAGAAACCTCCCAGCAACAGAGG - Intergenic
1041810418 8:61902482-61902504 TCGATTCCTCTCAGCCACAGGGG - Intergenic
1042680664 8:71379897-71379919 GAGACTGCTCCCAACCAGATAGG + Intergenic
1044609484 8:94078040-94078062 GCTGCTCCTCCCAGCCAGAGAGG - Intergenic
1046259007 8:111741356-111741378 CAGGCTCCTCCCAGCCACAAAGG - Intergenic
1046661170 8:116949840-116949862 GAGCCTCCTCCCAACCCCCGCGG - Intergenic
1048877134 8:138845657-138845679 GAGACTTCTCTAAGCCACAGAGG - Intronic
1049197766 8:141324934-141324956 AAGGCTCCTCCCACCCACTGTGG - Intergenic
1049581433 8:143412918-143412940 GTGGCCTCTCCCAGCCACAGGGG + Intergenic
1049883886 9:15330-15352 GAGCCACCTCCCAGCCACCTCGG + Intergenic
1052991955 9:34523523-34523545 GAGACCTCTCCCAGATACAGAGG - Intergenic
1053928316 9:43089658-43089680 GAGACTCCCGCCAGCCGCTGGGG - Intergenic
1056083983 9:83126640-83126662 GAGAGTCCTCCCAGGGAAAGTGG - Intergenic
1056708747 9:88973003-88973025 GAGACTCCCCCCACCGGCAGGGG - Intergenic
1058674119 9:107386243-107386265 GAAACTCATCCAAGTCACAGGGG - Intergenic
1059379077 9:113909330-113909352 GATACTCCACCCAGACCCAGGGG - Intronic
1059477809 9:114561840-114561862 GTGGCTCTTCCCAGACACAGGGG - Intergenic
1060088328 9:120721249-120721271 GGGACTCCTGGCAGCCATAGAGG - Intergenic
1061432641 9:130540939-130540961 GTGTCTCCTTCCAGCCACACTGG - Intergenic
1062095358 9:134700311-134700333 GTGACTCCCCAGAGCCACAGAGG - Intronic
1062288075 9:135782303-135782325 GAGACTCCTCTCACACACCGGGG - Intronic
1062303714 9:135890057-135890079 GAGCCTCCTTCCAGGCACGGTGG + Intronic
1062343446 9:136103907-136103929 GGGACTCCTCCCCGCCCCGGAGG - Intergenic
1062444545 9:136588128-136588150 GTGGCTCCTCCCAGCTGCAGGGG + Intergenic
1062609546 9:137367831-137367853 GGGAGTCCACCAAGCCACAGTGG - Intronic
1186806226 X:13142975-13142997 AAGGCACCTCCCAGGCACAGAGG + Intergenic
1189065756 X:37806509-37806531 GAGACTCATCCCAGCCAGTGAGG - Exonic
1189848631 X:45158107-45158129 GCCCCTCTTCCCAGCCACAGGGG - Intronic
1190558527 X:51663730-51663752 GTGACTCCCACCAGCTACAGTGG - Intergenic
1191607454 X:63078243-63078265 ATGATTCCTCCTAGCCACAGTGG + Intergenic
1192311174 X:70015283-70015305 GAAACTCCGGCCAGGCACAGTGG + Intronic
1192717539 X:73660041-73660063 GACAGACCTCCCAGCCAAAGTGG + Intronic
1192810013 X:74538947-74538969 GAGACTCCTCATATCCACAGGGG + Intergenic
1200066285 X:153505595-153505617 TCCACTCCTCCCAGCAACAGAGG + Intronic
1200401925 X:156024829-156024851 GAGCCACCTCCCAGCCACCTCGG - Intergenic